авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Влияние стресс-зависимых изменений текучести мембран нa экспрессию генов у цианобактерии synechocystis sp. pcc

На правах рукописи

МИРОНОВ Кирилл Сергеевич Влияние стресс-зависимых изменений текучести мембран нa экспрессию генов у цианобактерии Synechocystis sp. PCC 6803 03.01.05 — физиология и биохимия растений

Автореферат диссертации на соискание учной степени кандидата биологических наук

Москва — 2011

Работа выполнена в лаборатории молекулярных основ внутриклеточной регуляции Учреждения Российской академии наук Института физиологии растений им. К.А. Тимирязева РАН, г. Москва.

Научный консультант:

доктор биологических наук, профессор Лось Дмитрий Анатольевич

Официальные оппоненты:

доктор биологических наук, доцент Голденкова-Павлова Ирина Васильевна доктор биологических наук, профессор Балнокин Юрий Владимирович

Ведущая организация: Биологический факультет Московского государственного университета им. М.В. Ломоносова, г. Москва

Защита состоится «11» октября 2011 г. в 13 часов на заседании совета по защите докторских и кандидатских диссертаций Д 002.210.01 при Учреждении Российской академии наук Институте физиологии растений им. К.А. Тимирязева РАН по адресу:

127276, Москва, ул. Ботаническая, 35.

Факс: (495) 977 8018, электронная почта: m-azarkovich@ippras.ru;

ifr@ippras.ru Автореферат размещен на сайте ИФР РАН по адресу www.ippras.ru

С диссертацией можно ознакомиться в библиотеке Учреждении Российской академии наук Института физиологии растений им. К.А. Тимирязева РАН.

Автореферат разослан «7» сентября 2011 г.

Учный секретарь совета по защите докторских и кандидатских диссертаций, кандидат биологических наук М.И. Азаркович -2

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Принято считать, что предшественниками хлоропластов высших растений были цианобактерии, типичным представителем которых является Synechocystis sp. PCC 6803 (далее Synechocystis). Этот одноклеточный организм повсеместно используется в качестве модельного объекта для изучения стрессовых воздействий, поскольку характеризуется высокими скоростями роста в широком спектре условий, а также обладает способностью к генетической трансформации путем двойной гомологичной рекомбинации (Grigorieva & Shestakov, 1982). Кроме того, известна полная нуклеотидная последовательность генома Synechocystis (Kaneko et al., 1996).

К сегодняшнему дню накоплено достаточно много знаний относительно ответа Synechocystis на холодовое воздействие. Клетки Synechocystis испытывают состояние холодового шока, если температура окружающей среды снижается по крайней мере на 6 градусов относительно температуры, к которой были адаптированы клетки. При этом индуцируется экспрессия ряда генов: десатураз жирных кислот (ЖК), РНК связывающих белков, РНК-хеликаз, рибосомных белков, протеаз и др. — это было продемонстрировано с использованием микрочипов (Los et al., 1993;

2008). Известно, что часть этих генов экспрессируется под контролем гистидин-киназы Hik33, являющейся сенсором низкой температуры у Synechocystis (Suzuki et al., 2000). Другая часть генов регулируется изменением степени сверхспирализации молекул ДНК Synechocystis (Prakash et al., 2009). Упомянутые регуляторные механизмы играют основную роль в формировании ответа на холодовой стресс. Кроме этого, имеется единичная работа (Kis et al., 1998), выполненная на адаптированных к гетеротрофному росту в присутствии глюкозы клетках Synechocystis, в которой описана индукция транскрипции генов десатураз ЖК при освещении. Однако, вопрос регуляции экспрессии данной группы генов светом в условиях фотоавтотрофного роста так и остатся открытым.

Снижение температуры окружающей среды в первую очередь сказывается на клеточных мембранах, поскольку жидкокристаллическое состояние липидов при этом сменяется кристаллическим (Hazel et al., 1995). В этом случае основной стратегией адаптации к действию пониженных температур представляется повышение степени ненасыщенности остатков ЖК в составе мембран. Известно, что инактивация генов десатураз ЖК desA и desD, отвечающих за синтез полиненасыщенных ЖК в липидах мембран, приводила к снижению текучести мембран у двойного мутанта desA/desD (Tasaka et al., 1996). На этом штамме с применением геномных микрочипов было показано влияние изменения текучести мембран на экспрессию генов (Inaba et al., 2003). Следует иметь ввиду, что упомянутый мутант был получен с использованием кассеты устойчивости к антибиотику хлорамфениколу, который является ингибитором фотосинтеза, поскольку опосредует передачу электронов с фотосистемы -3 I на кислород. Поэтому этот мутант не вполне подходит для изучения физиологических аспектов светозависимой адаптации к условиям стресса.

Цели и задачи исследования. Целью настоящей работы было изучить влияние физического состояния клеточных мембран на экспрессию генов в условиях холодового стресса у цианобактерии Synechocystis. Для достижения поставленной цели были сформулированы следующие задачи:

сконструировать двойной мутант по генам desA и desD и 1) охарактеризовать его способность регулировать ЖК состав в различных условиях;

сравнить ростовые характеристики мутанта desA/desD и клеток дикого 2) типа в нормальных условиях и при пониженной температуре;

исследовать температуро-зависимое изменение текучести мембран у 3) мутанта desA/desD по сравнению с диким типом;

исследовать индукцию экспрессии генов холодового ответа в 4) зависимости от физического состояния (текучести/вязкости) биологических мембран;

исследовать влияние света на индукцию экспрессии генов ответа на 5) низкотемпературный стресс.

Научная новизна. Впервые для различных типов клеточных мембран цианобактерий (наружной, плазматической и тилакоидных) были измерены величины анизотропии поляризации флуоресценции, характеризующие вязкость мембран клеток, выращенных на свету и в темноте. Впервые проведено исследование дифференциальной экспрессии генов при воздействии различными температурами на клетки Synechocystis в зависимости от текучести/вязкости клеточных мембран.

Впервые показана светозависимость индукции генов холодового стресса, находящихся под контролем сенсорной гистидин-киназы Hik33.

Апробация работы. Основные результаты научной работы были представлены на конференциях (Москва, 2009, 2010) и семинаре (Москва, 2011) молодых учных ИФР РАН;

на V молоджной школе-конференции «Актуальные аспекты современной микробиологии» (Москва, 2009), на Всероссийских научных конференциях «Физиология и генетика микроорганизмов в природных и экспериментальных системах» (Москва, 2009), «Устойчивость организмов к неблагоприятным факторам внешней среды» (Иркутск, 2009), «Физиология трансгенного растения и фундаментальные основы биобезопасности» (Москва, 2010) и «Растение и стресс» (Москва, 2010), Международной конференции «Рецепторы и внутриклеточная сигнализация» (Пущино, 2011).

Публикации: по материалам диссертационной работы опубликовано печатных работ, из них 5 являются статьями в рецензируемых журналах.

Структура и объем работы: Диссертация построена по стандартной схеме и включает следующие разделы: введение, обзор литературы, материалы и методы исследования, результаты и их обсуждение, заключение, выводы, список литературы и приложения.

-4 Работа изложена на 122 страницах машинописного текста и содержит 9 таблиц и 32 рисунка. Список цитированной литературы содержит 186 наименований, из которых 168 на иностранных языках.

ОБЪЕКТ И МЕТОДЫ ИССЛЕДОВАНИЯ Объектом исследования в настоящей работе служила культура цианобактерий Synechocystis sp. PCC 6803, штамм GT (Williams, 1988;

Ikeuchi & Tabata, 2001).

Аксеничные культуры цианобактерий поддерживали на агаризованной среде BG-11, забуференной 20 мМ HEPES-NaOH, рН7,5 на чашках Петри при температуре 32°С и постоянном освещении люминесцентными лампами интенсивностью 70 мкЕ·м-2·с-1.

Мутантные культуры цианобактерий поддерживали на той же среде с добавлением соответствующих антибиотиков.

Интенсивные культуры цианобактерий выращивали асептически в культуральных сосудах при температуре 32°С, освещнности 70 мкЕ·м-2·с-1, с постоянным барботированием стерильной газовоздушной смесью, обогащенной СО до концентрации 1,6%. Для перевода в условия интенсивной культуры цианобактерии разводили в необходимом объеме стерильной среды BG-11, перемешивали, и разливали по культуральным сосудам. Таким образом осуществляли синхронизацию роста культур на нескольких сосудах. На 2-4 сутки (OD750 = 2) цианобактерии переносили в условия эксперимента. В качестве показателя роста использовали зависимость OD750 суспензии клеток от времени (в сутках культивирования).

Выделение РНК из клеток Synechocystis. Для выделения РНК экспериментальные образцы (50 мл интенсивной культуры цианобактерий OD750 = 2) фиксировали равным объмом ледяного этилового спирта с 0,5% фенола, после чего выделяли РНК согласно описанным ранее методикам (Kiseleva et al., 2000).

Содержание РНК в пробе оценивали спектрофотометрически.

Анализ экспрессии генов с помощью обратной транскрипции с последующей полимеразной цепной реакцией (ОТ-ПЦР).

1. Дополнительная очистка РНК от ДНК с помощью дезоксирибонуклеазы.

Очистку проводили с помощью DNase I (Fermentas) в соответствии с методиками производителя. Об отсутствии ДНК в образцах РНК судили по результатам ПЦР (см.

п.4).

2. Гель-электрофорез РНК. Степень деградации РНК определяли с помощью гель-электрофореза. Для этого 1 мкг РНК разделяли в 1% агарозном геле при постоянном токе напряжнностью 11 В/см в течение 15 минут. В норме после разделения РНК в геле в присутствии бромистого этидия при освещении ультрафиолетом 254 нм наблюдали 3 мажорных линии, соответствующие рибосомной РНК, при отсутствии следов е деградации.

3. Обратная транскрипция. Для постановки реакции ОТ использовали обратную транскриптазу Superscript III (Invitrogen, США). Реакцию проводили в -5 соответствии с протоколами фирмы-изготовителя фермента, при этом в реакционную смесь добавляли 2 мкг тотальной РНК и обратные ПЦР-праймеры (каждого по пмоль, Табл. 1).

Табл. 1. Праймеры для (ОТ-)ПЦР Рамка Название Прямой праймер Обратный праймер Длина ПЦР считывания гена 53 53 продукта, п.н.

slr1350 desA atgactgccacgattccccc aacttttttcagggagccgaa 1 sll0262 desD atgctaacagcggaaagaatt cgatgctttgccctaggcctc 1 slr0083 crhR gactaatactttgactagtacc ctgttggcgatcactataggc 1 ssr2595 hliB gactagccgcggatttcgcc gagagagagcaaccaacccac sll1441 desB cgtctagaaatttcatcgcc ggtttcttttgatatccacc 1 sll0517 rbpA gtcaatttatgtaggcaacc gtagcggctaccaccatagc Олигонуклеотиды, использованные в качестве праймеров, были синтезированы НПФ "ЛИТЕХ" (Россия).

4. Полимеразная цепная реакция. Амплификацию фрагментов всех исследуемых генов проводили для каждого образца кДНК, полученного в ходе реакции обратной транскрипции, независимо. Реакцию проводили с использованием Hot Start Taq-полимеразы согласно методикам фирмы-изготовителя (Fermetas). Для каждого гена условия проведения реакции, количество кДНК подбирали эмпирически. Отрицательным контролем служила ПЦР с праймерами к гену rbpA1 с добавлением вместо кДНК эквивалентного количества тотальной РНК. Для всех препаратов РНК на электрофорезе отсутствовали 300 п.н.-продукты ПЦР.

5. Гель-электрофорез ПЦР смеси проводили в 1% агарозном геле.

6. Анализ результатов ОТ-ПЦР. Агарозный гель фотографировали и сохраняли в формате tiff для последующего анализа. Для каждой i-полосы на форезе денситометрически определялась интенсивность свечения (Ii) в программе Adobe Photoshop CS5. Каждому эксперименту соответствовало сво суммарное значение интенсивностей свечения всех полос ITotal =. Полученные значения для каждой пробы использовали для численной оценки относительной величины экспрессии для каждой пробы: (Quackenbush, 2002). Таким образом, Ei оказывались нормализованными и допускали качественное сравнение между разными экспериментами. Для всех E было посчитано среднее значение и стандартное отклонение.

Направленный мутагенез генов Synechocystis. Штамм Synechocystis sp. PCC 6803 GT может быть трансформирован путм двойной гомологичной рекомбинации между хромосомной и экзогенной ДНК (Grigorieva & Shestakov, 1982). Полной сегрегации ДНК, несущей мутированный ген, добивались рассеванием цианобактерий -6 до одиночных колоний. О замене гена дикого типа мутантным судили по результатам ПЦР.

Определение содержания жирных кислот (ЖК) в глицерофосфолипидах и индекса ненасыщенности остатков ЖК. Метиловые эфиры жирных кислот (МЭЖК) суммарных липидов из клеток Synechocystis sp. получали согласно известным методикам (Zhukov et al., 1970). Очистку МЭЖК проводили методом препаративной тонкослойной хроматографии. Состав МЭЖК определяли с помощью ГЖХ-МС на приборе Agilent 7890A GC (Agilent Technologies, Inc., США) с 60 м капиллярной колонкой внутренним диаметром 0.25 мм (DB-23, Ser. № US8897617H).

Колонка содержала привитую (50% цианопропил)-метилполисилоксановую полярную жидкую фазу толщиной слоя 0.25 мкм (Tsydendambaev et al., 2004). Для идентификации индивидуальных видов МЭЖК и расчта их количественного содержания в смеси использовали расширенный пакет встроенных рабочих программ MSD Chem Station G1701EA E.02.00.493 и библиотекой спектров NIST.

Индекс ненасыщенности (ИН) суммы ЖК вычисляли как среднее взвешенное количества двойных связей у i-ЖК (Ni) с относительными молярными концентрациями i-ЖК (Ci):.

Разделение клеточных мембран Synechocystis в двухфазной системе.

1,5 л суспензии цианобактерий, выращенных в условиях интенсивной культуры, осаждали, промывали 5 мМ калий-фосфатным буфером рН7,8 с 0,25 М сахарозы, после чего клетки разрушали в прессе Френча при 70 МПа. Полученную суспензию обрабатывали гомогенизатором Поттера и с помощью дифференциального центрифугирования (3 000 g, 10 мин, затем 100 000 g, 30 мин) отделяли клеточные мембраны. Фракционирование мембран проводили в двухфазных 10 граммовых системах на основе полиэтиленгликоля с массовым числом 3 350 г/моль и декстрана Т-500 (Amersham) согласно методикам Norling et al. (1998), Norling (2000) и Huang et al., 2004).

Определение содержания белков в пробе проводили с использованием бицинхониновой кислоты (BCA Protein Assay Reagent, Bio-Rad). Белок солюбилизировали в 2% водном растворе лаурилсульфата натрия, центрифугировали 5 мин при 16 000 g, после чего аликвоту супернатанта использовали для определения белка согласно рекомендациям производителя. Калибровочную кривую строили с использованием разведений раствора БСА в 2% лаурилсульфате натрия.

Разделение белков и вестерн-блоттинг. 20 мкг (на одну пробу) белка разделяли в ПААГ согласно Laemmli (1970). Гель для визуализации фиксировали 50% этанолом с 3% ортофосфорной кислоты, после чего окрашивали коллоидным Кумасси G-250 по Neuhoff et al. (1985). Гель использовали для переноса белков на нитроцеллюлозную мембрану (45 мкм, Hybond-C Extra, GE Healthcare, UK). Перенос осуществляли c помощью Trans-Blot SD Electrophoretic Semi-Dry Transfer Cell (Bio Rad). Мембрану обрабатывали кроличьими антителами против D1-белка -7 фотосистемы II (Agrisera, Швеция), который использовали в качестве маркерного белка тилакоидных мембран. Для визуализации использовали антикроличьи антитела, меченные пероксидазой хрена (GE Healthcare).

Определение анизотропии поляризации флуоресценции (АПФ).

Характеристикой вязкости биологических мембран служит АПФ встраиваемого в мембраны в качестве зонда 1,6-дифенил-1,3,5-гексатриена (ДФГ) (van Blitterswijk et al., 1981;

Jameson & Ross, 2010). Встраивание ДФГ в мембраны Synechocystis sp.

проводили в 3 мл системе на основе PBS-буфера (Medicago AB), содержавшей мембраны (50 мкг белка) и 0,2 мкМ ДФГ. Для этого 3 мкл 0,2 мМ ДФГ в ацетоне медленно добавляли к суспензии мембран в PBS при сильном перемешивании, после чего инкубировали, перемешивая, на льду 30 минут. Величины АПФ, спектры флуоресценции ДФГ, а также суспензий мембран анализировали на флуоресцентном спектрофотометре Fluorescense Specrtophotometer 850 (Hitachi). Критерием встраивания ДФГ служило появление характерных пиков на спектре возбуждения при постоянной длине волны испускающего света 430 нм.

АПФ измеряли при длине волны поглощаемого света 360 нм, испускаемого — 430 нм при температурах от 15° до 50°С с интервалом в 5°С. Расчт величины АПФ проводили по формуле:

где — интенсивность флуоресценции;

индексы обозначают поляризаторы возбуждающего (i) и испускаемого (j) света;

«Н» обозначает горизонтальное положение поляризатора, «V» — вертикальное (Shi & Herschlag, 2009).

Статистическая обработка данных производилась для выборок численных величин по результатам трх повторностей экспериментов. Все данные представлены в виде среднего со стандартным отклонением.

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ Инактивация генов desA и desD у Synechocystis. Гены десатураз Synechocystis sp. PCC 6803 инактивировали последовательно. Сначала цианобактерий трансформировали плазмидной ДНК, несущей ген desA, разрушенный кассетой устойчивости к канамицину. Замещение фрагмента гена desA кассетой устойчивости к канамицину в клетках цианобактерий происходило путм двойной гомологичной рекомбинации по участкам ДНК, фланкирующим ген устойчивости к канамицину.

Таким образом был получен мутант desA. После этого аналогичным образом был получен двойной мутант desA/desD (см. Рис. 1) -8 Рис. 1 Инактивация генов desA (а) и desD desA, 1053 п.н. (б) Synechocystis а AF, AR — прямой и обратный праймеры для амплификации фрагмента гена desA;

DF, DR RgaI RgaI — для desD (см. Табл. 1);

стрелками показаны места отжига праймеров. Kmr, Spr — кассеты устойчивости к канамицину, AF спектиномицину, соотв. Фрагмент desA AR 456 п.н. длиной 456 п.н. был заменен кассетой устойчивости к канамицину. Полученную конструкцию использовали для Kmr трансформации Synechocystis sp. Путем RgaI RgaI обмена гомологичными участками ген дикого типа был заменен мутантным. Ген desD был разрушен аналогичным способом.

1,8 т.п.н.

Степень сегрегации мутантных б desD, 1077 п.н.

хромосом тестировали с помощью ПЦР с использованием ДНК Synechocystis sp.

NcoI PCC 6803 дикого типа, плазмидной ДНК, использованной для получения DF DR мутанта, а также геномной ДНК, выделенной из полученного мутанта.

r Sp На Рис. приведена NcoI NcoI электрофореграмма результатов ПЦР проверки сегрегации мутантных 1,5 т.п.н.

хромосом. Присутствие лишь одной полосы на электрофореграмме свидетельствует в пользу того, что имела место полная сегрегация мутантных хромосом, в ходе которой все гены desA и desD (порядка т.п.н.) были заменены мутантными (2,5-2,7 т.п.н.).

1 2 3 1 2 3 4 5 2,5-2,7 т.п.н.

1 т.п.н.

а б Рис. 2. Результаты ПЦР.

(а) Доказательство мутантности клеток desA. ПЦР с использованием AF и AR праймеров.

Матрицей служила геномная ДНК, выделенная из клеток Synechocystis sp., «1»;

плазмидная ДНК, использованная для трансформации Synechocystis sp., несущая разрушенный ген desA, «2»;

ДНК, выделенная из desA-мутанта, «3». (б) Доказательство получения двойного мутанта desA/desD. Праймеры: «1», «3», «5» — AF, AR;

«2», «4», «6» — DF, DR (см. Рис. 1).

Матрица: ДНК клеток дикого типа «1», «2»;

плазмидная ДНК, использованная для трансформации клеток «3», «4»;

ДНК, выделенная из desA/desD-клеток «5», «6».

Возможность полного разрушения генов desA и desD говорит о том, что в оптимальных условиях роста клетки Synechocystis sp. PCC 6803 могут обходиться без соответствующих десатураз.

-9 Жирнокислотный состав липидов desA/desD-мутанта. Цианобактерий культивировали в условиях интенсивной культуры при 32°С. Результаты определения содержания ЖК в составе липидов Synechocystis приведены на Рис. 3.

Дикий тип desA/desD -18:3;

12,3% 18:1;

18:2;

38,2% 13,9% 16:0;

16:0;

56,3% 56,1% 18:1;

11,5% 18:0;

18:0;

0,8% 0,8% 16:1;

16:1;

5,2% 4,9% Рис. 3. ЖК-состав desA/desD.

Клетки выращивали при 32°С, после чего анализировали ЖК * состав липидов мембран. В клетках дикого типа присутствовали 16:0, 9-16:1, 18:0, 9-18:1, 9,12-18:2 и -18:3 ЖК.

Цифрами обозначено их относительное содержание, мол.%. В клетках мутанта обнаруживались лишь мононенасыщенные ЖК, 16:0, 9-16:1, 18:0, 9-18:1, следовательно, десатуразы DesA и DesD в клетках мутанта были неактивны.

На диаграмме даны условные обозначение ЖК * и их содержание мол.%. В клетках дикого типа накапливались моно-, ди- и триненасыщенные ЖК. В клетках desA/desD отсутствовали ПНЖК, что говорило об отсутствии активностей DesA и DesD в клетках двойного мутанта (Los & Murata, 1998).

Таким образом, нами был получен двойной мутант Synechocystis sp. PCC по генам desA и desD, кодирующим ацил-липидные 12- и 6-десатуразы.

Доказательствами мутантности полученного штамма служили:

1) культивирование на селективной среде, что исключает возможность роста клеток дикого типа;

2) результаты ПЦР, свидетельствующие о полной сегрегации хромосом, несущих мутантные гены десатураз;

3) анализ ЖК-состава липидов.

Параметры роста клеток desA/desD. Ростовые кривые были получены для клеток дикого типа и двойного мутанта desA/desD в условиях интенсивной культуры. Начальная OD750 составляла 0,1±0,01. Клетки инкубировали при температуре 32°С (нормальная температура роста) и при пониженной температуре, 22°С (холодовой стресс). Полученные данные типичного эксперимента представлены на Рис. 4. При 32°С клетки дикого типа сразу вступали в экспоненциальную фазу * ЖК обозначены «X-Y:Z», где X — -номера двойных связей (если они есть);

Y— число атомов углерода в ЖК;

Z — количество двойных связей в ЖК.

- 10 роста, а клетки desA/desD характеризовались непродолжительной лаг-фазой.

Впоследствии скорость роста мутанта приближалась к скорости роста клеток дикого типа. При пониженных температурах клетки дикого типа росли менее интенсивно, desA/desD-клетки гибли. Таким образом, мутантные desA/desD потеряли способность расти при пониженных температурах.

Для всех S-образных ростовых кривых были рассчитаны периоды удвоения (Т1/2), максимальные скорости роста (Vmax) и времена, за которые скорости роста клеток достигали своих максимальных значений (TV) см. Табл. 2.

OD Дикий тип, 32 С desA/desD, 32 С Дикий тип, 22 С desA/desD, 22 С 0 2 4 6 8 10 Время, сут Рис. 4. Кривые роста клеток Synechocystis дикого и desA/desDпри 32оС и 22оС.

Клетки выращивали в условиях интенсивной культуры при 32°С и 22°С. Начальная OD750 = 0,1.

Табл. 2. Параметры роста клеток цианобактерий при 32 С и 22 С Дикий тип, 32°С desA/desD, 32°С Дикий тип, 22°С Т1/2 [час] 13,6 ± 1,2 14,2 ± 2,1 19,1 ± 1, 0,96 ± 0,02 0,93 ± 0,03 0,79 ± 0, Vmax [1/сут] 47 ± 5 68 ± 4 88 ± TV [час] Наиболее коротким периодом удвоения характеризовались клетки дикого типа, росшие при 32°С (13,6 часов). Для клеток мутанта в тех же условиях Т1/2 = 14,2 часа.

Кривая роста desA/desD-мутанта лежит ниже кривой дикого типа при нормальной температуре, что обусловлено более длительным периодом удвоения, а также более - 11 поздним временем достижения Vmax (после пятых суток). Тем не менее значение максимальной скорости роста мутанта почти не отличалось от рассчитанного для клеток дикого типа. Следовательно, отсутствие ПНЖК не сказывается на способности мутанта расти при нормальной температуре. Меняются только параметры роста. Так, кривая desA/desD при 32°С характеризуется более протяжнным линейным участком.

Светозависимость изменения ЖК-состава при пониженной температуре.

Клетки выращивали в условиях интенсивной культуры, после чего инкубировали при пониженной температуре (22°С) 16 часов. При этом часть клеток инкубировали на свету, часть — в полной темноте. Результаты определения содержания ЖК липидов мембран представлены в Табл. 3.

В клетках дикого типа на свету при нормальной температуре накапливаются 16:0;

9-16:1;

9-18:1;

9,12-18:2 и -18:3-ЖК — для которых массовая доля больше 1%.

ИН был равен 0,77. При 22°С содержание олеиновой кислоты (18:1) снижалось более, чем в четыре раза;

массовая доля -линоленовой кислоты увеличивалась в полтора раза. Это связано с активацией десатураз ЖК (в частности, DesB) под воздействием пониженных температур и хорошо согласуется с опубликованными данными (Los et al., 1993). Кроме того, в результате проявления под действием пониженных температур активности 3-десатуразы, появлялись -18:3 и 6,9,12,15-18:4-ЖК, которых не было при нормальной температуре. При этом ИН = 1,03. В темноте при 32°С в клетках дикого типа существенных изменений ЖК-состава не наблюдалось.

При воздействии пониженной температуры в темноте в клетках дикого типа ЖК состав количественно соответствовал таковому при нормальных условиях.

Качественно же расширялся спектр наблюдаемых второстепенных ЖК. Так, были обнаружены 10:0, 12:0, 15:0 и 11-18:1 ЖК.

В клетках мутанта количественно состав ЖК не менялся в различных условиях (ИН = 0,42 ± 0,05 — для всех вариантов эксперимента). Качественные изменения были заметны при действии низкой температуры в темноте, когда обнаруживались 11-18:1 и 15:0 ЖК. Следовательно, desA/desD-мутант не способен регулировать ЖК состав при понижении температуры.

На основании полученных данных была построена схема функционирования системы десатурации ЖК Synechocystis при различных условиях, см. Рис. 5.

- 12 Табл. 3. ЖК состав клеток цианобактерий на свету и в темноте Свет Содержание ЖК, мол.% 32C 22C ЖК Дикий тип Дикий тип desA/desD desA/desD 0,4 ± 0,1 0,5 ± 0,2 0,3 ± 0,1 0,4 ± 0, 14: 57,7 ± 2,5 57,2 ± 1,0 55,8 ± 1,6 57,6 ± 5, 16: 4,7 ± 0,6 5,0 ± 0,1 5,7 ± 0,4 4,3 ± 0, 9-16: 0,2 ± 0,1 0,2 ± 0,1 0,2 ± 0,1 0,3 ± 0, 17: 0,7 ± 0,2 1,1 ± 0,3 0,5 ± 0,1 1,2 ± 0, 10-17: 0,7 ± 0,3 0,7 ± 0,3 0,3 ± 0,1 0,6 ± 0, 18: 10,8 ± 0,9 35,4 ± 1,1 2,6 ± 0,1 35,6 ± 3, 9-18: 13,1 ± 1,3 13,1 ± 0, 9,12-18:2 0 -18:3 11,7 ± 0,8 17,2 ± 0, 0 -18:3 3,0 ± 0, 0 0 1,4 ± 0, 6,9,12,15-18:4 0 0 ИН 0,77 ± 0,05 0,41 ± 0,01 1,01 ± 0,03 0,41 ± 0, Темнота Содержание ЖК, мол.% 32C 22C ЖК Дикий тип Дикий тип* desA/desD** desA/desD 0,4 ± 0,1 0,4 ± 0,2 0,8 ± 0,1 0,5 ± 0, 14: 58,3 ± 3,0 57,0 ± 1,0 56,7 ± 1,6 56,8 ± 5, 16: 4,8 ± 0,5 4,8 ± 0,1 5,4 ± 0,4 5,6 ± 0, 9-16: 0,3 ± 0,1 0,3 ± 0,1 0,3 ± 0,1 0,2 ± 0, 17: 0,7 ± 0,2 1,2 ± 0,3 0,8 ± 0,1 1,3 ± 0, 10-17: 0,7 ± 0,4 0,6 ± 0,3 0,6 ± 0,1 0,5 ± 0, 18: 8,4 ± 0,7 35,7 ± 1,1 9,2 ± 0,1 35,0 ± 3, 9-18: 14,2 ± 1,5 12,8 ± 0, 9,12-18:2 0 -18:3 12,3 ± 1,0 12,5 ± 0, 0 -18:3 0 0 0 6,9,12,15-18:4 0 0 0 ИН 0,79 ± 0,05 0,42 ± 0,01 0,79 ± 0,03 0,42 ± 0, * Появляются ЖК: 10:0, 12:0, 13:0, 15:0, — в сумме 1,0%.

** Появляется 15:0 — 0,1%.

- 13 32 С s n- (22 С, темнота) 1 6: 1 8:0 DesA DesB s n-3 s n-3 s n- 1 6: 1 6: DesC 1 6: 1 8 :2(9, 1 2) 1 8 :1(9) 1 8 :3(9, 1 2, 1 5) DesD DesD s n- s n- 1 6: 16: 1 8 :4(6, 9, 1 2, 1 5) 18:3(6, 9, 12) 22 С s n- (Свет) 1 6: 1 8 :0 DesA DesB s n-3 s n-3 s n- 1 6: 1 6: DesC 1 6: 1 8 :2(9, 1 2) 1 8 :1(9) 1 8:3(9, 1 2, 1 5) DesD DesD s n- s n- 1 6: 1 6: 1 8 :4(6, 9, 1 2, 1 5) 1 8 :3(6, 9, 1 2) Рис. 5. Схема десатурации ЖК Synechocystis в различных условиях.

На основании данных по ЖК в темноте и на свету была построена схема функционирования генов десатураз в зависимости от света при нормальной по пониженной температурах. На свету при холодовом воздействии клетками синтезируются -18:3 и 6,9,12,15-18:4, которые отсутствуют при нормальной температуре. В темноте DesB неактивна (указано пунктиром), поэтому упомянутые ЖК отсутствуют даже при инкубации в условиях пониженных температур. Специфика дегидрирования: DesC, 9;

DesA, 12;

DesD, 6;

DesB, 15 (или 3).

Регуляция физического состояния клеточных мембран светом.

Synechocystis sp. выращивали в условиях интенсивной культуры, после чего инкубировали при 22°С 16 часов на свету и в темноте. Для каждого варианта эксперимента выделяли фракции наружной, плазматической и тилакоидных мембран (НМ, ПМ и ТМ, соотв.). В соответствии с методиками фракции НМ и ПМ могут быть загрязнены ТМ (Norling et al., 1997, 1998;

Huang et al.,2004).

- 14 Поэтому для доказательства чистоты исследуемых фракций использовали вестерн-блоттинг. Мембранные белки разделяли в ПААГ (T = 12,5%, C = 2,7%) и переносили на мембрану, которую обрабатывали первичными антителами к D1-белку фотосистемы II. Результаты вестерн-блоттинга представлены на Рис. 6.

Положение полос на мембране соответствует молекулярному весу D1-белка, который обнаруживался во фракциях тотальных мембран и ТМ, соответствующих тотальным и тилакоидным мембранам. Т.о. нами было показано отсутствие примеси тилакоидных мембран во фракциях плазматической и наружной мембран.

Рис. 6. Анализ белков мембранных 1 2 34 1 2 3 кДа фракций Synechocystis (а) Электрофореграмма белков мембранных фракций после двух 100 фазного разделения.

(б) Вестерн-блот.

«1» — тотальные мембраны;

«2» — фракция ПМ;

«3» — фракция ТМ;

«4» — фракция НМ.

Измерение анизотропии поляризации флуоресценции (АПФ) проводили для трх типов клеточных мембран цианобактерий: НМ, ПМ и ТМ.

Наиболее хорошо ДФГ встраивался в плазматическую мембрану. Для нее уровень фоновой флуоресценции (б) (а) составил не более 5% от максимального.

В то время, как препараты тилакоидных и внешней мембран характеризовались более низким выходом флуоресценции. Результаты измерения АПФ представлены в виде графиков зависимости АПФ от температуры на Рис. 7.

Полученные данные позволяют сделать следующие выводы:

1) мембраны клеток Synechocystis, адаптированных к пониженным температурам, характеризуются сниженной вязкостью, при этом сильнее всего это заметно для НМ;

2) мембраны клеток desA/desD для всех вариантов опыта и для всех фракций характеризуются большей величиной упорядоченности липидов по сравнению с клетками дикого типа;

3) регуляция вязкости клеточных мембран носит светозависимый характер;

4) несмотря на неспособность регулировать степень ненасыщенности ЖК липидов мембран, клетки desA/desD регулировали вязкость мембран в условиях холодового стресса;

5) в формировании ответа на холодовой стресс в клетках Synechocystis посредством изменения величины упорядоченности липидов мембран участвуют несколько факторов, одним из которых представляется индекс ненасыщенности ЖК липидов мембран.

- 15 Дикий тип, 32°С desA/desD, 0,31 0, 32°С 0,29 0, 0,27 0, 0,25 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10 20 30 40 10 20 30 40 Дикий тип, 22°С, desA/desD, 0,31 0, свет 22°С, свет 0,29 0, 0,27 0, 0,25 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10 20 30 40 10 20 30 40 Дикий тип, 22°С, desA/desD, 0,31 0, темнота 22°С, темнота 0,29 0, 0,27 0, 0,25 0, 0,23 0, 0, 0, НМ НМ 0, 0, ПМ ПМ 0, 0, ТМ ТМ 0, 0, 10 20 30 40 10 20 30 40 Рис. 7. Результаты анализа величины АПФ для различных мембранных фракций.

Ось абсцисс — температура, °С;

ось ординат — АПФ. Клетки выращивали при 32°С после чего инкубировали при 22°С в темноте и на свету 16 часов. Показаны результаты измерения АПФ для трех фракций мембран для каждого варианта условий.

Светозависимость экспрессии генов холодового ответа Synechocystis от температуры. Клетки инкубировали при различных температурах (от 32 до 18 с интервалом 2С) в течение 30 минут. Варианты эксперимента: клетки дикого типа, desA/desD, «свет», «темнота», «мутант hik33» и «диурон (DCMU), 20 мкМ». Для проб «22С» из каждого варианта эксперимента реакцию ОТ-ПЦР проводили отдельно, после чего продукты реакций разделяли на электрофорезе и денситометрически определяли уровень свечения полос (E). Эти значения E служили для пересчта данных между различными вариантами эксперимента.

- 16 Свет Темнота (А) 2,5 2, E E desB desB Д 2,0 2,0 ДТ 1,5 1,5 desA/desD 1,0 1, 0,5 0, 0,0 0, 18 tC 32 18 tC 32 30 28 26 24 22 20 30 28 26 24 22 Д Д М М 2, desB E 1, 0, К Д hik33 Д ДМММ Т И ТИ 22С Свет Темнота (Б) E 1, E 1, ДТ hliB hliB Д desA/desD 1,0 1, 0,5 0, 0,0 0, tC 32 18 tC 32 30 28 26 24 22 20 18 30 28 26 24 22 Д Д М М 1, hliB E 0, Д hik33 Д ДМММ К Т И ТИ 22С Рис. 8. Экспрессия генов desB и hliB Synechocystis при различных температурах.

«Е» — экспрессия в относительных единицах;

«Д» — дикий тип;

«М» — мутант desA/desD;

«К» — контроль (32С);

«Т» — темнота;

«hik33» — мутант по гену гистидин-киназы Hik33;

«И» — ингибитор фотосинтеза, диурон (20 мкМ). Клетки инкубировали при различных температурах 30 мин, после чего анализировали экспрессию генов методом ОТ-ПЦР.

Диаграммы показывают относительные численные значения светимости полос на электрофорезе. Внизу каждой панели показано сравнение уровней экспрессии генов в различных условиях и у мутанта hik33- при холодовом воздействии 22°С 30 мин.

- 17 Свет Темнота E 1,5 E 1, crhR crhR 1,0 1, 0,5 0, ДТ 0,0 0, 18 tC 32 30 28 26 24 22 20 30 28 26 24 22 20 tC Д Д М М crhR 1, 0, Д hik33 Д ДМММ К Т И ТИ 22С (Б) Свет Темнота E1,5 E 1, rbpA1 rbpA 1, 1, Д ДТ 0, 0, desA/desD 0, 0, tC 32 30 28 26 24 22 20 18 tC 32 30 28 26 24 22 20 Д Д М М 1, E rbpA 0, К Д hik33 Д ДМММ Т И ТИ 22С Рис. 9. Экспрессия генов crhR и rbpA1 Synechocystis при различных температурах.

«Е» — экспрессия в относительных единицах;

«Д» — дикий тип;

«М» — мутант desA/desD;

«К» — контроль (32С);

«Т» — темнота;

«hik33» — мутант по гену гистидин-киназы Hik33;

«И» — ингибитор фотосинтеза, диурон (20 мкМ). Клетки инкубировали при различных температурах 30 мин, после чего анализировали экспрессию генов методом ОТ-ПЦР.

Диаграммы показывают относительные численные значения светимости полос на электрофорезе. Внизу каждой панели показано сравнение уровней экспрессии генов в различных условиях и у мутанта hik33- при холодовом воздействии 22°С 30 мин.

- 18 Так за единицу экспрессии была принята величина светимости полосы на электрофорезе, соответствующая пробе «22С» для клеток дикого типа на свету.

Гены desB и hliB (см. Рис. 8, панели А и Б, соотв.) демонстрировали светозависимый характер экспрессии, которая в свою очередь зависела от вязкости клеточных мембран. Оба гена находятся под контролем гистидин-киназы Hik33.

Индукция генов crhR и rbpA1 (см. Рис. 9, панели А и Б соотв.) низкими температурами наблюдалась во всех вариантах эксперимента. Экспрессия этих генов не регулировалась Hik33 и не носила светозависимый характер.

Гены desB, hliB и crhR усиливали экспрессию при добавлении диурона.

Очевидно, что на их экспрессию оказывает влияние окислительно-восстановительный статус фотосинтетического аппарата.

ЗАКЛЮЧЕНИЕ Таким образом, вязкость клеточных мембран оказывает влияние на экспрессию генов при низкотемпературном стрессе. Гены, отвечающие на холодовой стресс у Synechocystis можно разделить на две группы. К первой группе относятся гены, экспрессия которых при холодовом стрессе зависит от вязкости клеточных мембран (например, hliB, desB). Эта группа генов находится под контролем сенсорной гистидин-киназы Hik33. Ко второй относятся гены, экспрессия которых индуцируется при снижении температуры независимо от вязкости клеточных мембран (например, crhR, rbpA1).

Гены, экспрессия которых зависит от вязкости мембран и находится под контролем Hik33, демонстрируют исключительно светозависимый характер низкотемпературной индукции. Эксперименты с использованием диурона показали, что эта зависимость не связана с активностью фотосинтетического аппарата.

- 19 ВЫВОДЫ Накопление ПНЖК в клетках Synechocystis, индуцированное снижением 1.

температуры окружающей среды, носит светозависимый характер.

Десатурация в положениях 12 и 6 зависит от света, тогда как 3 (15) осуществляется только на свету. Образование первой двойной связи в положении 9, сопровождающее синтез мононенасыщенных ЖК не зависит от температуры и/или света.

Сконструированный двойной мутант desA/desD не способен синтезировать 2.

ПНЖК и изменять ЖК-состав клеточных мембран, вследствие чего клетки мутанта desA/desD не способны адаптироваться к пониженным температурам ни на свету, ни в темноте.

Клетки Synechocystis способны регулировать текучесть клеточных мембран при 3.

снижении температуры только на свету. Мутант desA/desD может повышать текучесть клеточных мембран при низкотемпературном воздействии, несмотря на полную неспособность синтезировать ПНЖК и регулировать ЖК-состав липидов мембран. Таким образом, обнаружено существование неизвестного ранее механизма регуляции текучести мембран, который не связан с изменениями состава ЖК мембранных липидов.

Экспрессия генов (например, desB, hliB), индуцируемая низкими 4.

температурами и находящаяся под контролем сенсорной гистидин-киназы Hik33, зависит от текучести клеточных мембран. Экспрессия генов низкотемпературного ответа (например, rbpA1, crhR), не регулируемых Hik33, не зависит от текучести клеточных мембран.

Физическое состояние мембран (их текучесть/вязкость) определяет 5.

температурную зависимость экспрессии генов холодового ответа, находящихся под контролем гистидин-киназы Hik33. Экспрессия носит светозависимый характер, но не зависит от активности фотосинтетического аппарата.

- 20 Список публикаций 1. Миронов К.С. (2009) Изучение экспрессии гена 3-десатуразы, desB, у мутанта Synechocystis sp. PCC 6803 с измененным жирнокислотным составом мембранных липидов. ХVI международная конференция студентов, аспирантов и молодых ученых «Ломоносов – 2009», тезисы докладов, с. 98.

2. Миронов К.С., Лось Д.А. (2009) Влияние текучести клеточных мембран на экспрессию гена desB у Synechocystis sp. PCC 6803. Бюллетень МОИП. Отдел биологический Т. 114(2): 141-142.

3. Миронов К.С., Лось Д.А. (2010) Экспрессия гена 3-десатуразы жирных кислот регулируется физическим состоянием клеточных мембран у Synechocystis sp. PCC 6803. Годичное собрание общества физиологов растений России. Тезисы докладов, Москва, с. 75.

4. Синетова М.П., Миронов К.С., Зорина А.А., Зинченко В.В., Лось Д.А.

(2010) Функциональная геномика цианобактерий: мутагенез регуляторных компонентов, вовлеченных в стрессовые ответы. Тезисы трудов III-го Всероссийского симпозиума «Физиология трансгенного растения и фундаментальные основы биобезопасности». Москва, с. 74.

5. Лось Д.А., Зорина А.А., Синетова М.П., Миронов К.С. (2010) Сенсорные системы цианобактерий. Тезисы Всероссийского симпозиума «Растение и стресс», Москва, с. 221.

6. Los D.A., Zorina A., Sinetova V., Kryazhov S., Mironov K., Zinchenko V.V.

(2010) Stress sensors and signal transducers in cyanobacteria. Sensors 10: 2386-2415.

7. Миронов К.С., Максимов Е.Г., Лось Д.А. (2011) Влияние изменения вязкости клеточных мембран на экспрессию гена desB у Synechocystis sp. PCC Международной конференции "Рецепторы и внутриклеточная 6803.

сигнализация”. Тезисы докладов, Москва, 323.

8. Зорина А.А., Миронов К.С., Степанченко Н.С., Синетова М.А., Коробан Н.В., Зинченко В.В., Куприянова Е.В., Аллахвердиев С.И., Лось Д.А. (2011) Системы регуляции стрессовых ответов у цианобактерий. Физиология растений 58: 643-663.

9. Миронов К.С., Максимов Е.Г., Максимов Г.В., Бедбенов В.С., Лось Д.А.

(2011) Обратная связь между текучестью мембран и транскрипцией гена desB, кодирующего 3-десатуразу жирных кислот у цианобактерии Synechocystis.

Молекулярная биология - в печати.

10. Mironov K.S., Sidorov R.A., Trofimova M.S., Bedbenov V.S., Tsydendambaev V.S., Allakhverdiev S.I., Los D.A. (2011) Light-dependent cold induced fatty acid unsaturation, changes in membrane fluidity, and alterations in gene expression in Synechocystis. Biochim. Biophys. Acta (Bioenergetics) – in press.

- 21

 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.