авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Разработка систем идентификации фитопатогенов различных таксономических групп методом flash-пцр

УЧРЕЖДЕНИЕ РОССИЙСКОЙ АКАДЕМИИ НАУК ИНСТИТУТ БИООРГАНИЧЕСКОЙ ХИМИИ им. академиков М.М. ШЕМЯКИНА и Ю.А. ОВЧИННИКОВА

На правах рукописи

Рязанцев Дмитрий Юрьевич РАЗРАБОТКА СИСТЕМ ИДЕНТИФИКАЦИИ ФИТОПАТОГЕНОВ РАЗЛИЧНЫХ ТАКСОНОМИЧЕСКИХ ГРУПП МЕТОДОМ FLASH-ПЦР Специальность 03.00.03 – Молекулярная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва – 2009

Работа выполнена в группе молекулярной диагностики Института биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской Академии Наук

Научный консультант: доктор биологических наук, профессор, чл.-корр. РАСХН Сергей Кириакович Завриев

Официальные оппоненты: доктор биологических наук, профессор Алексей Анатольевич Аграновский доктор биологических наук, профессор Лев Иванович Патрушев

Ведущая организация: Всероссийский научно исследовательский институт фитопатологии РАСХН

Защита состоится 11 ноября 2009 г. в 11 часов на заседании диссертационного совета Д.002.019.01 при Институте биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН по адресу: 117997, Москва, ул. Миклухо-Маклая, 16/10.

С диссертацией можно ознакомиться в библиотеке Института биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН

Автореферат разослан 6 октября 2009 г.

Ученый секретарь Специализированного Совета, доктор физико-математических наук В.А. Олейников

Общая характеристика работы

Актуальность проблемы. Диагностика и идентификация патогенов важны в медицине, во многих отраслях сельского хозяйства (растениеводстве, животноводстве и ветеринарии), при контроле за состоянием окружающей среды и т.д. Так, вирозам, бактериозам, гельминтозам и микозам подвержены все без исключения растения. В сельскохозяйственном производстве это грозит большими потерями. Например, при заражении картофеля вирусами урожайность снижается в пределах от 10 до 80% (в зависимости от вируса и сорта картофеля), уменьшается содержание крахмала в клубнях, ухудшаются их качество и товарный вид.

Продовольственная и биологическая безопасность во многом зависит от четкого и постоянного контроля над фитосанитарным состоянием не только окружающей среды в целом, но и сельскохозяйственных растений, продуктов их переработки и кормов. Одним из основных методов осуществления такого контроля является высоко специфичная и эффективная диагностика и идентификация фитопатогенов.

Традиционные методы диагностики болезней растений основаны на таких подходах как визуальная диагностика болезни по симптомам и по морфологии возбудителя, микроскопия, использование растений-индикаторов.

Все эти методы позволяют определить болезнь и ее возбудителя, но для этого требуют выполнения ряда обязательных условий: явного проявления симптомов (в то время как многие болезни развиваются латентно), больших затрат времени и средств для выделения патогена в культуру и его идентификации (в то время как многие фитопатогены сложно культивировать), наличие теплиц для выращивания растений-индикаторов. Диагностику фитопатогенов традиционными методами затрудняет также большое разнообразие и быстрое появление новых штаммов и рас, дающих нехарактерные симптомы. Сильно затруднена традиционная диагностика при больших объемах анализируемого материала, например, при проверке на наличие карантинных организмов, когда нужна быстрая детекция патогена с максимальной чувствительностью (Borman et al., 2008;

McCartney et al., 2003;

Atcins & Clark, 2004;

Rosso, 2007;

Lopez et al., 2003;

Lopez et al., 2009).

Таким образом, сегодня традиционные методы диагностики фитопатогенов далеко не всегда эффективны, что обусловливает необходимость создания и постоянного усовершенствования специфичных и чувствительных тестов, не требующих большого количества материала для анализа и пригодных для рутинной диагностики. Поэтому на смену традиционным методам приходят все более чувствительные молекулярные технологии, такие как различные модификации иммуноферментного анализа (ИФА, чувствительность ~103-105 ед. патогена/мл) и полимеразной цепной реакции (ПЦР, чувствительность ~10-102 ед. патогена/мл). Еще в диагностике распространено использование микрочипов, позволяющих одновременно анализировать большое число образцов, а также различать последовательности нуклеотидов с гомологией около 80%. Однако этот метод обладает невысокой, сравнимой с ИФА, чувствительностью и требует сложного и дорогого оборудования.

Использование SCAR-маркеров (sequence characterized amplified region) — ДНК-маркеров, основанных на ПЦР одного локуса, дающей один фрагмент с охарактеризованной последовательностью нуклеотидов, позволяет четко детектировать и идентифицировать вид или штамм организма по специфической последовательности нуклеотидов фрагментов его генома, метод обладает гораздо большей чувствительностью по сравнению с ИФА, достаточно прост и позволяет существенно сократить время, затрачиваемое на анализ, которое в случае ПЦР не превышает 2-3 часов. Метод ПЦР дает возможность максимально автоматизировать процесс диагностики, а ПЦР «в реальном времени» (ПЦР-РВ) хотя и требует дорогостоящего оборудования, но позволяет осуществлять количественный анализ (Saponari et al., 2008;

Osman et al., 2008;

Gil-Salas et al., 2007;

Agindotan et al., 2007;

Lopez et al., 2009).

Для рутинной диагностики фитопатогенов в России наиболее оптимальным и перспективным сегодня является метод ПЦР в формате FLASH (FLuorescent Amplification-based Specific Hybridization). Этот метод позволяет использовать недорогое, но высококачественное оборудование российского производства, что снижает стоимость оснащения диагностических лабораторий, экономит время анализа и сводит к минимуму риск контаминации рабочего пространства продуктами реакции, неизбежно сопутствующей анализам результатов ПЦР методом гель-электрофореза.

Цели и задачи исследования. Целью настоящей работы была разработка новой стратегии диагностики фитопатогенов при помощи SCAR маркеров с детекцией результатов в формате FLASH, что позволяет просто и эффективно детектировать патогенные организмы. В качестве объектов исследования были выбраны 18 фитопатогенов разных систематических групп, являющихся особо важными и/или карантинными организмами (далее К означает, что данный патоген является объектом внешнего или внутреннего карантина в РФ): X, Y, A, M и S вирусы картофеля (X-, Y-, A-, M- и SВК), вирус скручивания листьев картофеля (ВСЛК), вирус метельчатости верхушки картофеля (ВМВК), вироид веретеновидности клубней картофеля (ВВКК), возбудители кольцевой гнили картофеля (Clavibacter michiganensis subsp.

sepedonicus), аскохитоза тыквенных и томатов (Didymella spp.), гнили плодов (Pectobacterium carotovorum subsp. carotovorum), рака томатов (C. michiganensis subsp. michiganensis), вилта кукурузы (Pantoea stewartii subsp. stewartii, К), бурой гнили картофеля (Ralstonia solanacearum, К), бледная и золотистая картофельные цистообразующие нематоды (Globodera pallida и G. rostochiensis, К), сосновая стволовая нематода (Bursaphelenchus xylophilus, К) и ее вид двойник (B. mucronatus, К), вирус ризомании сахарной свеклы (Beet necrotic yellow vein virus). Для контроля корректности выделения РНК и реакции обратной транскрипции также была разработана тест-система на ген актина картофеля.

В процессе работы предстояло решить следующие задачи:

1. Разработать стратегию диагностики фитопатогенов методом ПЦР в формате FLASH.

2. Создать SCAR-маркеры для детекции фитопатогенов методом FLASH-ПЦР по унифицированному алгоритму.

3. Клонировать и протестировать положительные контроли.

4. Оптимизировать методы выделения нуклеиновых кислот из различных материалов (культур микроорганизмов, тканей растений, нематод, семян, почвы и т.п.).

5. Разработать регламент производства тест-систем для рутинной диагностики перечисленных выше фитопатогенов в формате FLASH-ПЦР.

Научная новизна и практическая значимость работы. Основным научным результатом исследований является разработка новой стратегии диагностики фитопатогенов при помощи SCAR-маркеров и создание 18 тест систем в формате FLASH-ПЦР. Тест-системы на перечисленные выше патогены в формате FLASH-ПЦР разработаны впервые и не имеют аналогов в нашей стране, а также за рубежом. Во всех тест-системах используются оригинальные праймеры и зонды. Полученные результаты открывают новые возможности для рутинной диагностики фитопатогенов, в том числе ряда особо вредоносных и карантинных. Впервые продемонстрировано, что зонд типа «молекулярный маячок» разрушается ферментом с 5'-3' экзонуклеазной активностью в ходе элонгации цепи ДНК при ПЦР.

Практическая значимость работы определяется тем, что созданные тест-системы просты и удобны для рутинного применения и позволяют с высокой чувствительностью и специфичностью определять детектируемые фитопатогены. Диагностические системы разработаны в едином формате FLASH-ПЦР, рассчитанном на недорогое оборудование отечественного производства.

Внедрение работы. На базе проведенных исследований создан производственный регламент, на основе которого ЗАО «НПФ ДНК Технология» наладило опытное производство диагностических наборов на основе разработанных тест-систем (см. приложение). Тест-системы были апробированы во ВНИИ картофельного хозяйства имени А.Г. Лорха РАСХН (Красково, Московская обл.), во ВНИИ карантина растений МСХ РФ (Быково, Московская обл.), в Научно-практическом центре НАН Беларуси по картофелеводству и плодоовощеводству (Самохваловичи, Беларусь), во ВНИИ фитопатологии РАСХН (Бол. Вяземы, Московская обл.), компанией HLB (Нидерланды). Эти тест-системы могут и уже используются в профильных НИИ и лабораториях, осуществляющих фитосанитарный контроль. Тест системами для карантинных объектов в настоящее время активно пользуются лаборатории службы карантина растений РФ.

Апробации работы и публикации. Результаты работы были доложены на международной школе-конференции «Генетика микроорганизмов и биотехнология», международной конференции «Грибы и водоросли в биоценозах», международной научно-практической конференции «Биотехнология. Вода и пищевые продукты», международном научно практическом совещании «Паразитические нематоды растений, биоразнообразие, изучение, коллекции», всероссийской научно координационной конференции «Использование мировых генетических ресурсов ВИР в создании сортов картофеля нового поколения». По материалам диссертации опубликовано 15 печатных работ, из них 4 статьи в журналах, рекомендуемых ВАК.

Структура и объем диссертации. Диссертационная работа состоит из введения, глав «Обзор литературы», «Материалы и методы», «Результаты и обсуждение», выводов, списка литературы, включающего 229 названий, и приложений. Работа изложена на 149 машинописных страницах, содержит рисунков и 5 таблиц.

СОДЕРЖАНИЕ РАБОТЫ

Стратегия диагностики. Разрабатываемые диагностические системы должны быть простыми в применении и обеспечивать анализ в максимально короткое время. Ниже приведена стандартная схема анализа для разрабатываемых диагностических систем и указана примерная длительность отдельных его этапов (рис. 1).

1. Пробоподготовка Выделение ДНК Выделение РНК 40-60 мин 40-60 мин Обратная транскрипция с random праймером. Позволяет проводить ПЦР на разные вирусы с одной ОТ-смеси -50 мин 2. ПЦР - 90 мин 3. Детекция результатов - 5 мин положительный результат положительный результат отрицательный результат недостоверный результат 0 2 4 6 8 10 12 14 Специфика ВК Рис. 1. Этапы проведения диагностики методом FLASH-ПЦР.

Таким образом, при детекции результатов на флуориметре «Джин», общая длительность анализа не превышает 2-3 часов. Для детекции флуоресценции нет необходимости открывать пробирки с продуктом ПЦР, что практически исключает риск контаминации.

Оптимизация методов выделения нуклеиновых кислот. С учетом уже упомянутых требований к разрабатываемым тест-системам, а также специфики объектов диагностики возникла необходимость адаптации наборов реагентов производства ЗАО «НПФ ДНК-Технология» для выделения нуклеиновых кислот (НК) из растений и культур микроорганизмов.

Для выделения РНК из растительной ткани использовали набор «Проба-НК» (ЗАО «НПФ ДНК-Технология»). При оптимизации выделения РНК протокол, рекомендуемый производителем, был модифицирован следующим образом: добавлены этапы гомогенизации растительной ткани в лизирующем буфере, а также увеличена скорость центрифугирования после инкубации в лизирующем буфере с рекомендованных 2000 об/мин до об/мин, что способствовало более эффективной очистке гомогената от дебриса.

Выделение ДНК из культур микроорганизмов, растительного материала и из смывов с поверхности семян проводили с помощью набора «Проба-ГС» (ЗАО «НПФ ДНК-Технология») в соответствии с протоколом производителя. Однако потребовалось модифицировать этап подготовки образцов для выделения ДНК в зависимости от природы диагностируемого объекта. В случае с бактериальной культурой пробоподготовка заключалась в приготовлении суспензии в 50 мкл лизирующего буфера. При выделении ДНК из культуры гриба, имеющего плотный мицелий, или из растительной ткани около 50 мг ткани помещали в пробирку с 50 мкл лизирующего буфера и гомогенизировали. При диагностике патогенов, сохраняющихся на поверхности семян, вначале проводили смыв с поверхности 50-100 семян буфером, содержащим 0.1 M хлорид натрия, 0.01 М Tris Cl, pH 8.0, 0.025 М EDTA, 0.5 % SDS, затем проводили центрифугирование в течение 15 мин при 13 000 об/мин, осадок ресуспендировали в 50 мкл лизирующего буфера.

Выделение ДНК из отдельных нематод рода Bursaphelenchus и цист нематод рода Globodera проводили по следующей схеме. Нематоды или цисты помещали в пробирку, добавляли 50 мкл буфера STE (10 мМ Tris HCl, pH 8.0, мМ EDTA, 0.1 М хлорид натрия), гомогенизировали, инкубировали 5 мин на кипящей водяной бане и центрифугировали 5 мин при 13 000 об/мин, надосадочную жидкость использовали для амплификации ДНК соответствующей нематоды.

Выбор типа флуоресцентно-меченого зонда для ПЦР в формате FLASH. При детекции результатов ПЦР по интенсивности флуоресценции после амплификации необходимо, чтобы непрореагировавшие зонды имели низкий уровень флуоресценции. Мы остановились на зондах двух типов:

«молекулярные маячки» и TaqMan.

Теоретически зонды типа «молекулярный маячок» должны иметь меньший уровень фоновой флуоресценции, так как у них флуорофор и тушитель тесно сближены (Marras et al., 2002). Для проверки этого утверждения мы проанализировали несколько зондов разного типа, причем специфичная часть зондов TaqMan и «молекулярных маячков» была одинаковой (см. табл. 1, 4). Следует отметить, что на 5'-конце зонда PSSh825p нуклеотидов не гомологичны матрице, что характерно для «молекулярных маяков», а у зонда LRVp640b 5'-конец полностью гомологичен ДНК-мишени, что характерно для TaqMan. Как видно из табл. 1, фоновая флуоресценция для TaqMan в 1.25-2 раза выше, а уровень разгорания в 1.33-1.5 раза ниже аналогичных показателей «молекулярного маячка».

В то же время считалось, что принцип действия «молекулярного маячка» при ПЦР-РВ, в отличии от действия TaqMan, заключается не в разрушении зонда, а только в его гибридизации на ДНК-мишени (Tyagi&Kramer 1996;

Goel et al., 2005). Хотя при использовании фермента с 5'-3' экзонуклеазной активностью зонд, отжигающийся на цепь ДНК, должен разрушаться Taq полимеразой, публикаций на эту тему в литературе нет.

Таблица 1. Сравнение уровней фоновой флуоресценции и разгорания зондов типа TaqMan и Molecular Beacon (концентрация и последовательность зондов одинаковы) Название зонда и его тип Фоновая флуоресценция, ед. Уровень разгорания (ед. фона) отношение TaqMan/Beacon отношение Beacon/TaqMan PSSh825p Molecular Beacon 120 1.25 8 1. TaqMan 150 LRVp640b Molecular Beacon 120 2.08 12 1. TaqMan 250 Для проверки этого утверждения нами были проведены соответствующие эксперименты. Капиллярный электрофорез продуктов ПЦР, полученных при использовании Taq-полимеразы с 5'-3' экзонуклеазной активностью, показал как наличие целого зонда (рис. 2, пик 1), так и его фрагментов (пики 2), в то время как электрофорез продуктов ПЦР, проведенной с Taq-полимеразой без 5' 3' экзонуклеазной активности (NseqPol, ЗАО «Синтол», РФ), показал присутствие только нативного зонда. Также был проведен эксперимент, показавший, что при использовании фермента без 5'-3' экзонуклеазной активности (NseqPol) в ходе FLASH-ПЦР увеличение интенсивности флуоресценции происходит в значительно меньшей степени (рис. 3А), тогда как количество продукта реакции судя по электрофореграмме одинаково (рис.

3Б).

Рис. 2. Капиллярный электрофорез продуктов ПЦР с Taq-полимеразой с 5'-3' экзонуклеазной активностью (А) и без нее (Б).

Таким образом, зонд типа «молекулярный маячок» на самом деле работает по принципу зонда TaqMan, обладая при этом более низким уровнем фоновой флуоресценции, что особенно важно для ПЦР в формате FLASH.

Б 1 А 1 10, 2 3, 2 3, 3 12, 3 12, 4 2, 4 2, Рис. 3. Сравнение уровня разгорания «молекулярных маячков» при использова 0 2 4 6 8 10 12 нии ферментов с (1, 3) и без (2, 4) 5'-3' экзонуклеазной активностью (А). Электрофореграмма продуктов ПЦР при использовании ферментов с (1, 3) и без (2, 4) 5'-3' экзонуклеазной активностью (1, 2 — PSSh825p, 3-4 — LRVp640b).

ПЦР в формате FLASH. В ходе ПЦР зонд отжигается на ДНК-матрицу, и ДНК-полимераза разрушает его благодаря 5'-экзонуклеазной активности, отщепляя флуорофор. После реакции, при низкой температуре, непрореагировавшие зонды принимают «исходную» конформацию и в отличие от флуорофоров, высвободившихся в ходе реакции, не флуоресцируют (рис. 4).

Поэтому в FLASH-ПЦР зонды типа «молекулярный маячок» гораздо эффективней, так как благодаря контактному тушению флуоресценции они дают меньший уровень фона по сравнению с зондами типа TaqMan.

Рис. 4. Принцип действия зонда типа «молекулярный маячок» в ходе ПЦР в формате FLASH.

Этот принцип реализован в методе FLASH-ПЦР, который уже применяется в медицинской диагностике (Ёлов и др., 2005;

Лаптинов, 2005).

В целях унификации диагностических тест-систем мы использовали один и тот же состав реакционной смеси (за исключением олигонуклеотидов), а также одинаковую программу амплификации для идентификации всех фитопатогенов.

Универсальная программа амплификации включала следующие этапы (при этом для оптимизации использовали две температуры отжига праймеров:

64 и 67°С): 93°С — 90 сек;

93°С — 20 сек, 64°С/67°С — 5 сек, 67°С — 5/10 сек, 5 циклов;

93°С — 1 сек, 64°С/67°С — 5 сек, 67°С — 5/10 сек, 40 циклов. Состав реакционной смеси для амплификации включал в 35 мкл: 3.5 мкл 10х буфера (750 мМ Tрис-HCl, pH 8.8, 200 мМ сульфат аммония, 0.1% Tвин-20), 1 мМ каждого dNTP, 1 мкМ праймеров, 0.1-0.2 мкМ зондов, 2.5 ед. Taq-полимеразы и 5 мкл раствора ДНК и 0.5 мкл раствора плазмиды для внутреннего контроля (ВК, см. Результаты и обсуждение). Для снижения уровня неспецифической амплификации применяли горячий старт: реакционную смесь разделяли слоем парафина на две части — олигонуклеотиды, буфер и dNTP в одной, а ДНК и Taq-полимера — в другой. Таким образом, начало реакции возможно только после прогрева смеси до температуры выше 60°С.

В ходе постановки ПЦР, помимо пробирок с исследуемыми образцами, положительным и отрицательным контролями (К+ и К-), ставили контроль фонового уровня флуоресценции: две пробирки с реакционной смесью без Taq полимеразы. Уровень флуоресценции в этих пробирках принимали за фоновый (Ёлов и др., 2005). Положительным считали результат, при котором уровень флуоресценции не менее чем в 2.1 раза превышал фоновое значение.

Также использовали систему экзогенного ВК, построенную по принципу мультиплексной ПЦР, при которой происходит одновременная амплификация целевого фрагмента генома патогена и ДНК ВК. В качестве матрицы для ВК использовали плазмиду, содержащую вставку размером 560 п.н., фланкированную инвертированными последовательностями, гомологичными праймеру, используемому для амплификации вставки (ЗАО «НПФ ДНК Технология»). Размер ампликона ВК составляет 560 п.н., что позволяет в геле четко отличать его от ампликонов с ДНК/кДНК фитопатогенов, длина которых подбиралась в пределах 100-320 пар оснований. Зонд для детекции амплификации ВК содержит флуорофор HEX, излучающий на длине волны нм, что позволяет четко отличать его от флуорофора FAM, который входит в состав зондов для специфических мишеней и который излучает на длине волны 520 нм. Следует отметить, что при необходимости детекцию результатов при использовании разработанных тест-систем можно также проводить на детектирующем амплификаторе в режиме ПЦР-РВ и методом гель электрофореза.

Общая стратегия подбора праймеров осуществлялась по следующему алгоритму: сначала проводили поиск последовательностей нуклеотидов геномов патогенов, имеющихся в банке генов (GenBank, http://www.ncbi.nlm.nih.gov/), затем их выравнивали и отбирали наиболее вариабельные внутри вида последовательности ДНК/РНК. При выборе последовательностей прежде всего обращали внимание на возможность подбора специфичных праймеров и высокую копийность гена, позволяющую разработать более чувствительную и специфичную диагностическую систему.

При подборе праймеров для идентификации бактерий прежде всего анализировали внутренние транскрибируемые спейсеры генов рРНК, а также гены патогенности;

грибов и нематод — интроны различных генов и внутренние транскрибируемые спейсеры генов рРНК;

для детекции вирусов в первую очередь брали во внимание гены, экспрессирующиеся с субгеномных РНК, что позволяет повысить относительную чувствительность тест-системы (табл. 2).

При подборе праймеров было необходимо учитывать, что они должны детектировать максимальное количество штаммов и изолятов конкретного фитопатогена, но при этом не давать ложноположительных реакций, например, с родственными видами. Также при подборе праймеров учитывали требования и к самим тест-системам, такие как максимальная чувствительность, универсальность и простота в обращении. Исходя из сказанного, были сформулированы требования к праймерам и зондам:

Праймеры должны быть строго специфичны к определенному фитопатогену. Допускаются единичные нуклеотидные замены на 5'-конце праймера. На 3'-конце праймера должны находиться как минимум два нуклеотида, не гомологичных последовательности НК родственных организмов, от которых необходимо отличать исследуемый патоген.

Температура отжига праймеров должна находится в пределах 64-67°С.

На нуклеотидный состав праймеров вводятся следующие ограничения:

процент GC оснований в праймере должен составлять около 40-60%;

праймер должен содержать не более 3-4 повторяющихся нуклеотидов;

на 3'-конце последние 2-4 нуклеотида праймера должны быть A или T;

праймеры не должны образовывать стабильных шпилечных структур и димеров.

Праймеры должны фланкировать фрагмент размером 100-350 п.н., так как небольшой фрагмент амплифицируется эффективнее, и при детекции методом гель-электрофореза можно легко отличить фрагмент, амплифицируемый с матрицы патогена от фрагмента, амплифицируемого с матрицы ВК.

Температура отжига зонда должна составлять около 75°С.

Шпилечная структура зонда должна состоять из 5-6 GC пар.

Особенно строгие требования предъявляются к вторичной структуре зонда: при моделировании вторичной структуры зонда с помощью программы mfold (mfold.bioinfo.rpi.edu) (при температуре 37°С) должна наблюдаться классическая для «молекулярного маячка» структура:

формироваться шпилька из 5-6 GC пар 3'- и 5'-концевых нуклеотидов и петля из 20-24 нуклеотидов;

в петле допускаются 2 пары спаренных нуклеотидов с низкой энергией связи (две пары AT или пара AT+GC).

После подбора праймеры проверяли на специфичность, проводя ПЦР на ДНК/кДНК видов, наиболее близких к объекту исследования (как правило, относящихся к тому же роду), а также живущих в одной с ним экосистеме. Если праймеры не отжигались на ДНК этих видов, то они считались специфичными.

Характеристики разработанных праймеров и зондов. Для обеспечения максимальной специфичности для большинства патогенов было сконструировано по несколько пар праймеров, в некоторых случаях — к различным генам (табл. 2-4). В табл. 2 дан список генов-мишеней для подбора праймеров к различным фитопатогенам. Подобранные пары праймеров проверяли на специфичность и отбирали наиболее пригодные для диагностики.

Как видно из табл. 3, не все пары праймеров оказались строго специфичными в принятых условиях реакции, поэтому их выбраковывали и не использовали в дальнейшей работе. В случае, если обе пары праймеров оказывались специфичными, проводили дополнительное тестирование на чувствительность при разных степенях разведения ДНК/кДНК и отбирали более эффективную пару.

На следующем этапе конструировали зонды. Так как специфичность реакции обеспечивается праймерами, зонды для родственных патогенов могут быть универсальными, и для подбора зонда можно использовать всю фланкируемую праймерами последовательность, что позволяет подобрать зонд оптимальной структуры (табл. 5).

Качество зонда контролировали по ряду показателей. Во-первых, по уровню фоновой флуоресценции в пробирке без добавления Taq-полимеразы.

Это значение показывает, насколько эффективно гасится флуоресценция в зонде, принявшем шпилечную конформацию. Вторым параметром качества зонда является максимальный уровень разгорания зонда, наблюдаемый в пробирке с положительным результатом ПЦР (измеряется в единицах фонового уровня). Пригодным для работы признавался зонд, показывающий не менее чем 8-кратное увеличение фонового уровня флуоресценции при положительном результате, при том что фоновый уровень флуоресценции составляет не более 150 ед. Высокий уровень фоновой флуоресценции свидетельствует о неэффективном ее гашении вследствие неправильного фолдинга зонда, а низкий уровень флуоресценции после амплификации говорит о нестабильной гибридизации зонда с ДНК-матрицей, например, вследствие неполной гомологичности специфической части зонда ДНК-матрице. Следует также отметить, что в ряде случаев оптимизации работы зондов удалось добиться при увеличении их концентрации в реакционной смеси с 0.1 до 0.2 мкМ (табл. 4).

Разработка SCAR-маркеров для видовой дифференцировки фитопатогенов. Алгоритм разработки SCAR-маркеров и создания диагностических тест-систем для различных патогенов универсален. Поэтому в автореферате подробно рассмотрены все этапы разработки тест-систем на примере диагностики сосновых стволовых нематод рода Bursaphelenchus.

Основными этапами при создании тест-систем являлись: разработка SCAR-маркеров для видовой дифференцировки фитопатогенов, для чего проводили поиск и выравнивание последовательностей нуклеотидов, имеющий полиморфизм, подбор специфичных праймеров и их верификацию;

перевод тест-системы в формат FLASH, для чего подбирали флуоресцентно-меченый зонд типа «молекулярный маячок»;

проверка работы тест-системы и разработка положительного контроля. На каждую созданную диагностическую систему был разработан регламент для внедрения в производство на базе ЗАО «НПФ ДНК-Технология» (приложение).

Таблица 2. Области геномов и номера депонированных в банке генов последовательностей НК, использованных при подборе праймеров и зондов.

Наименование Участок генома Номера последовательностей объекта Картофель мРНК гена актина STU60486, X55751, STU ВВКК Геномная РНК AF369530, AY532801-4, AY372397, X17268, U51895, AJ583449, AY962324, X52038-40, AY360446, M88678, X76846, X76845, Y09381-Y09383, Y08852, AF483470-73, M93685, M14814, AJ007489, X52036, AY492075-84, AY937179-93, M36163, AF454395, AF458986, AF458987-93, AF459007, AY152840, X97387, X58388, AY152841, AF458997, AY518939-40, U23058, AJ634596, AY673974, AF458989-96, U23060, AY492078, E00278, AY493559, Y09886, NC_002030, AJ515261, X76848,Y09887, Y09888, X76847, U23059, M16826, M ХВК 5'-нетранслируемая AB056718, AF172259, AF373782, D00344, M31541, M38480, M63141, M95516, NC_001455, X55802, X72214, область/ген БО* Z ВМВК Ген БО AF508250-57, AY196094, AY277633, DQ102381, AJ224991, AJ ВСЛК A07940-43, AF022782, AF271214, AF271215, AF296280, AF539791, AY007727, AY307123, D13753, M89926, S77421, U73777, U74377, X13906, X773- МВК Ген БО/11К белок AF023877, AJ437481, AY311394, AY311395, D14449, NC_001361, X57440, X ТБГ Ген РЗРП* SВК Y15617, Y15618, Y15619, Y15620, Y15621, Y15622, Y15623, Y YВК 3'-концевая область A08776, AF237963, AF522296, AY166866, AY166867, AY745494, AY745492, AY884982-85, DQ008213, NC001616, генома U09509, D00441, AF АВК AF543212, AF543709, AJ131400, AJ131401, AJ131403, AJ296311, NC004039, Z21670, AJ307035, Y11422-25, Y10126, Y10125, Y10250, Y10079, X91967, X91968, X ВТС1* B. mucronatus AM179514, AY347914, AY347915, AY347916, U B. xylophilus AM157747, AM179515, AY347911, AY347912, AY347913, U G. pallida AF016871, AF016868, AF016870, AF016869, AF G. rostochiensis 18S-ВТС1 AF016872, AF016873, AF016874, AF016875, AF016876, AF016877, AF C. michiganensis ВТС1 U09378, U09379, U09380, DQ437513, U09378, U09381, U subsp. sepedonicus ВНПЖС Ген БО AJ634732, AJ634738, AJ634741, AJ634736, AJ634733, AJ634740, AJ634735, AJ634739, AM779752, AJ634734, AJ Продолжение таблицы 2 на стр. Таблица 2 (продолжение) R. solanacearum Ген fliC AY192718-AY192721, EU795355, EU795356, EU795350, EU Didymella/Ascochyta ВТС1 AF297228, AY157875-89, DAP428164-70, DAP P. carotovorum subsp. ВТС1-ВТС2 AF448592, AF448594, AF448596, AF234289, AF232677, AF232684, AF232679, AF232680, AF232685-AF carotovorum 16S рРНК AF373187, AF373188, AF373189, AF373185, AF373182, AF373183, AF373180, AF373176, AF373177, AF373190, AF373193, AF P. stewartii subsp. Ген HRPL AF stewartii * БО — белок оболочки, РЗРП — РНК-зависимая РНК-полимераза, ВТС — внутренний транскрибируемый спейспер.

Таблица 3. Структура и характеристики сконструированных праймеров. Олигонуклеотиды, отобранные для использования в тест-системах, выделены жирным шрифтом.

Объект Название Последовательность 5'-3' %GC Ns Размер Ta Sp Sn амликона STVf020 CGTGGTTCCTGTGGTTCACACC 59 - 320 64 + н/о* ВВКК STVr280 CTTCAGTTGTTTCCACCGGGTA 50 MT2f094 ACTGACCATGATGGAACGTTTGAG 57 - 270 64 + н/о ВМВК MT2r358 CCCTGGCTCAATTACATCCACC 60 LRVf543 GAAGAGGCCTCGCTGACGAAC 62 - 250 64 + н/о ВСЛК LRVr797 CCAGTGGTTATGGTCACGGCC 62 10- VX1r290 GTCTTAGCGGCTGCATGTGTATG 52 - 280 64 + ХВК VX1f031 CAAACCCACCACGCCCAA 61 10- VX2r360 TCGGTTATGTAGACGTAGTTATGGTGG 44 - 167 64 + VX2f230 ATGAATGCTGCCCAAACTGCT 48 VM1r500 CACGTTATATATTAAATAGGATTTAATGGC 27 - 200 64 - н/о МВК VM1f300 TAGCTAGGTGTCACAGGTGCTATCG 52 VM2r1020 GCGATGTCTTTGTGCGTATTGTG 42 - 160 64 + н/о VM2f880 GGCTGCCATGGGGTTTCAGT 60 10- VS1r697 TCACCAGCGAAGCATATCCG 55 - 278 64 + SВК VS1f414 ACGGGTTGTGCACAGAGTCTGAC 57 10- VS2r436 GTCAGACTCTGTGCACAACCCG 55 - 255 64 + VS2f181 CATGGGCATGGTCTTCTCAAAG 50 Продолжение таблицы 3 на стр. Таблица 3 (продолжение) VYf210 ACATCACGAACACCAGTGAGGG 55 - 241 64 + н/о YВК VYr450 GATAAAAGTAGTACAGGAAAGCCAAAATA 30 VYr370 CACATGTTCTTGACTCCAAGTAGAGTATG 41 - 64 - н/о VAf326 CCCTGACAGTTGAAACATAAAACCA 57 - 230 64 + н/о АВК VAr560 CGTGAAGGGGGTGTAACCGAA 40 ACTf2 TGTTGGTGATGAAGCTCAATCGA 300 64 + н/о Актин картофеля ACTrRNA CCATGACAATACCAGTTGTACGACC Bmf90 CGTCACGAAAACGTGGAGCA 55 12 280 64 + н/о B. mucronatus Bmr370 AAGTGATCCACCGGAGTAACTTAAATT 40 Bxf90 GTCACGATGATGCGATTGGTG 55 12 280 64 + н/о B. xylophilus Bxr370 GTGATCCACCGGAGTAACTTAAAGC-3' 48 GpF TGAGTCAGTGTGGGCAACACCA 50 - 140 67 + н/о G. pallida GpR GACGACAACAGCAATCGTCGAG 55 GrF AAACTCGGGGACGATTATGCGT 55 - 300 67 + н/о G. rostochiensis GpR CGACAACAGCAATCGTCGGC 60 cls280 GACCCTTTCCGTCGTCCTGTT 60 4 140 67 + н/о C. michiganensis subsp.

Cls462r CGTTTCGCCTCCCCGAAG 67 sepedonicus rs190f AACGCCAAACGGTGCGAAC 55 6 300 67 + н/о R. solanacearum rs490r CCGAAGGTCGACATGTTGACA 55 rizof GGGCTTATAGAGCTGCTAGAGTCACC 50 - 320 64 + н/о ВНПЖС rizor GACGCAAGAGCAGCCATAGC 60 didy70 CTTTGCCTGCCATCTCTTACCC 55 - 300 64 + н/о Didymella/Ascochyta didy300 GCGTTCAAAGATTCGATGATTCA 39 PeCC4f CAAGCGCACCTGTTGATGCG 60 2 320 64 + н/о P. carotovorum. subsp.

PeCC4r TGCATCACTCACACCACATTACTGTT 42 carotovorum PeCC170 GCT AAT ACC GCA TAA CCT CGC AA 48 5 320 64 - н/о PeCC496 CTT CTG CGA GTA ACG TCA ATC GAT 42 clM280 GACCCTTTCCGTCGTCCTGTT 55 4 140 64 + н/о C. michiganensis subsp.

Clm462r CGTTTCGCCTCCCCGAAG 58 michiganensis pssf675 GAGCACTCATTCCGACCACATC 58 7 220 64 + н/о P. stewartii subsp. stewartii pssr890 CTATCAGTCTGCCTGAGCACCCT 52 н/о – не определялась, Ns - количество специфичных нуклеотидов на 3'-конце праймера, Ta — температура отжига, Sp – специфичность, Sn – относительная чувствительность. ** - указано для некоторых патогенов, имеющих близких родственников с высокогомологичной последовательностью нуклеотидов.

Таблица 4. Структура и характеристики сконструированных зондов.

Олигонуклеотиды, отобранные для использования в тест-системах, выделены жирным шрифтом. Подчеркиванием выделена специфичная часть зонда.

A* С* Объект Название Последовательность Фон (BHQ1)-5'-...3'-(FAM) ВВКК STVp2 CGGGGATCCCTGAAGCGCTCCTCCCCG 13 100 0. ВМВК MT2p265 GCTGGACGTTGTAGCCGATGTAGACTCCAGC 8 150 0. ВСЛК LRVp640b CGGCGAGGACGAGGCTCAAGCGAGCGCCG 12 120 0. LRVp640 CCCCGAGGACGAGGCTCAAGCGGGG 2 100 0. LRVt640b (FAM)CGAGGAC(BHQ1)GAGGCTCAAGCGA 8 250 0. (TaqMan) ХВК VX2p270 CGGGCACAATCCAACGACTTCGCCAGCCCG 10 100 0. МВК VM2p980b CGGGGATTGATCAGGCGACCTACCCCG 10 90 0. SВК VS1p590 CCGCCATAATGCGCTTCTCCGGTGAGGCGG 9 90 0. VS1p518 CTGGGCTTGCCCAATGATCTCATAGAGGCCCAG 3 130 0. АВК VAp480 CTCGCAACAGTGAGTTTGAGTGGGAAATGCGAG 9 100 0. VAp510 CGGTGGCCTTACTTGTTATATAGACCCACCG 2 150 0. YВК VYp330 CGCACAGAGAGGCACACCACCGAGGATGTGCG 8 60 0. Актин картофеля ACTp CGCCTCACCGAAGCACCTCTCAATCCTAAGGCG 10 60 0. Bursaphelenchus Bp280 CGGGCTTTTCAATCCTACGCTCGCCCG 20 40 0. Globodera Gprp GGCCCACAGGGCGCTGTCCATACATTGTTGGGCC 15 70 0. R. solanacearum rsp2 GGCGCGAAAACAACCTGCAGCGTATGCGCC 18 50 0. ВНПЖС rizop CCGGCTCCTAGAGACACTGCCTTGATGCCGG 10 75 0. Didymella/ Didyp4 CCGCCTTCAACAACGGATCTCTTGGTTCTGGCGG 10 75 0. Ascochyta Didyp3 CCGCCAGAACCAAGAGTCCGTTGTTGAAGGCGG 2 300 0. Didyp2 CCGCCCTTAAGTTTTGTCCAATCGGCGGGCGG 2 150 0. Didyp CGCCCGCCGATTGGACAAAACTTAAGGGCG 2 255 0. P. carotovorum PeCCp4 CCGCCTAGGACACTGCCCTTTCACGGCGG 10 100 0. subsp.

carotovorum Clavibacter clMp2 CCGGTGAATCTAAGATGCTCGCGTCCACCGG 12 44 0. michiganensis P.stewartii subsp. PSSh825p CCCGGCGATCTTGTTCTGGAAGGTGAAACCGGG 8 125 0. stewartii PSSh825t (FAM)GATCTTGT(BHQ1)TCTGGAAGGTGAAACCGG 6 150 0. (TaqMan) *A- амплитуда разгорания, ед. фона. C- концентрация, мкМ.

После анализа последовательностей нуклеотидов нематод Bursaphelenchus, представленных в банке генов, в качестве мишени для подбора специфических праймеров были отобраны последовательности внутренних транскрибируемых спейсеров (ВТС): ВТС1, отделяющий ген 18S рРНК от гена 5.8 рРНК и ВТС2, отделяющий ген 5.8 рРНК от гена 28S рРНК.

Последовательности ВТС были выбраны благодаря тому, что гены, кодирующие рДНК, многокопийны, а вариабельные последовательности спейсеров позволяют надежно идентифицировать виды рода Bursaphelenchus.

Bm(x) AM179514_BM (50) TATGACACATTCATTCGTGCTCGTCACGAAAACGTGGA--GCAACTTCGGTTGCGCC--GCAGGATGTGGGTTCG AY347915_BM (8) TATGACACATTCATTCGTGCTCGTCACGAAGACGTGGA--GCAACTTCGGTTGCGCC--ACATGATGCGGGTTCG AY347914_BM (8) TATGACACATTCATTCGTGCTCGTCACGAAGACGTGGA--GCAWCTTCGGTTGCGCC--ACATGATGCGGGTTCG AY347916_BM (8) TATGACACATTCATTCGTGCTCGTCACGAAGACGTGGA--GCAACTTCGGTTGCGCC--ACATGATGCGGGTTCG U93554_BM (50) TATGACACATTCATTCGTGCTCGTCACGAAGACGTGGA--GCAACTTCGGTTGCGCC--GCATGATGTGGGTTCG AM179515_BX (50) TATGACACATTTATTCGTGCTCGTCACGATGATGCGAGCGGTGACTTCGGTTGCCACTCGCATGATGGCGGTTCG AM157747_BX (50) TATGACACATTTATTCGTGCTCGTCACGATGATGCGATTGGTGACTTCGGTTGCCGC--GCATGATGGCGGTTCG AY347913_BX (8) TATGACACATTTATTCGTGCTCGTCACGATGATGCGATTGGTGACTTCGGTTGCCGC--GCATGATGGCGGTTCG AY347912_BX (8) TATGACACATTTATTCGTGCTCGTCACGATGATGCGATTGGTGACTTCGGTTGCCGC--GCATGATGGCGGTTCG U92464_BX (50) TATGACACATTTATTCGTGCTCGTCACGATGATGCGATTGGTGACTTCGGTTGCCGC--GCATGATGGCGGTTCG 275 Bp280 AM179514_BM (268) CGAGCGTAGGATTGAAAAGCCCGAGCGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAA AY347915_BM (225) CGAGCGTAGGATTGAAAAGCCCGAGCGGCTGCCCCGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGGA AY347914_BM (225) CGAGCGTAGGATTGAAAAGCCCGAGCGGCTGCCCCGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGGA AY347916_BM (225) CGAGCGTAGGATTGAAAAGCCCGAGCGGCTGCCCCGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGGA U93554_BM (268) CGAGCGTAGGATTGAAAAGCCCGAGCGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAA AM179515_BX (275) CGAGCGTAGGATTGAAAAGCCCGAGCGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAG AM157747_BX (273) CGAGCGTAGGATTGAAAAGCCCGAGAGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAG AY347913_BX (231) CGAGCGTAGGATTGAAAAGCCCGAGAGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAG AY347912_BX (231) CGAGCGTAGGATTGAAAAGCCCGAGAGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAG U92464_BX (273) CGAGCGTAGGATTGAAAAGCCCGAGAGGCTGCCCTGACAAAACATTCATTTTACATTTATTTTGTTGGAAAAGAG 350 Bm(x)370r AM179514_BM (343) ATTTAAGTTACTCCGGTGGATCACTTGGCTCGCGGGTC AY347915_BM (300) ATTTAAGTTACTCCGGTGGATCACTTGGCTCGCGGGTC AY347914_BM (300) ATTTAAGTTACTCCGGTGGATCACTTGGCTCGCGGGTC AY347916_BM (300) ATTTAAGTTACTCCGGTGGATCACTTGGCTCGCGGGTC U93554_BM (343) ATTTAAGTTACTCCGGTGGATCACTTGGCTCGCGGGTC AM179515_BX (350) CTTTAAGTTACTCCGGTGGATCA CTTGGCTCGCGGGTC AM157747_BX (348) CTTTAAGTTACTCCGGTGGATCA CTTGGCTCGCGGGTC AY347913_BX (306) CTTTAAGTTACTCCGGTGGATCA CTTGGCTCGCGGGTC AY347912_BX (306) CTTTAAGTTACTCCGGTGGATCA CTTGGCTCGCGGGTC U92464_BX (348) CTTTAAGTTACTCCGGTGGATCA CTTGGCTCGCGGGTC Рис. 5. Выравнивание последовательностей нуклеотидов фрагмента ВТС1 нематод B. mucronatus (BM) и B. xylophilus (BX). Праймеры и зонд выделены подчеркиванием.

Общая гомология генов 18S, 5.8S и 28S рРНК у видов Bursaphelenchus составляет около 99%, а гомология для ВТС1 (310 п.н.) и ВТС2 (315 п.н.) составляет 86% и 76%, соответственно. Для подбора праймеров мы выбрали ВТС1, так как при его амплификации образуется фрагмент заданной длины (280 п.н.), кроме того, последовательность ВТС1 содержит вариабельные участки, позволяющие подобрать специфические праймеры, а также консервативные регионы, необходимые для подбора универсального зонда для двух видов нематод (рис. 5, табл. 3).

Далее осуществлялась эмпирическая проверка специфичности синтезированных праймеров, для чего проводили амплификацию с ДНК каждой из детектируемых нематод (рис. 6). Из рисунка видно, что полученные праймеры работают строго специфично. Исключение составляет дорожка (рис. 6). Наличие фрагмента с праймерами к обоим видам объясняется контаминацией при отборе особей. В дальнейшем, при повторном анализе амплификация шла строго специфично.

Рис. 6. Электрофореграмма результатов ПЦР с праймерами к B. mucronatus (А) и B. xylophilus (Б). 1-6 – ДНК B. xylophilus, 7-12 – ДНК B. Рис. 7. Предсказанная вторичная mucronatus, 13-14 – отрицательный контроль. структура для зонда Bp280.

В табл. 4 суммированы данные о всех подобранных зондах. Проверку эффективности зондов проводили методом FLASH-ПЦР c добавлением зонда в концентрации 0.1 мкМ. В случае если сигнал был низок (3-5 ед. фона), концентрацию зонда повышали до 0.2 мкМ. Если повышение концентрации не приводило к желаемому результату — подбирали новый зонд. На рис. приведена смоделированная вторичная структура зонда Bp280 для детекции нематод рода Bursaphelenchus. Данный зонд показал уровень разгорания в ед. фона при фоновом уровне 50 ед. и концентрации 0.1 мкМ, что говорит о его высоком качестве.

Таблица 5. Проверка ингибирования ПЦР амплификацией ВК.

Объект Конечное разведение. при Объект Конечное разведение, при котором есть сигнал во котором есть сигнал во FLASH-ПЦР FLASH-ПЦР Без ВК С ВК Без ВК С ВК 10-4 10-4 10-9 10- МВК ВВКК 10-6 10-6 10-9 10- SВК ХВК 10-4 10-4 10-8 10- YВК ВМВК 10-5 10-5 10-5 10- АВК ВСЛК 10-5 10-5 10-4 10- ВНПЖС B. xylophilus 10-9 10-9 10-5 10- Актин картофеля R. solanacearum 10-4 10-4 10-5 10- B. mucronatus C. michiganensis subsp. sepedonicus 10-5 10-5 10-5 10- Didymella/ C. michiganensis subsp.

Ascochyta michiganensis 10-5 10-5 10-5 10- P. carotovorum P. stewartii subsp.

subsp. carotovorum stewartii 10-6 10-6 10-6 10- G. pallida G. rostochiensis Для проверки эффективности ПЦР и отсутствия ингибирования специфической реакции амплификацией ВК проводили FLASH-ПЦР в двух вариантах: с ВК и без него (рис. 8-9, табл. 5) с рядом разведений анализируемой ДНК. Для этого подбирали такое разведение плазмиды для ВК, при котором ингибирование отсутствовало (исходная концентрация плазмиды 400 нг/мкл).

Для систем с температурой отжига праймеров 64 и 67°С это разведение составило 10-8 и 10-7 раз, соответственно.

Как видно из этих рис. 8 и 9, положительный сигнал отмечен при одном и том же разведении при амплификации ДНК обоих видов как с ВК, так и без него, что свидетельствует об отсутствии ингибирования специфической реак ции амплификацией ВК.

Используя описанный выше алгоритм разработки диагностических систем в формате FLASH-ПЦР, мы разработали все 18 тест-систем для диагностики и идентификации перечисленных выше фитопатогенов.

Buraphelenchus mucronatus, с ВК Buraphelenchus mucronatus, без ВК 16, 10e- 23, 10e-1 15, 1, 15, 10e- 10e-2 17, 1, 11, 10e- 26, 10e-2 19, 1, 13, 10e- 10e-3 17, 1, 10, 10e- 11, 10e-3 17, 1, 1, 10e- 1, 10e-4 19, 1, 0, 10e- 1, 10e-4 17, 1, 1, 10e- 1, 10e-4 18, 1, 1, K 1, K- 18, 1, 0 5 10 15 20 0 5 10 15 20 25 Рис. 8. Результат ПЦР в формате FLASH на B. mucronatus с различными разведениями ДНК.

Buraphelenchus xylophilis, с ВК Buraphelenchus xylophilis, без ВК 10, 21,5 10e- 10e-1 1, 16, 15, 21 10e- 10e-2 1, 17, 13, 16, 10e- 10e-2 1, 19, 11, 21, 10e- 10e-3 1, 15,5 11, 10e-3 10e- 20,2 1, 3,9 10e-4 10e- 20,1 1, 1,15 1, 10e-4 10e- 20,6 1, 1,05 1, 10e-4 10e- 20,1 1, 1, K- 1, K 19,6 1, 0 5 10 15 20 25 0 2 4 6 8 10 12 14 Рис. 9. Результат ПЦР в формате FLASH на B. xylophilus c различными разведениями ДНК.

В мировой практике существует целый ряд тест-систем для диагностики сосновых стволовых нематод. Ниже сравним уже существующие тест-системы с разработанными и обратим особое внимание на возможность их применения в рутинной диагностике. Применяемые в мировой практике тест-системы для идентификации нематод Bursaphelenchus основаны на трудоемких, пригодных только для использования в научных лабораториях методах, таких как ПЦР ПДРФ с праймерами к ВТС1-2 (Han et al., 2008), RAPD-анализ (Braasch et al., 1995), а также классическая ПЦР с праймерами к межгенным и внутренним транскрибируемым спейсерам рДНК (Kang et al., 2004;

Matsunaga & Togashi, 2004), генам белков теплового шока (Leal et al., 2005) и сателлитной ДНК (Castagnone et al., 2005).

Существует также диагностическая система, основанная на современном методе ПЦР-РВ с TaqMan зондами и праймерами к генам белков теплового шока Hsp70 (Leal et al., 2007). Следует отметить, что данная система не оптими зирована для количественного определения нематод, поэтому применение сложной техники ПЦР-РВ, требующей дорогого оборудования и расходных ма териалов, на наш взгляд, не оправдано. Еще одним недостатком данной систе мы детекции сосновых стволовых нематод методом ПЦР-РВ является отсут ствие интегрированной системы ВК.

Разработанные нами на основе FLASH-ПЦР тест-системы для диагности ки сосновых стволовых нематод имеют ряд существенных преимуществ по сравнению с существующими и полностью удовлетворяет всем предъявляемым к современным диагностическим системам требованиям. Так, они характеризу ются высокой чувствительностью и специфичностью за счет использования флуоресцентной детекции результатов;

максимальной автоматизацией большинства этапов анализа, что уменьшает вероятность субъективной оценки результатов;

стандартизацией этапов анализа за счет наличия системы контро лей, включающей внутренний, положительный и отрицательный контроли;

вы сокой производительностью системы;

сокращением количества манипуляций/этапов;

компьютеризацией ввода и вывода данных анализов и совместимостью с программным обеспечением по статистической обработке результатов.

Рис. 10. Диагностика вирусов картофеля методом FLASH-ПЦР. По оси абсцисс отложена интенсивность флуоресценции, по оси ординат — номера образцов. Черный столбец — специфика, серый столбец — ВК. 1-12 — образцы инфицированных растений картофеля, 13 — K+, 14 — K-, 15 — вода, 16-17 — фон. Vd — анализ на ВВКК, L — ВСЛК, Mt — ВМВК, Y — YВК, A — АВК, X — ХВК, M — МВК, S — SВК, Ak — актин.

Для более полного представления о практической значимости проведенных исследований ниже приведены результаты применения разработанных тест систем. На рис. 10 суммированы результаты тестирования 12 различных полевых образцов картофеля на основные вирусы и ВВКК, а также тестирование семян огурцов на зараженность аскохитозом (рис. 11).

Из рис. 10 видно, что некоторые из исследованных растений были инфицированы одним или одновременно несколькими патогенами. В частности, образец № 1 одновременно инфицирован ВВКК, ВСЛК и YВК, № 4 ВВКК, ХВК и YВК, а № 7 – YВК и МВК. Результаты FLASH-ПЦР, представленные на рис. 10, сравнивали с данными ИФА-диагностики. Все образцы, в которых, по данным ИФА, отмечена инфекция, также дали положительный результат при диагностике тест-системами на основе FLASH ПЦР. Однако в ряде случаев метод ПЦР обнаруживает наличие инфекции, не выявляемое ИФА ввиду недостаточной чувствительности, а также специфичности последнего. Так, в образце № 4 с помощью FLASH-ПЦР мы обнаружили наличие АВК, а в образце № 8 – ХВК. Тест на мРНК актина картофеля (Ak) во всех образцах был положительным, что свидетельствует о корректности выделения РНК и реакции обратной транскрипции.

На рис. 11 представлены результаты ПЦР на аскохитоз огурца различных партий семян с детекцией в формате электрофореза (А) и в формате FLASH (Б).

Из рисунка видно, что данные классической ПЦР и ПЦР в формате FLASH полностью коррелируют. Для проверки достоверности результатов ПЦР полученные специфические фрагменты были проклонированы и секвенированы (номера в банке генов: FJ748550-FJ748553). Показано, что полученные фрагменты ДНК принадлежат грибам Didymella bryoniae и Phoma sp., которая является анаморфой возбудителя аскохитоза.

Резюмируя все выше сказанное, можно заключить, что разработанные в ходе данной работы тест-системы в формате FLASH-ПЦР имеют целый ряд существенных преимуществ, перечисленных ранее, и полностью удовлетворяет всем предъявляемым к современным диагностическим системам требованиям, а следовательно, могут эффективно применяться для диагностики и идентификации соответствующих фитопатогенов.

Рис. 11. Диагностика аскохитоза огурца методом ПЦР (А) и FLASH-ПЦР (Б). 80, 322, 477, 478, 2185, 2382 — номера партий семян. «-» — К-, «+» — К+.

ВЫВОДЫ 1. Разработана общая стратегия диагностики фитопатогенов методом ПЦР в формате FLASH.

2. Подтверждено, что зонд типа «молекулярный маячок» обладает меньшим уровнем фоновой флуоресценции, чем TaqMan, и также, как и TaqMan, разрушается Taq-полимеразой с 5'-3' экзонуклеазной активностью, а следовательно лучше всего подходит для ПЦР в формате FLASH.

3. Созданы SCAR-маркеры для детекции 18 фитопатогенов методом ПЦР в формате FLASH по унифицированному алгоритму.

4. Для каждой тест-системы сконструированы и проклонированы положительные контроли.

5. Разработанные тест-системы внедрены в производство на базе ЗАО «НПФ ДНК-Технология».

Список работ, опубликованных по теме диссертации Статьи 1. Рязанцев Д.Ю., Абрамов Д.Д., Завриев С.К. (2006). ПЦР-диагностика основных патогенов картофеля. Вопросы картофелеводства. Актуальные проблемы науки и практики. М.: ВНИИ картофельного хозяйства. с. 242-248.

2. Завриев С.К., Рязанцев Д.Ю., Кошкина Т.Е. и Абрамов Д.Д. (2007).

Эффективный и экономичный метод чувствительной диагностики и идентификации патогенов картофеля. В сборнике: Картофелеводство России:

актуальные проблемы науки и практики. М.: ФГНУ «Росинформагротех», с.100-103.

3. Zavriev S.K., Ryazantsev D., Abramov D. and Koshkina T. (2007). Effective and efficient approach to potato pathogen sensitive detection and identification. In:

“Potato production and innovative technologies”. A.J. Haverkort and B.V. Anisimov (Eds). Wageningen Academic Publishers, p. 255-261.

4. Абрамова С.Л., Рязанцев Д.Ю., Воинова Т.М. и Завриев С.К. (2008).

Диагностика фитопатогенных грибов Septoria tritici и Stragonaspora nodorum методом FLASH–ПЦР. Биоорганическая химия, 34: 107-113.

5. Кулинич О.А., Рысс А.Ю., Чернецкая А.Ю., Пономарев В.Л., Рязанцев Д.Ю., Завриев С.К. (2008). Использование ПЦР-диагностики для идентификации карантинных видов нематод. Защита и карантин растений, №8: 36-39.

6. Рязанцев Д.Ю., Абрамова С. Л., Евстратова С. В., Гагкаева Т. Ю., Завриев С. К. (2008). Диагностика токсиногенных грибов рода Fusarium методом FLASH-PCR. Биоорганическая химия, 34: 716–724.

7. Рязанцев Д.Ю., Ребриков Д.В., Дробязина П.Е., Завриев С.К. (2008).

Диагностика основных фитопатогенов огурца и томата при выращивании в закрытом грунте методом полимеразной цепной реакции в формате FLASH с использованием диагностических наборов производства ЗАО «НПФ ДНК Технология». Методические указания. М.: ВНИИ фитопатологии РАСХН. 21 с.

8. Рязанцев Д.Ю., Завриев С.К. (2009). Эффективный метод диагностики и идентификации вирусных патогенов картофеля. Молекулярная биология, 43:

558–567.

9. Рязанцев Д.Ю., Абрамов Д.Д., Дробязина П.Е., Приходько Ю.Н., Завриев С.К. (2009). Диагностика ряда карантинных фитопатогенов методом полимеразной цепной реакции в формате FLASH при помощи диагностических наборов производства ООО «АгроДиагностика». Методические указания. М.:

ФГУ Всероссийский Центр Карантина Растений. 27 с.

10. Рязанцев Д.Ю., Абрамов Д.Д., Завриев С.К. (2009). Диагностика карантинных фитопатогенов методом ПЦР в формате FLASH.

Сельскохозяйственная биология, №3: 114-117.

Материалы конференций 1. Рязанцев Д.Ю. (2006). ПЦР-диагностика основных патогенов картофеля.

Материалы конференции "Грибы и водоросли в биоценозах". МГУ, с. 130-131.

2. Рязанцев Д.Ю., Абрамов Д.Д, Завриев С.К. (2008). Детекция ряда карантинных фитопатогенов методом ПЦР в формате FLASH. Материалы международной школы-конференции «Генетика микроорганизмов и биотехнология». Москва-Пущино, 21-24 октября. с. 76.

3. Рязанцев Д.Ю., Абрамова С.Л., Евстратова С.В., Гагкаева Т.Ю., Завриев С.К. (2008). ДНК-технологии для диагностики и идентификации токсигенных патогенов зерна и продуктов его переработки. Материалы международной научно-практической конференции «Биотехнология. Вода и пищевые продукты», Москва, с. 364- 4. Завриев С.К., Рязанцев Д.Ю., Абрамов Д.Д. (2008). Разработка систем для детекции и идентификации карантинных нематод Bursaphelenchus и Globodera на основе FLASH-PCR. Материалы международного научно практического совещания «Паразитические нематоды растений, биоразнообразие, изучение, коллекции». ВНИИ фитопатологии РАСХН, Голицыно, 8-9 апреля 2008.

5. Рязанцев Д.Ю., Абрамов Д.Д, Завриев С.К. (2009). Детекция ряда карантинных фитопатогенов методом ПЦР в формате FLASH. Материалы всероссийской научно-координационной конференции «Использование мировых генетических ресурсов ВИР в создании сортов картофеля нового поколения». Санкт-Петербург, 28-29 июля. с. 265-272.

Приложение

 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.