авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Влияние цитокининов и салициловой кислоты на экспрессию генов митохондриальных белков

На правах рукописи

БЕЛОЗЕРОВА Наталья Сергеевна Влияние цитокининов и салициловой кислоты на экспрессию генов митохондриальных белков 03.01.05 – физиология и биохимия растений

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Москва – 2010

Работа выполнена в лаборатории экспрессии генома растений Учреждения Российской академии наук Института физиологии растений им. К.А. Тимирязева РАН, Москва

Научный консультант:

Кандидат биологических наук Пожидаева Елена Станиславовна

Официальные оппоненты:

Доктор биологических наук, профессор Одинцова Маргарита Семёновна Доктор биологических наук Клячко Нелла Леопольдовна Ведущее учреждение:

Московский государственный университет им. М.В. Ломоносова, биологический факультет.

Защита состоится «25» января 2011 г. в 11:00 часов на заседании диссертационного совета Д 002.210.01 при Учреждении Российской академии наук Институте физиологии растений им. К.А. Тимирязева РАН по адресу: 127276, Москва, Ботаническая ул., 35.

Факс:(499)977-80-18;

электронная почта: m-azarkovich@ippras.ru;

ifr@ippras.ru

С диссертацией можно ознакомиться в библиотеке Учреждения Российской академии наук Института физиологии растений им. К.А. Тимирязева РАН.

Автореферат разослан « 24 » декабря 2010 года

Ученый секретарь совета по защите докторских и кандидатских диссертаций, кандидат биологических наук М.И. Азаркович

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Фитогормоны оказывают влияние на различные стороны развития растений, включая рост, дифференцировку и морфогенез (Кулаева, 1973;

Кулаева, Кузнецов, 2002). При этом неизбежно возникают существенные изменения в интенсивности и характере основных процессов клеточного метаболизма, включая дыхание. Поскольку митохондрии занимают центральное место в метаболизме клетки, в первую очередь, как основные поставщики энергии и промежуточных метаболитов, маловероятно, чтобы регуляция их активности оказалась вне сферы действия фитогормонов.

Митохондрии растений, наряду с основным цитохромным путем окисления, обладают альтернативным путем переноса электронов, шунтирующим два пункта сопряжения в ЭТЦ. Постулируется, что функционирование шунтирующих механизмов увеличивает способность растений к адаптации при изменении эндогенных и экзогенных факторов (см. обзор Грабельных, 2005). В этой связи возрастает интерес к изучению механизмов регуляции энергетики дыхания, включая изучение роли фитогормонов в этом процессе.

Выбор в качестве объекта исследований люпина желтого обусловлен его чувствительностью к экзогенным гормонам, в частности цитокинину. Для него оптимизирована схема постановки экспериментов, которая позволила изучить регуляцию фитогормонами экспрессии ядерных и хлоропластных генов, и биогенеза хлоропластов (см. обзор Кулаева, Кузнецов, 2002;

см. обзор Романов, 2009). Однако крайне мало известно о механизмах действия фитогормонов на митохондрии растений, в частности люпина, о гормональной регуляции митохондриального генома, а также о регуляции митохондриальных генов ядерного кодирования, включая гены альтернативной оксидазы (АО) (Miller et al., 2010). Дополнительные сложности создает отсутствие полной нуклеотидной последовательности ядерного, митохондриального и пластидного геномов люпина.

Цели и задачи исследования. С целью выяснения механизмов действия фитогормонов на функциональную активность митохондрий растений на примере этиолированных семядолей Lupinus luteus L. в данной работе были поставлены следующие основные задачи:

1) Для семядолей L. luteus провести подбор оптимальных условий действия цитокинина (6-бензиламинопурина, 6-БАП) и салициловой кислоты (СК) (концентрации гормона, способы обработки растительного материала);

2) Изучить влияние экзогенных 6-БАП и СК на интенсивность дыхания в семядолях L. luteus и на активность различных путей митохондриального окисления в условиях in vivo;

3) Исследовать методом run-on транскрипции влияние 6-БАП и СК на регуляцию интенсивности транскрипции митохондриальных генов, кодирующих органельные белки комплексов основного цитохромного пути дыхания, тРНК и рРНК у L. luteus;

4) Идентифицировать гены альтернативной оксидазы цианид-резистентного пути окисления у L. luteus для дальнейшего анализа эффекта 6-БАП и СК на экспрессию АО.

Научная новизна работы. Впервые для семядолей L. luteus изучено влияние 6 БАП и СК на интенсивность транскрипции митохондриальных генов, кодирующих органельные белки комплексов основного цитохромного пути дыхания. Показана дифференциальная регуляция интенсивности транскрипции изучаемых генов при воздействии указанных фитогормонов.

При помощи ПЦР с парой вырожденных праймеров изолированы нуклеотидные последовательности фрагментов генов АО, предположительно, относящиеся к двум разным подсемействам.

На фоне активации альтернативного пути окисления в ответ на обработку СК показана положительная регуляция АО на уровне мРНК и белковых продуктов. 6 БАП не оказывает достоверного влияния на экспрессию АО и на альтернативное дыхание, но 6-БАП усиливает окисление по цитохромному пути.

Практическое значение работы. Полученные в диссертационной работе результаты имеют как фундаментальное, так и прикладное значение. Показанные данные способствуют формированию целостного представления о путях действия фитогормонов на митохондрии растений - от гена до функции. В настоящее время нет информации о регуляции гормонами транскрипции митохондриальных генов, а также о влиянии цитокинина на экспрессию генов митохондриальных белков ядерного кодирования. Идентификация генов АО у L. luteus позволяет изучить регуляцию альтернативного пути дыхания и дополняет информацию об эволюции этих генов.

Апробация работы. Основные результаты работы были представлены на Международной конференции «Физико-химические основы структурно функциональной организации растений» (Екатеринбург, 2008), Международной конференции «Plant Abiotic Stress – from signaling to development» (Эстония, Тарту, 2009), Международной конференции «Физико-химические механизмы адаптации растений к антропогенному загрязнению в условиях Крайнего Севера» (Апатиты, 2009), в приглашенном докладе на Зимней студенческой школе «Биология растительной клетки» (Пущино, 2009), XVII Международной научной конференции студентов, аспирантов и молодых ученых «Ломоносов - 2010» (Москва, 2010), Всероссийском симпозиуме «Растение и стресс» (Москва, 2010) и на Всероссийской, с международным участием, конференции молодых ученых, посвященной 90-летию Уральского государственного университета им. А.М. Горького «Биология будущего:

традиции и инновации» (Екатеринбург, 2010).

Публикации. По материалам диссертационной работы опубликовано печатных работ, из которых 2 статьи в рецензируемых журналах.

Структура и объем работы. Диссертация состоит из следующих разделов:

введение, обзор литературы, материалы и методы исследований, результаты и их обсуждение, заключение, выводы и список литературы. Работа изложена на страницах машинописного текста, содержит 11 таблиц, 37 рисунков.

ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Объектом исследования являлись этиолированные семядоли и проростки Lupinus luteus (сорт «Дружный»), проростки Glycine max (L.) Meer.

Обработку гормонами проводили согласно схеме, описанной для люпина (Kusnetsov et al., 1994). Проращивание семян и экспонирование семядолей производили в климатической камере, в темноте при температуре 24С. Семядоли экспонировали на воде или на водных растворах, содержащих 20 мМ Трис-HCl (pH 8.0), СК + 20 мМ Трис-HCl (pH 8.0), 6-БАП + 20 мМ Трис-HCl (pH 8.0) в течение 12 ч.

Дыхательную активность определяли по поглощению кислорода, которое регистрировали полярографическим методом на полярографе LP 7 (Чехия) (Шольц, Островский, 1975). Семядоли или суспензию митохондрий вносили в полярографическую ячейку, термостатируемую при 25°С в воде или буфере выделения митохондрий, соответственно. Для определения общей скорости дыхания (Vt), скорости цианид-резистентного (VKCN) и остаточного (Vres) дыхания применяли ингибиторный анализ с использованием цианида калия и салицилгидроксамовой кислоты (СГК) в концентрациях для семядолей 4 мМ и 20 мМ, соответственно;

для изолированных митохондрий - 1 мМ и 3 мМ, соответственно (Moller et al., 1988).

Максимальную активность альтернативного дыхания (Valt), определяли по изменению скорости дыхания ткани после добавки CГК в присутствии KCN, а уровень цитохромного дыхания (Vcyt) – по изменению скорости поглощения кислорода после добавки цианида на фоне СГК (McDonald et al., 2002). Вычисление уровня цианид-резистентного дыхания (ЦРД) проводили по формуле:

ЦРД = (VKCN / Vt) * 100%. При измерении дыхания семядолей скорость поглощения кислорода выражали в нг-атомах О2 в мин на г сухого/сырого веса. В случае измерения дыхания в суспензии митохондрий - в нг-атомах О2 в мин на мг белка.

Митохондрии выделяли по Giege et al. (2000) методом дифференциального центрифугирования и последующей очисткой в градиенте плотности сахарозы с изменениями. В данной работе для изучения интенсивности транскрипции митохондриальных генов был оптимизирован метод run-on транскрипции (Giege et al., 2000;

Binder et al., 1995). Подбор праймеров для исследуемых генов осуществляли при помощи программы Vector NTI. Характеристика праймеров представлена в таблице 1.

Для биоинформационного анализа нуклеотидных и аминокислотных последовательностей использовали следующие программы и интернет ресурсы:

Vector NTI, SeqScanner, BioEdit, NCBI, СDD на сервере NCBI, ExPASY и MITOPORT.

Таблица 1. Список праймеров, использованных для ПЦР.

длина ПЦР исходная название последовательность темп.

№ продукта, последова гена праймеров (5'-3') отжига п.н. тельность s - aaatcaataggtgccggagctgcta Arabidopsis thaliana, 60 1 atp as - tgcgatcggaaaacgaatgaga D A. thaliana, s - aggagaggaatacccaatcgatgaa 60 548 NC_001284, region:

2 ccmB as - cataagcagatcttcccctccacac 30463- s - ggtgcgatgagtctcatccgtgta A.thaliana X 62 3 cob as - ggttcggttcgttagcaggtattt A. thaliana, s - cttcggtgccattgcaggagtgat 62 875 NC_001284, region:

4 cox as - tgatcatggtagctgcggtgaagta 349830- s - aatgggaataaccgaaccacgtcta A. thaliana, 60 5 cox as - aagggggtgcaacacttctcagtt NM_ s - tgcggagttgattatccctctcg L. luteus, AF 64 6 nad as - ctacgctgttcccaaggactagcaa s - cgagccctgctttggtctct L. luteus, AF 64 7 nad as - tcgtcggaaaacatcctgtctt s- atcccactcggtcttccttttc L. luteus, AF 64 8 nad as - tgccctatcactatggattactccc s- gagcgatgcctacattcaatcaa L. luteus, AF 70 9 rps as - gcctcttcttcgatccggaa s - gaatttgcttgcgagcagtcctt Zea mays, AF 60 10 rps as - ggagctagatcacttcccgatgaac s - cagcgtcggtagggacccaga L. luteus, Z 60 11 rrn as - gcacgtaggcggtgaatcgg A. thaliana, s - tcctggaagtttcaaccttc 48 300 NC_001284, region:

12 rrn as - tggagcgaattggatgat 8848- s - taaggggtggtaggcttagtagggc A. thaliana, 60 13 trnI as - ttgggcattcctgggaagagg NC_ s - ttcgcttcaaccaaatatttcgtc Зубо Я.О. (не опубл.

58 14 atpE as - cgtattaccaaaccacgccccta данные) s - tggaccagaagcaagcaaga Зубо Я.О. и др., 60 15 nad F as - tcgcaactgcaccaaggaat A. thaliana, s - gattgggcgtaaagcgtctgtagg 60 224 NC_000932 region:

16 rrn as - ccatttgctcccctagctttcgt 101012- A. thaliana, s - ggtaggggagcgttccgcc 61 164 NC_000932 region:

17 rrn as - ccctgactcaccctccgtgga 104691- s - gggaggaatgcaaatctttgtgaa Lupinus polyphyllus, 72 18 Ubq as - cacggagacgtaaaacaaggtgaa X Таблица 1. Список праймеров, использованных для ПЦР (продолжение).

длина ПЦР исходная название последовательность темп.

№ продукта, последова гена праймеров (5'-3') отжига п.н. тельность A. thaliana, D89875, NM_113135, D89875, NM_113134, s - atgaccttcatggaagtggcaa 19 Аох1 64 120 AB003175, as - gtgtgcgaatttaggtgacaacaa AB003175, NM_113678, NM_ G. max X А. thaliana s - actatggtggaacttgtgaagccta AB003176, 20 Аоx2а 69 as - tgagccaccttcggggag NM_ G. max U А. thaliana s - ccatggtggagcttgtgaagcctgt AB003176, 21 Аох2b 68 as - tgtgcccctttggcgaga NM_ G. max U Aox (Р1) s - gargcnkanaaygarmgnatgcayyt 70- 176 см. текст (Р2) as - gcytcytcytcnarrtancc 68- s - ttcctcctcgaagtagccgacaa LlAox1, LlAox2, 65 23 LlAox as - ggcggaaaatgaaagaatgcat см.главу Примечание: № 1-13 гены митохондриального кодирования;

№ 14-17 гены пластидного кодирования;

Ubq и Aox гены ядерного кодирования;

s – прямой праймер;

as- обратный праймер.

Выделение ДНК, ПЦР-анализ, выделение РНК и иммунохимический анализ проводили по стандартным методикам (Sambrook et al., 1989;

Chomczyncski et al., 1987;

Laemmli, 1970). Клонирование фрагментов генов проводили в вектор pTZ57R/T согласно рекомендациям фирмы-производителя («Fermentas»). Секвенирование проводили на оборудовании Applied Biosystems в ЗАО «Синтол» (Москва). Анализ методом ОТ-ПЦР проводили согласно рекомендации фирмы-производителя обратной транскриптазы («Fermentas»). В качестве референтного гена использовали ген убиквитина (Ubq).

Количество белка определяли по Бредфорд (Bredford, 1976) или бицинхониновым методом (Stoscheck, 1990), в качестве стандарта использовали БСА.

Содержание белка АО определяли с использованием коммерческих поликлональных антител (AS04054, «Agrisera»).

Все эксперименты проводили в 3-кратной биологической и аналитической повторности. Для всех полученных данных были рассчитаны средние арифметические значения и их стандартные отклонения (Лакин, 1973).

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ 1. Изучение действия СК и 6-БАП на дыхание семядолей L. luteus.

Изменение скорости различных путей митохондриального окисления является одной из главных характеристик, демонстрирующих изменения в функционировании митохондрий. В данной работе была разработана схема экспериментов, которая опиралась на данные по действию гормонов на биогенез пластид L. luteus (Kusnetsov et al., 1994). В качестве контроля использовали семядоли, инкубированные в течение 12 часов на растворе 20 мМ Трис-HCl (рН 8.0), который также добавляли в раствор фитогормонов для улучшения их проникновения в ткани. В предварительных экспериментах была показана активация скорости дыхания по цитохромному пути (Vcyt) при инкубации семядолей на 20 мМ Трис-HCl (рН 8.0) по сравнению с показателями дыхания семядолей, инкубированных на воде, что учитывали при пересчете данных.

1.1. Влияние СК на активность различных путей митохондриального окисления в тканях этиолированных семядолей Для подбора L. luteus.

действующей концентрации СК было изучено влияние 100 мкМ, 500 мкМ и 1 мМ СК на интенсивность дыхания этиолированных семядолей L. luteus (рис. 1А, Б).

В качестве действующей концентрации СК был выбран 1 мМ раствор, который активирует общее дыхание на 43 %. Это происходит за счет увеличения максимальной скорости альтернативного пути окисления (Valt) на 131 % по сравнению с контролем (рис. 1Б). Увеличение общего дыхания при действии 1 мМ СК отчасти может быть связано и с активацией остаточного окисления (Vres).

Данный эффект СК сохраняется и при пересчете скоростей дыхания на сырой вес семядоли.

скорость поглощения нг-атом О2/ мин г сух 1200 О кислорода, ЦРД, % О О веса О 60 А 600 А 40 А А Ц Ц Ц 0 Ц К 100 500 К 100 500 концентрация СК, мкМ Б А концентрация СК, мкМ Рис. 1. Влияние салициловой кислоты на показатели скорости дыхания и соотношение дыхательных путей семядолей люпина желтого: изменение доли цианид резистентного дыхания (А);

изменение скорости цитохромного пути окисления, максимальной скорости альтернативного дыхания и остаточного дыхания при пересчете на сухой вес (Б). Контроль (К) - 20 мМ Трис-HCl (рН 8.0). Ц – Vcyt, скорость цитохромного пути окисления;

А – Valt, максимальная активность альтернативного пути окисления;

О – Vres, скорость остаточного дыхания. Бары отражают стандартные отклонения при трех независимых повторах эксперимента.

Подтверждением правильности выбора концентрации гормона служило также то, что аналогичные данные с использованием 1 мМ СК получены Matos et al. (2008) на гипокотилях G. max. Кроме того, активация АО при действии СК показана на различных видах растений (Clifton et al., 2006;

Fung et al., 2006;

Norman et al., 2004).

Выбор такой высокой концентрации СК может обуславливаться, в том числе, быстрым поглощением и интенсивной метаболизацией этого фитогормона в клетках растений. В частности, в работе Chen et al. (2001) было показано, что более 85 % СК, поглощенной клетками табака, метаболизируется в течение 5 часов. Это свидетельствует, что выбор в качестве действующей концентрации СК 1 мМ, является вполне оправданным и именно такая концентрация позволила получить в данном исследовании отчетливый эффект этого фитогормона на определяемые параметры дыхания семядолей.

Необходимо отметить, что при использовании 100 мкМ СК в данном исследовании выявлено увеличение скорости окисления по цитохромному пути (Vcyt), однако эти отличия были недостоверными при сравнении с контролем (рис. 1Б). Отсутствие достоверного увеличения Valt при действии 100 мкМ может быть следствием недостаточной концентрации гормона или ограниченностью его проникновения в ткани семядолей (Norman et al., 2004). Как при воздействии 500 мкМ, так и 1 мМ СК наблюдается достоверное увеличение доли цианид резистентного дыхания (ЦРД) (рис. 1А). Это происходит за счет увеличения Valt, рассчитанной на грамм сухого веса, на фоне уменьшения Vcyt (рис. 1Б). Однако при действии 500 мкМ СК это не приводит к увеличению общего дыхания.

1.2. Влияние 6-БАП на активность различных путей митохондриального окисления в тканях этиолированных семядолей L. luteus. Литературные данные об эффекте различных концентраций 6-БАП противоречивы и неоднозначны. В частности, существуют сведения о подавлении альтернативного пути митохондриального окисления (Miller, 1979, 1980;

Musgrave, Siedow, 1985), либо о подавлении общего дыхания за счет ингибирования НАДН-дегидрогеназ (Miller, 1982;

Sue et al., 1997) при действии цитокининов. В большинстве работ используемые концентрации гормона значительно превышали эндогенное содержание цитокининов в растительном соке, которое составляет десятки нМ (см. обзор Романов, 2009).

Поскольку диапазон используемых концентраций весьма широк, то в ходе этого исследования было использовано несколько концентраций данного гормона: 1 мкМ, 10 мкМ, 22 мкМ, 50 мкМ, 100 мкМ и 200 мкМ.

скорость поглощения нг атом О2/мин г сух О О О ЦРД, % кислорода, А О А А 40 900 О веса А 30 600 А О О Ц Ц Ц 20 А А Ц Ц Ц Ц К 1 10 22 50 100 К 1 10 22 50 100 А Б концентрация 6-БАП, мкМ концентрация 6-БАП, мкМ Рис. 2. Влияние 6-бензиламинопурина на показатели скорости дыхания и соотношение дыхательных путей семядолей люпина желтого: изменение доли цианид резистентного дыхания (А);

изменение скорости цитохромного пути окисления, максимальной скорости альтернативного дыхания и остаточного дыхания при пересчете на сухой вес (Б). Контроль (К) - 20 мМ Трис-HCl (рН 8.0). Ц – Vcyt, скорость цитохромного пути окисления;

А – Valt, максимальная активность альтернативного пути окисления;

О – Vres, скорость остаточного дыхания. Бары отражают стандартные отклонения при трех независимых повторах эксперимента.

Обнаружено, что 6-БАП уменьшает долю ЦРД в общем дыхании изолированных этиолированных семядолей L. luteus при действии всех выбранных концентраций, за исключением концентрации 100 мкМ (рис. 2А). Однако, наблюдаемый эффект достигается за счет различных механизмов. В малых концентрациях гормон (1-22 мкМ) вызывает постепенную активацию общего тканевого дыхания (рис. 2Б). Это происходит из-за увеличения активности цитохромного пути окисления. Повышение концентрации приводит к исчезновению эффекта 6-БАП на цитохромный путь дыхания. Цитокинин в концентрации 50 мкМ и 100 мкМ подавлял общее тканевое дыхание за счет значительного снижения по сравнению с контролем Valt на 73 % и 97 %, соответственно (рис. 2Б). Отсутствие эффекта 200 мкМ 6-БАП может быть следствием смены метаболических путей и, как результат, смены окисляемого субстрата. В работе Dizengremel et al. (1982) на препарате митохондрий показано, что при окислении сукцината и малата концентрации 6-БАП, подавляющие дыхание, различаются.

Увеличение уровня ЦРД (рис. 2А) на фоне уменьшения максимальной активности альтернативного окисления (рис. 2Б) происходит за счет увеличения уровня остаточного дыхания. При действии 100 мкМ 6-БАП происходит активация Vres на 27% (по сравнению с контролем) и Vres составляет 55 % от общего дыхания ткани. Известно, что 6-БАП активирует обменные процессы, включая окислительные процессы (Dezsi, Farkas, 1964;

Kuper et al., 1991, 1992;

Кулаева, 1973), что, видимо, и является причиной активации остаточного дыхания ткани. Кроме того, длительная инкубация с высокими концентрациями 6-БАП вызывает синтез эндогенного этилена и оксида азота (Carimi et al., 2005;

Vogel et al., 1998), которые являются важными сигнальными молекулами растений. Вероятно, наблюдаемый эффект при действии различных концентраций 6-БАП является совместным эффектом различных регуляторных компонентов, таких как цитокинин, этилен и оксид азота.

Проанализировав полученные данные, и сопоставив их с ранее опубликованными исследованиями по влиянию 6-БАП на интенсивность дыхания митохондрий, концентрация 22 мкМ 6-БАП была выбрана для дальнейшей работы на изолированных этиолированных семядолях L. luteus. В этой концентрации 6-БАП не вызывает изменения Valt по сравнению с контролем (рис. 2Б), в то время как Vcyt увеличивается на 128 %, что может быть следствием активации метаболизма клетки.

Достоверность этих результатов сохраняется и при пересчете скоростей дыхания на сырой вес семядоли. Таким образом, в данной работе впервые показана активация митохондриального дыхания синтетическим аналогом природного цитокинина 6 БАП.

2. Изучение влияния 6-БАП и СК на скорость транскрипции митохондриальных генов. Поскольку метод run-on транскрипции позволяет изучить интенсивность синтеза индивидуальных мРНК, то при помощи этого метода можно получить, хотя и не окончательный, но ответ на вопрос, как под влиянием фитогормона изменилось содержание мРНК. Были отобраны гены, кодирующие компоненты различных комплексов ЭТЦ: комплекс I - ndh;

комплекс III - cob;

комплекс IV – ccmB и cox гены;

АТФ-синтазный комплекс – atp9, а так же гены белоксинтезирующей системы митохондрий: рибосомальные РНК – rrn26 и rrn гены, рибосомальные белки – rps12 и rps13 гены, ген транспортной РНК для изолейцина – trnI. Все отобранные для изучения гены митохондриального кодирования. С целью оценить возможный вклад пластидных транскриптов были выбраны пластидные гены, экспрессирующиеся с высокой интенсивностью (atpE, nadF, rrn16, rrn23). Следует подчеркнуть, что возможная перекрёстная гибридизация была исключена путем проверки на гомологию фрагментов митохондриальных генов с четырьмя пластомами, а пластидных - с четырьмя митохондриальными геномами.

На первых этапах работы использовали митохондрии, полученные дифференциальным центрифугированием. Однако органеллы, выделенные таким образом, имели очень низкую транскрипционную активность in vitro и в дальнейшем использовали митохондрии, очищенные в сахарозном градиенте.

А В Б Рис. 3. Данные полярографических исследований различных фракций, полученных в результате очистки митохондрий люпина в градиенте плотности сахарозы (А) и радиоавтограф run-on транскрипции с митохондриями 2-й фракции в оптимизированных условиях (Б). Фракции, содержащие митохондрии (МХ), инкубировали в реакционной среде, куда дополнительно вносили 200 мкМ АДФ и 10 мкМ сукцината (СК). Численные значения кривых показывают скорость поглощения кислорода митохондриями в нг-атомов О2/(мин мг белка) (В). cox3, nad9, atp9, – митохондриальные гены, rrn16 - пластидный ген.

Функциональную активность органелл определяли полярографическим методом (рис. 3А, В) и затем использовали данную фракцию митохондрий для подбора транскрипционной системы (Giege et al., 2000), которая отличалась от других систем (Binder et al., 1995;

Зубо и др., 2008) повышенным содержанием солей магния и калия. В ходе экспериментов в составе отобранной транскрипционной системы (Giege et al., 2000) было увеличено содержание нуклеотидов. Время транскрипции составляло 10 мин, что позволило получить наибольшую интенсивность сигналов (рис. 3Б).

2.1. Влияние экзогенной СК на интенсивность транскрипции митохондриальных генов. Согласно экспериментальным данным, полученным в данном исследовании, воздействие СК не влечет за собой изменения интенсивности цитохромного пути дыхания. Однако в работе показано, что СК изменяет интенсивность транскрипции генов митохондриального кодирования, при этом, СК может, как ее увеличивать, так и уменьшать (рис. 4). Наибольшее влияние СК оказывала на интенсивность транскрипции митохондриальных генов nad6, nad9 и rps12. Интересно отметить, что изменение интенсивности транскрипции генов субъединиц комплекса I ЭТЦ (nad3, nad6, nad9) происходит прямо противоположно:

если для nad3 и nad6 она подавляется, причем в случае nad6 практически в 2 раза, то интенсивность транскрипции nad9 усиливается в 2 раза. На культуре клеток A. thaliana также показана разнонаправленная регуляция генов, кодирующих субъединицы этого комплекса при обработке перекисью водорода и актиномицином А (ингибитором комплекса III) (Sweetlove et al., 2002). По-видимому, регуляция экспрессии генов данного комплекса носит сложный характер. Для выявления механизма и физиологического смысла такой регуляции необходимы дополнительные исследования. Интенсивность транскрипции двух пластидных генов atpE и rrn16, уменьшалась более чем в 2 раза под воздействием СК.

Изменение интенсивности транскрипции может свидетельствовать об изменении экспрессии генов, что, в конечном итоге, приводит к изменениям в содержании соответствующих белков.

Однако анализ литературы показал, Рис. 4. Эффект 1 мМ СК на интенсивность транскрипции генов что изменение интенсивности митохондриального кодирования. Значения приведены в виде десятичного логарифма транскрипции митохондриальных изменения скорости транскрипции генов в течение циркадного цикла не относительно контроля (lg X). K IV и K I – гены субъединиц четвертого и первого приводит к изменениям содержания комплексов ЭТЦ соответственно. БСС – гены белок-синтезирующей системы митохондрий, мРНК соответствующих генов, а в hlp - хлоропластные гены. Бары отражают стандартные отклонения при трех независимых случае необходимости может служить повторах эксперимента.

для обеспечения достаточного уровня мРНК. (Okada, Brennicke, 2006). Поэтому нельзя утверждать, что изменения интенсивности транскрипции в ответ на действие 1 мМ СК действительно влекут за собой изменения на уровне количества мРНК и соответствующих белков.

2.2. Влияние 6-БАП на интенсивность транскрипции митохондриальных генов. Согласно полученным данным по изменению скорости дыхания в системе in vivo на изолированных семядолях, цитокинин активирует цитохромный путь дыхания. Для изучения эффекта цитокинина на цитохромный путь изучили влияние 6-БАП на интенсивность транскрипции соответствующих генов. Полученные результаты убедительно демонстрируют снижение интенсивности транскрипции практически всех изученных генов, за исключением rps12, интенсивность транскрипции которого незначительно увеличивалась (рис. 5). Наибольшее подавляющее действие гормон оказывал на транскрипцию гена atp9, кодирующего субъединицу АТФ-синтазы. Кроме того, 6-БАП более чем в 2 раза уменьшал интенсивность транскрипции генов cox1 и cox3 (комплекс IV);

ccmB (связанный с биосинтезом цитохромом с);

nad6 (комплекс I);

rps13, rrn26 и trnI (белок синтезирующая система митохондрий);

atpE и rrn16 (пластидные гены).

Подавление интенсивности транскрипции при действии 6-БАП на фоне активации цитохромного пути дыхания можно объяснить увеличением времени полураспада мРНК соответствующих генов.

Накопление матриц, вероятно, Рис. 5. Эффект 22 мкМ 6-БАП на интенсивность транскрипции генов приводит к подавлению нового митохондриального кодирования. Значения приведены в виде десятичного логарифма синтеза данных мРНК. Кроме того, изменения скорости транскрипции увеличение скорости дыхания по относительно контроля (lg X). K IV и K I – гены субъединиц четвертого и первого цитохромному пути при воздействии комплексов ЭТЦ, соответственно. БСС – гены белок-синтезирующей системы митохондрий, цитокинина, возможно, является hlp - хлоропластные гены. Бары отражают стандартные отклонения при трех независимых результатом увеличения повторах эксперимента.

ферментативной активности комплексов ЭТЦ, а также результатом формирования суперкомплексов, существование которых показано (Dudkina et al., 2006). Не исключена возможность, что при 12-часовом воздействии гормона удалось уловить кратковременный и долговременный эффекты, которые являются прямо противоположными. При этом кратковременным эффектом является активация гормоном цитохромного пути окисления, вероятно связанной с активацией метаболизма, в то время как в клетке начинают развиваться процессы (подавление транскрипции генов компонентов цитохромного пути), предшествующие реализации долговременного эффекта, а именно гибели клеток. На культуре клеток A. thaliana (Carimi et al., 2004) и Medicago truncatula (Zottini et al., 2006) показано, что длительное культивирование (от 24 часов и более) в среде, содержащей 27 мкМ 6-БАП, вызывает гибель клеток. Известно, что при программируемой клеточной смерти, наряду со многими изменениями на молекулярном уровне, происходит высвобождение цитохрома с из митохондрий в цитоплазму и активация альтернативного дыхания (Sun et al., 1999), следствием чего является изменение интенсивности цитохромного дыхания. Однако на сегодняшний день экспериментальных данных, имеющихся в литературе, недостаточно для объяснения результатов, представленных в данной работе.

Таким образом, в ходе настоящего исследования впервые продемонстрировано изменение интенсивности транскрипции генов митохондриального кодирования в ответ на обработку фитогормонами. Показано, что 1 мМ СК оказывает разнонаправленное влияние на интенсивность транскрипции ряда генов. Причём даже при отсутствии эффекта, детектируемого на уровне скорости дыхания, 1 мМ СК изменяет интенсивность транскрипции генов, кодирующих субъединицы комплексов ЭТЦ. Также обнаружено, что обработка 22 мкМ 6-БАП вызывает снижение интенсивности транскрипции этих же генов, хотя на физиологическом уровне продемонстрировано увеличение интенсивности дыхания по цитохромному пути.

3. Влияние 6-БАП и СК на альтернативный путь переноса электронов у L. luteus. Альтернативная оксидаза является основным компонентом альтернативного пути переноса электронов, которая катализирует поглощение кислорода, нечувствительное к цианиду. В задачи данного исследования входило выявить формы АО в клетках L. luteus и изучить возможное влияние фитогормонов СК и 6-БАП на экспрессию генов АО. Анализ методом ПЦР с ген-специфичными праймерами Аох1 s, -as;

Аох2a -s, -as и Аох2b -s, -as к уже идентифицированным растительным генам АО (табл. 1), где в качестве матрицы использовали ДНК и кДНК L. luteus, показал отсутствие синтеза ДНК или синтез фрагмента, размер которого не соответствует ожидаемому результату. На основе сравнительного анализа последовательностей ДНК и кДНК генов АО A. thaliana (D89875, NM_113135, AB003175, NM_113134, AB003175, NM_113678, AB003175, NM_102968, AB003176, NM_125817), Nicotiana tabacum (AB281425), Solanum tuberosum (AB176953), G. max (X68702, U87906, U87907), Phasoleus vulgaris (AB236953) и Vigna unguiculata (DQ100440, DQ100441, EF187463, AJ319899, DQ100439, AJ421015) были подобраны вырожденные праймеры (Р-1 и Р-2, табл. 1).

В результате ПЦР с вырожденными праймерами, где в качестве матрицы использовали ДНК L. luteus был получен фрагмент ожидаемой длины около 180 п.н.

(рис. 6, дорожка 1), который соответствует размеру фрагмента, полученного при проведении контрольного ПЦР с использованием в качестве матрицы кДНК G. max (рис. 6, дорожка 4).

Рис. 6. Результаты электрофореза продуктов ПЦР с вырожденными праймерами к генам АО. 1 - в качестве матрицы использовали ДНК L. luteus;

2 - в качестве матрицы использовали кДНК L. luteus;

3 - в качестве матрицы использовали ДНК G. max;

4 - в качестве матрицы использовали кДНК G. max;

К - отрицательный контроль;

М – маркер молекулярной массы.

Секвенирование полученных фрагментов показало, что с использованием указанных праймеров амплифицируется, по крайней мере, две последовательности размером 177 п.н. и 179 п.н. (V-2 и V-3 соответственно), которые имеют 70 % идентичных нуклеотидов. Биоинформационный анализ показал высокое сходство обеих последовательностей с последовательностями АО высших растений различных видов. К примеру, фрагмент V-2 имеет 74 % и 80 % идентичности нуклеотидного состава с генами GmАох2а и GmАох2b, соответственно, и 68 % - с геном GmАох1.

Фрагмент V-3 имеет 83 % идентичности нуклеотидного состава с геном GmАох1, и 69 % и 65 % с GmАох2а и GmАох2b, соответственно. На основе анализа взаимного сходства GmАох1, GmАох2а и GmАох2b было сделано предположение, что V- (LlАox2) относится к подсемейству Аох2, а V-3 (LlAox1) к Аох1.

3.1. Изменение содержания мРНК генов АО у L. luteus под действием СК и 6-БАП. Во многих работах показано накопление мРНК различных генов АО при действии СК (Matos et al., 2009;

Norman et al., 2004;

Rhoads, McIntosh, 1992;

Clifton et al., 2006;

Djajanegara et al., 2002;

Fung et al., 1997). Для выявления влияния СК на экспрессию генов АО был проведен анализ методом мультиплексного ПЦР после обратной транскрипции с использованием праймеров (LlAox -s, -as;

табл. 1), подобранных на основании консервативных последовательностей LlAox1 и LlАox2 для изучения суммарного количества мРНК генов АО.

А В Г Б Рис. 7. Влияние 1 мМ СК (А, Б) и 22 мкМ 6-БАП (В, Г) на экспрессию генов АО. А и В – электрофореграмма результатов мультиплексного ПЦР;

Б и Г – содержание мРНК, вычисленное на основании интенсивности сигнала, содержание в контрольном варианте принято за 100%. В качестве референтного гена использовали ген убиквитина (Ubq). М – маркер молекулярной массы;

К – контроль (без обработки гормоном);

СК – обработка 1 мМ СК;

6-БАП – обработка 22 мкМ 6-БАП. Бары отражают стандартные отклонения при трех независимых повторах эксперимента.

Результаты экспериментов показали, что при воздействии 1 мМ СК происходит накопление мРНК генов АО более чем в полтора раза (рис. 7А, Б). Результаты анализа влияния 22 мкМ 6-БАП на экспрессию генов АО показали отсутствие какого либо достоверного эффекта (рис. 7В, Г).

3.2. Характеристика белка АО у L. luteus Идентифицированные нуклеотидные последовательности фрагмента LlAox1 и LlAox2 были транслированы (LlAOX1 и LlAOX2, соответственно) для поиска гомологичных белков и сравнения их аминокислотных последовательностей.

Обнаружены многочисленные гомологи, относящиеся к семейству белков АО.

Идентифицированная область является консервативной для всех обнаруженных гомологов и включает в себя домен, характерный для ферритин-подобных белков.

Сравнение транслируемой аминокислотной последовательности с последовательностями белков АО с определенным положением консервативных аминокислотных остатков в активном центре (Siedow et al., 1995) позволил определить положение таковых в последовательности L. luteus (рис. 8).

Рис. 8. Выравнивание аминокислотных последовательностей идентифицированных клонов (LlAox1, LlAox2) АО L. luteus с последовательностями белков АО A. thaliana (At) и G. max (Gm). Аминокислотные последовательности (LlAOX1, LlAOX2) были транслированы с нуклеотидных последовательностей (LlAox1, LlAox2) с помощью программы ExPASY. (*) – консервативные аминокислотные остатки активного центра, участвующие в связывании ионов железа, рамкой выделен консервативный мотив ExxH.

Согласно анализу профилей гидрофобности (Kyte, Doolittle, 1982) аминокислотных последовательностей уже идентифицированных АО организмов, таких как A. thaliana и G. max, АО является гидрофильным белком, с двумя гидрофобными участками в С-концевой области. Это указывает на его мембранную локализацию. В наших экспериментах с поликлональными антителами против АО (рис. 9) продемонстрирована ассоциация АО с внутренней мембраной митохондрий.

Рис. 9. Локализация белка АО в митохондриях L. luteus.

Очищенные митохондрии разрушали и фракционировали на растворимую (Мт – общий белок матрикса) и мембранную (вн, вш – общий белок внутренних и внешних мембран соответственно) фракции. После разделения белков (по 15 мкг) с помощью денатурирующего гель-электрофореза и их иммобилизации на нитроцеллюлозной мембране, присутствие АО во фракциях определяли иммунохимическим анализом с антителами против АО. М – маркер молекулярной массы.

3.3. Влияние СК и 6-БАП на содержание белка АО у L. luteus. С использованием вестерн-блоттинга изучено содержание белка АО при 12-часовом воздействии гормонов: 1 мМ СК и 22 мкМ 6-БАП. Показано, что при действии СК количество белка АО возрастает в два раза по сравнению с контролем (рис. 10А, Б, В), что полностью согласуется с уже известными данными (Clifton et al., 2006;

Norman et al., 2004;

Rhoads, McIntosh, 1992).

При изучении влияния 6-БАП на экспрессию АО не обнаружено достоверного изменения количества этого белка (рис. 10Г, Д, Е). Нужно отметить, что в работах других исследователей, иллюстрирующих подавление цитокинином альтернативного дыхания, содержание мРНК и белка АО не изучалось. Это является отличительной особенностью данной работы.

Б В А Д Г Е Рис. 10. Влияние 1 мМ СК (А, Б, В) и 22 мкМ 6-БАП (Г, Д, Е) на содержание белка АО. Суммарный митохондриальный белок (40 мкг) разделяли с помощью денатурирующего гель-электрофореза и иммобилизовали на нитроцеллюлозную мембрану. Количество АО определяли иммунохимически с антителами против АО. А и Г – окрашивание геля раствором кумасси синий R-250;

Б и Д – результаты вестерн-блоттинга;

В и Е – содержание белка, подсчитанное по интенсивности сигнала;

содержание белка в контрольных пробах принято за 100%. К – контроль (без обработки гормоном);

СК – обработка 1 мМ СК;

6-БАП – обработка 22 мкМ 6-БАП. Бары отражают стандартные отклонения при трех независимых повторах эксперимента.

ЗАКЛЮЧЕНИЕ В ходе выполнения диссертационной работы были последовательно решены три основные задачи. Во-первых были выбраны и оптимизированы условия биологического эксперимента, включая выбор объекта исследований, действующие концентрации гормонов, а также условий и времени инкубации растений, при которых можно было обнаружить эффект экзогенных гормонов на метаболизм митохондрий. Во-вторых, были отработаны и частично модифицированы биохимические и молекулярно-биологические методы исследования, например, отработан метод выделения и очистки интактных митохондрий из семядолей люпина, оптимизирован метод run-on транскрипции и ряд других методов. Наконец, были проведены опыты по изучению влияния фитогормонов на дыхание семядолей в условиях in vivo и транскрипцию генов, кодирующих некоторые белки митохондрий.

В ходе экспериментальной работы, был проверен широкий спектр концентраций гормонов, и были выбраны их действующие концентрации: для СК – это 1 мМ, а для 6-БАП – 22 мкМ. Результаты, приведенные в диссертации, убедительно показывают, что данные фитогормоны оказывают заметное влияние на измеряемые параметры дыхательного метаболизма, а также на экспрессию митохондриальных генов.

Полученные в диссертационной работе результаты свидетельствуют, что обработка СК индуцирует увеличение скорости поглощения кислорода семядолями люпина, преимущественно за счет активации альтернативного цианид-резистентного дыхания. Показано также, что эта активация достигается за счет СК-индуцируемой экспрессии генов АО и накопления белка АО в митохондриях. Кроме того, СК оказывает разнонаправленное действие на экспрессию митохондриального генома, в том числе генов, кодирующих субъединицы комплекса I.

В диссертационной работе также было изучено влияние цитокининов на дыхание семядолей и сделана попытка охарактеризовать возможные молекулярно генетические основы данного эффекта. На примере синтетического аналога 6-БАП было проведено изучение его влияния на интенсивность дыхания и скорость транскрипции митохондриальных генов. Анализируя полученные результаты, следует, отметить два момента. Во-первых, впервые были получены данные, которые убедительно демонстрируют снижение под влиянием 6-БАП интенсивности транскрипции практически всех изученных генов. Такой результат может говорить о влиянии цитокинина как на общие факторы транскрипции, так и на белковые факторы, регулирующие транскрипцию индивидуальных генов. Во-вторых, обнаруженное снижение интенсивности транскрипции генов, кодирующих некоторые субъединицы компонентов цитохромного пути переноса электронов, происходило на фоне заметной активации цитохромного дыхания семядолей, что было показано впервые. Одним из объяснений такого феномена может быть предположение о том, что активация под влиянием 6-БАП цитохромного пути дыхания семядолей была обусловлена активацией клеточного метаболизма и перехода митохондрий в более активное состояние. Таким образом, важным результатом всей работы является обнаружение того факта, что экзогенный цитокинин оказывает регуляторное влияние на экспрессию не только хлоропластного генома (Zubo et al., 2008), но также на транскрипцию митохондриальных генов.

Обобщая изложенное, в диссертационной работе впервые продемонстрировано влияние СК и 6-БАП на дыхание семядолей люпина. Несмотря на то, что вопрос о детальном механизме действия фитогормонов на дыхание остается открытым, из представленных результатов следует, что действие изученных гормонов оказалось комплексным, затрагивающим активность основного (цитохромного) и альтернативного (CN-резистентного) пути электронного транспорта в ЭТЦ митохондрий. При этом фитогормоны могут оказывать свое влияние на дыхание как непосредственно, активируя или ингибируя активность или биосинтез компонентов ЭТЦ, в частности, активность и биосинтез АО, так и, по-видимому, опосредовано, изменяя напряженность клеточного метаболизма. При этом характер действия экзогенных гормонов на дыхание растений в значительной степени зависит от условий эксперимента, концентрации гормонов, времени инкубации ткани и т.д.

ВЫВОДЫ 1. Экзогенные 6-БАП и СК влияют на интенсивность дыхания и на активность различных путей митохондриального окисления целых семядолей L. luteus. В ответ на обработку 1 мМ СК происходит активация альтернативного пути окисления. 22 мкМ 6-БАП усиливает окисление по цитохромному пути.

2. Идентифицированы нуклеотидные последовательности фрагментов генов митохондриального кодирования L. luteus: atp9, ccmB, cob, cox1, cox3 и rps13.

4. Впервые показан дифференциальный эффект 1 мМ СК на интенсивность транскрипции митохондриальных генов, кодирующих органельные белки комплексов основного цитохромного пути дыхания, тРНК и рРНК методом run-on транскрипции.

5. Впервые установлено, что 22 мкМ 6-БАП снижает интенсивность транскрипции практически всех изученных генов митохондриального и пластидного кодирования, в том числе кодирующие компоненты различных комплексов ЭТЦ.

6. Идентифицированы частичные нуклеотидные последовательности двух генов АО у L. luteus, относящиеся к подсемействам АОХ1 и АОХ2.

7. На фоне активации альтернативного пути окисления в ответ на обработку 1 мМ СК методом ПЦР после обратной транскрипции и вестерн-блоттингом показана положительная регуляция экспрессии АО на уровне мРНК и на уровне белков.

СПИСОК ПУБЛИКАЦИЙ 1. Белозерова Н.С., Зубо Я.О., Кузнецов В.В. Регуляция транскрипции митохондриальных и хлоропластных генов цитокинином // Международная конференция «Физико-химические основы структурно-функциональной организации растений». Екатеринбург, 2008. с. 68-69.

2. Belozerova N., Shugaev A.G., Pojidaeva E., Kusnetsov V.V. «Influence of cytokinin on capacity and protein level of mitochondrial AOX protein in lupin cotyledons» // Международная конференция «Plant Abiotic Stress – from signaling to development». Эстония, Тарту, 2009. с.

46.

3. Белозерова Н.С., Пожидаева Е.С., Шугаев А.Г., Кузнецов В.В. Влияние цитокинина на цианид-резистентное дыхание в митохондриях семядолей люпина (Lupinus luteus L.) // Международная конференция «Физико-химические механизмы адаптации растений к антропогенному загрязнению в условиях Крайнего Севера». Апатиты, 2009. с. 57-58.

4. Белозерова Н.С., Зубо Я.О., Шугаев А.Г., Кузнецов В.В. «Метод изучения интенсивности транскрипции индивидуальных митохондриальных генов у растений» // Вестник РУДН, серия «Агрономия и животноводство» 2009 г., №1, с. 65-72.

5. Белозерова Н.С., Балашкина Л.В. Влияние цитокинина на функционирование электрон транспортной цепи в митохондриях семядолей люпина (Lupinus luteus L.) // XVII Международная научная конференция студентов, аспирантов и молодых ученых «Ломоносов - 2010». Москва, 2010. с. 248.

6. Белозерова Н.С., Баик А.С., Шугаев А.Г., Пожидаева Е.С., Кузнецов В.В. Регуляция энергетической функции митохондрий салициловой кислотой // Всероссийский симпозиум «Растение и стресс», Москва, 2010. с.57.

7. Белозерова Н.С., Пожидаева Е.С., Кузнецов В.В. Идентификация генов альтернативной оксидазы у Lupinus luteus // Материалы Всероссийской, с международным участием, конференции молодых ученых, посвященной 90-летию Уральского государственного университета им. А.М. Горького «Биология будущего: традиции и : традиции и инновации», Екатеринбург, 2010. с. 107-108.

8. Белозерова Н.С., Баик А.С., Пожидаева Е.С., Шугаев А.Г. Изменение дыхания под действием фитогормонов // Материалы Всероссийской, с международным участием, конференции молодых ученых, посвященной 90-летию Уральского государственного университета им. А.М. Горького «Биология будущего: традиции и инновации», Екатеринбург, 2010. с. 123-124.

9. Белозерова Н.С., Пожидаева Е.С., Шугаев А.Г., Кузнецов В.В. Метод run-on транскрипции для изучения экспрессии митохондриального генома // Физиология растений, 2011. № 1, с. 133-138 (принята в печать).



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.