авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Анализ структуры и получение в прокариотической системе рекомбинантного белка g2 хантавир уса серотипа пуумала, изолированного из зоонозного очага на территории республики башкортостан

На правах рукописи

Мухаметханов Наиль Ханафиевич АНАЛИЗ СТРУКТУРЫ И ПОЛУЧЕНИЕ В ПРОКАРИОТИЧЕСКОЙ СИСТЕМЕ РЕКОМБИНАНТНОГО БЕЛКА G2 ХАНТАВИР УСА СЕРОТИПА ПУУМАЛА, ИЗОЛИРОВАННОГО ИЗ ЗООНОЗНОГО ОЧАГА НА ТЕРРИТОРИИ РЕСПУБЛИКИ БАШКОРТОСТАН 03.01.03 – молекулярная биология

АВТОРЕФЕРАТ

Диссертации на соискание ученой степени кандидата биологических наук

Уфа – 2010 1

Работа выполнена в лаборатории вирусных препаратов «НПО «Микроген»» МЗ РФ филиал «Иммунопрепарат» доктор биологических наук, доцент

Научный консультант:

Баймиев Алексей Ханифович Учреждение Российской Академии наук Институт биохимии и генетики Уфимского научного центра РАН доктор биологических наук, профессор Официальные Чемерис Алексей Викторович оппоненты:

Учреждение Российской Академии наук Институт биохимии и генетики Уфимского научного центра РАН доктор биологических наук Шевелев Алексей Борисович Учреждение Российской Академии медицинских наук Институт полиомиелита и вирусных энцефалитов Учреждение Российской Академии медицинских

Ведущая организация:

наук НИИ вакцин и сывороток им.И.И. Мечникова РАМН

Защита диссертации состоится «_» 2010 г. в «» часов на заседании Объединенного диссертационного совета ДМ 002.133. при Учреждении Российской Академии наук Институт биохимии и генетики Уфимского научного центра РАН по адресу: Уфа, пр. Октября,

С диссертацией можно ознакомиться в библиотеке Уфимского научного центра РАН (Уфа, пр. Октября, 71) и на сайте ИБГ УНЦ РАН ibg.anrb.ru/dissov.html e-mail: molgen@anrb.ru

Автореферат разослан «» 2010 г.

Ученый секретарь диссертационного совета Бикбулатова С.М.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Геморрагическая лихорадка с почечным синдро мом (ГЛПС) - широко распространенное в странах Евроазиатского континента природно-очаговое заболевание, вызываемое хантавирусной инфекцией. В Евро пейской части Российской Федерации на территории Республики Башкортостан (РБ) находится самый крупный и активный природно-зоонозный очаг этого забо левания. Основным возбудителем ГЛПС в Башкортостане является хантавирус се ротипа Пуумала (PUU). В Восточной Сибири и на Дальнем Востоке, ГЛПС с более тяжелой формой вызывается серотипом Сеул (SEU) и Хантаан (HTN). Актуаль ность изучения проблемы обусловлена отсутствием тенденции к снижению забо леваемости, тяжестью течения с развитием различных тяжелых осложнений (ток сико-инфекционный шок, почечная недостаточность, разрыв почек, тромбогемор рагический синдром, кровоизлияние) и значительным экономическим ущербом. К сожалению, на сегодняшний день еще не получены эффективные специфические средства для профилактики и этиотропной терапии ГЛПС. Динамика заболеваемо сти ГЛПС в республике характеризуется эпидемическими вспышками каждые 3– года. Подобные вспышки связаны с массовым размножением рыжих полевок и высоким уровнем инфицированности грызунов – природного резервуара для виру са. Кроме того, подъем заболеваемости ГЛПС в годы с низкой численностью по левок, а также отличия в тяжести инфекционного процесса могут быть вызваны, в том числе, антигенной вариабельностью и разной степенью патогенности цирку лирующих на территории РБ штаммов хантавирусов, возбудителей ГЛПС. Пере дача вируса от грызуна к человеку происходит в основном воздушно-капельным путем и через экскременты животных (Schmaliohn et al., 1985;

Chu et al., 1994;

Avsic-Zupanc et al., 1995). Ежегодно по всему миру фиксируется более 150– тысяч случаев заболевания ГЛПС.

Эффективность лечения любого заболевания определяется его точной диаг ностикой на раннем этапе заболевания. Для диагностики ГЛПС наиболее широко используются методы, основанные на детекции специфических антител. В них ис пользуется фиксированный ацетоном антиген, полученный из культуры клеток Vero E6, инфицированных патогенным хантавирусом (Lee et al., 1985). Получение подобного препарата является весьма трудоемкой и опасной процедурой. Альтер нативой традиционному получению антигена может стать рекомбинантный ви русный белок, синтезированный в про- или эукариотической системе экспрессии.

При наличии эффективных штаммов-продуцентов получение рекомбинантного белка потребует значительно меньше времени, кроме того, отсутствует необходи мость работы непосредственно с вирусом.

Разработанные и лицензированные на сегодняшний день вакцинные препа раты для профилактики ГЛПС представляют собой «живые» аттенюированные вакцины, созданные на основе вирусов серотипов HTN и SEU, циркулирующих, преимущественно, в странах Азии – Китае и Южной Корее (Song et al., 1998;

Lee et al., 2001). К тому же, по ряду сообщений, указанные вакцинные препараты инду цируют низкий уровень синтеза нейтрализующих антител у иммунизированных людей. На территории России основным возбудителем ГЛПС является вирус серо типа PUU, и поэтому нет оснований утверждать, что данные вакцины окажут эф фективное профилактическое действие. В качестве альтернативы обычным вакци нам уже разработаны и разрабатываются новые рекомбинантные вакцины, напри мер, от гепатита В и С (Спасокукоцкий, 2000). Стратегия создания таких вакцин сводится к клонированию гена, чей продукт при экспрессии в подходящей системе приведет к продукции белка, способного вызвать при введении в организм челове ка синтез вируснейтрализующих антител. Еще одним направлением в области ре комбинантных технологий является разработка ДНК-вакцин. Принцип ДНК вакцинации основан на введении в организм векторной ДНК, несущей гены бел ков, продукция которых приведет к полноценному иммунному ответу. Данный подход позволил получить антитела к множеству антигенов инфекционных пато генов вирусной и бактериальной природы (Dertzbaugh et al., 1997). В настоящее время, в ряде стран Западной Европы, а также в Китае и Южной Корее активно ведутся исследования, направленные на создание ДНК-вакцин для лечения и про филактики ГЛПС. Однако до введения ДНК-вакцин в медицинскую практику не обходимо провести эксперименты, подтверждающие их эффективность и безопас ность.

Цель работы заключалась в исследовании структуры гена поверхностного гликопротеина G2 хантавируса, выделенного из зоонозного очага на территории Республики Башкортостан и создании системы получения рекомбинантного белка G2 в клетках E. coli.

Задачи исследования:

1. Амплификация, клонирование и секвенирование гена гликопротеина G хантавируса, выделенного из органов грызунов и крови больных ГЛПС на терри тории Республики Башкортостан;

2. Анализ нуклеотидной и выведенной из нее аминокислотной последова тельности клонированного гена гликопротеина G2 и сравнение с аналогичными последовательностями исследованных ранее вирусов;

3. Получение генетической конструкции, содержащей ген поверхностного гликопротеина G2 исследуемого хантавируса, способного экспрессироваться в прокариотической системе;

4. Получение рекомбинантного белка G2 в клетках E. coli.

Научная новизна. Установлено, что на территории Республики Башкорто стан циркулирует хантавирус Ufa-2005 серотип PUU. Определена полная последо вательность кодирующей области гена G2. Получена генно-инженерная конструк ция на основе векторов pBluescript и pPinPoint, включающих в себя ген гликопро теина G2 хантавируса серотипа PUU, экспрессия которого регулируется бактери альным lac промотором. Показана возможность экспрессии полноразмерного бел ка G2 хантавируса серотипа Пуумала в E. coli (штамм JM 109).

Практическая значимость Полученные результаты расширяют и допол няют представления о структуре нуклеотидной и белковой последовательностей хантавируса, который циркулировал на территории Республики Башкортостан и явился причиной вспышки ГЛПС в 2001-2005гг. Ген G2 из плазмидных конструк ций можно использовать для получения штамма-продуцента гликопротеина, для диагностических целей, ДНК-вакцины и рекомбинантной вакцины.

Апробация работы. Материалы диссертации были доложены на конферен ции «Актуальные вопросы разработки, производства и применения иммунобиоло гических и фармацевтических препаратов (Уфа, 2000);

на Всероссийской научно практической конференции «Медицина будущего» (Сочи, 2002);

на Всероссий ской конференции с международным участием «Медицинские иммунобиологиче ские препараты в ХХI веке: разработка, производство и применение», посвящен ной 100-летию основания филиала «Иммунопрепарат» (Уфа, 2005);

«История изу чения и современное состояние эпидемиологии, патогенеза, диагностики, лечения и профилактики» (Уфа, 2006).

Публикации. По материалам диссертации опубликовано 5 работ, в том чис ле 1 статья в журнале из Перечня ВАК.

ОБЪЕКТ И МЕТОДЫ ИССЛЕДОВАНИЙ Объект исследования – хантавирус (род Hantavirus), который был основным этиологическим агентом ГЛПС на Южном Урале за период 2001 – 2005 гг.

Выделение и очистка тотальной РНК из крови больных и образцов легочной ткани рыжых полевок (Myodes, Clethrionomys glareolus), отловленных на террито рии Республики Башкортостан, проводилась экстракцией смесью гуанидинтио ционат-фенол-хлороформ (Chomczynski et al. 1987) и «Trizol Reagent» фирмы «In vitrogen». Выделение и очистку плазмидной ДНК проводили методом мягкого ли зиса с использованием Brij-58 (Pernecky, Coon 1996). Электрофоретическое фрак ционирование препаратов ДНК осуществляли в зависимости от размера разделяе мых фрагментов ДНК и требуемого разрешения, используя 0,6 – 1,8% агарозные гели. Синтез кДНК. ДНК, комплементарную вирусной геномной РНК, получали, используя фермент AMV-ревертазу (обратной транскриптазы вируса миелобласто за птиц) или MulV-ревертазу (Frohman 1988). Амплификацию вирусной кДНК проводили методом «гнездовой» полимеразной цепной реакции (ПЦР) (Feldman 1993). Компетентные клетки готовили по Kushner (Kushner 1978), с некоторыми изменениями. Молекулярную массу полипептидов определяли методом коэлек трофореза белков с известными значениями молекулярных масс (Laemmli 1970).

Твердофазный иммуноферментный анализ проводили, используя тест-систему для определения антигенов хантавирусов «Хантагност». Определяли величину погло щения света при длине волны 492 нм на приборе «Унискан II» (Flow laboratories Финляндия) (Гловер 1989).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ Выделение геномной РНК хантавируса Из 0,5 г ткани легких зараженных мышей гуанидинтиоционат-фенол хлороформным методом была выделена тотальная РНК. Для выделения М сегмента генома из вирусного материала использовали метод обратной транс крипции с полимеразной цепной реакцией (ОТ-ПЦР). В пяти препаратах было от мечено накопление продуктов кДНК с размерами, которые соответствовали теоре тически ожидаемым - около 2000 п.н. (рис. 1).

1 2 3 4 5 6 7 Рис. 1. Электрофоретический анализ продуктов кДНК гена G2.

Дорожки: 1, 8 – маркер весов (ДНК фага : BssTI);

2 - 6 – кДНК-копии гена G2;

7 – отсутствие продукта.

Для увеличения наработки целевого продукта использовали метод гнездовой ПЦР (nested PCR) (рис. 2) с использованием внешней (М1 и М2) и внутренней па ры (М3 и М4) праймеров в два раунда. В амплификации использовали праймеры, представленные в таблице 1. Продукт амплификации фрагмента М-сегмента был очищен методом фенольно-хлороформной экстракции и клонирован в вектор pGEM-TEasy («Promega», США).

Далее была определена нуклеотидная последовательность данного фрагмен та и зарегистрирована (Ufa-2005) в базе данных GenBank.

1 2 3 4 5 6 7 8 Рис. 2. Электрофоретический анализ продуктов ПЦР.

1 – 4 – продукты ПЦР реакции при использовании внешних М1и М2 праймеров (1876 н.п.);

5 – 8 – продукты гнездовой ПЦР реакции с использованием внутрен них пар М3 и М4 праймеров (1543 н.п.);

9 – ДНК фага : BssTI) Таблица Праймеры для амплификации кДНК фрагмента М-сегмента, соответствующего гену G2 хантавируса.

Наиме- Нуклеотид- Последовательность праймера Ориента- Размер нование ная пози- ция ПЦР прай- ция праймера продук мера та (п.н.) М1 1796, 1817 5CCATCTGAGGCAACAACATCTG-3 «+» М2 3668, 3647 5-GCAAGAACAAA AGTCCAGGCAT-3 «-» М3 1945,1975 5-TCGGTTCTTTGTGATGCTAGTCTGG- «+» TGCGTG- М4 3487, 3455 5-TTAGGGCTTATGTTCTTTCCTGTAA- «-» CTAGGTCT- Анализ нуклеотидной последовательности фрагмента вирусного генома, соответствующей гену G2 хантавируса Ufa- При сравнительном анализе нуклеотидной последовательности клонирован ного нами фрагмента с первичной структурой соответствующего участка М сегмента штамма хантавируса CG-1820 было обнаружено, что на всем протяжении исследуемого фрагмента, соответствующего кодирующей последовательности гликопротеина G2 имеются отдельные несовпадения в нуклеотидной последова тельности. Уровень гомологии сравниваемых участков составляет 94,7%. Были выявлены следующие отличия: в положении 1990 была обнаружена замена CG, в положении 1997 GA, 2063 AG, 2109 AC, 2143 AG, 2215 GA, AG, 2602 CT, 2724 CG, 2763 CT, 2781 AT, 2829 AG, 2837 TC, CT, 2866 TC, 2893 TC, 2896 AG, 3269-3270 CCGG. Замена в положении 2063 привела к замене аминокислоты RG, в положении 2109 QP, 2724 PR, 2763 AV, 2781 QL, 2829 KR, 2837 FL, 3269 PG.

Большая часть нуклеотидных замен в открытых рамках считывания иссле дованного М сегмента, соответствующего гену G2, сосредоточена в 3-й позиции кодонов, вследствие чего они не оказывают влияния на аминокислотные последо вательности вирусного белка. Обнаруженные изменения в аминокислотных после довательностях белков хантавируса сводятся к взаимным заменам гидрофобной аминокислоты с короткой боковой цепью – аланина на валин, основной аминокис лоты лизина на аргинин, что оказывает минимальное воздействие на вторичную структуру белка. Однако, наблюдаются и значимые для сохранения конформации и общего заряда белка замены гидрофобных аминокислот на полярные и наоборот, в следующих положениях: 2063 (аргинин на глицин), 2109 и 2781 (глютамат на пролин и лейцин, соответственно), 2837 (пролин на аргинин) и 2724 (фенилаланин на лейцин).

В настоящее время эволюционная взаимосвязь хантавирусов устанавливается на основе сравнительного анализа соответствующих нуклеотидных последова тельностей M, S и L сегментов генома вируса (Antic et al., 1992;

Spiropoulou et al., 1994;

Vapalahti, 1996;

). Antic и соавт. (1992) выделяют два различных эволюцион ных направления хантавирусов: один включает вирусы, переносимые Apodemus и Rattus (семейство Мышиные, Muridae), такие как HTN (Хантаан) и SEU (Сеул) се ротипы, а другой включает серотипы, переносимые Clethrionomys и Microtus (се мейство Хомякообразные, Cricetidae), такие как серотипы PUU (Пуумала) и PH (Проспект Хилл). В последние годы были выделены вирусы, впоследствии клас сифицированные как хантавирусы, переносимые землеройками (семейство Земле ройковые Soricidae), которые отделились и эволюционировали самостоятельно в гораздо более ранний период по сравнению с другими хантавирусами. Открытия новых хантовирусов (Kang H., 2009;

Song J.-W., 2009) несколько изменило точку зрения на эволюцию хантавирусов, предложенную Antic и соавт. (1992).

Филогенетический анализ, проведенный на основе компьютерного выравни вания нуклеотидных последовательностей M-сегментов (рис. 3), зарегистрирован ных в электронном банке нуклеотидных последовательностей GenBank (NCBI, США) показал, что изолированный нами вирус на дендрограммах находится в об щем кластере хантавирусных штаммов, выделенных ранее на территории Респуб лики Башкортостан. Исследователи по-разному оценивают роль географического фактора в эволюции хантавирусов. Например, Plyusnin с соавт. (1994) считают, что штаммовые различия хантавирусов связаны с их географической удаленностью друг от друга.

Взаимосвязь между генетической и географической отдаленностью штаммов была также показана для PUU штаммов из Центральной Европы, для HTN штам мов из Китая и из Кореи, для SNV и других хантавирусов из США (Schmaliohn et al., 1988;

Xiao et al., 1993;

Liang et al., 1994;

Bowen et al., 1995;

Rowe et al., 1995;

Hielle et al., 1995;

Song et al., 1996).

Определенный нами уровень нуклеотидных различий для М-сегментов штаммов, выделенных из популяций грызунов в разных странах, составил 25 – 40%;

для штаммов, изолированных в одной стране - 12 – 18%, и для штаммов, изо лированных в одной популяции 4 – 8%. Штаммы формируют отдельные группы в соответствии с местом их изоляции: в Сербии, Греции, Словении – серотип DOBV, в Германии, Норвегии, Финляндии – PUU, в России в Приволжском ФО – PUU, на Дальнем Востоке России, в Китае и Южнoй Корее – Amur, HTN, SEU. А в США, Панаме, Мексике, Боливии выделены вирус SNV и другие хантавирусы, вы зывающие геморрагическую лихорадку с легочным синдромом (ГЛЛС). В группе российских штаммов для серотипа Пуумала были выделены несколько подгрупп:

вирусные изоляты из Казани, Ижевска, Уфы, Омска и Тюмени.

А В Рис. 3. Филогенетический анализ нуклеотидных (C) и аминокислотных (D) последовательностей гена G2 (Gc) некоторых изолированных хантавирусов. В скобках указаны названия штаммов и номера, под которыми нуклеотидные после довательности зарегистрированы в базе данных GenBank.

Необходимо отметить, что в Тюменской области циркулируют, помимо се ротипа PUUV, серотипы DOBV, TopografovV, TULV (Якименко и др., 2008);

на территории Омской области циркулируют серотипы хантавируса – PUUV, DOBV, TULV (Дзагурова и др., 1999;

Якименко и др., 2001). B Германии и Словакии вы делены серотипы PUU и TULV. Имеются данные, что на территории Республики Башкортостан также циркулируют два серотипа вируса – PUUV, DOBV (Ткаченко Е.А., 2006), что согласуется с исследованиями Antic с соавт. (1992), которые пола гают, что географический фактор не играет большой роли в эволюции этих виру сов, и в качестве примера приводят изоляцию как PUU-, так и HTN-подобных ви русов из одних и тех же географических регионов Восточной Европы, а также SEU- и HTN-подобных вирусов из одного и того же региона Кореи.

Сравнительный анализ нуклеотидных и аминокислотных последовательно стей подтвердил вывод о географической кластеризации вирусных штаммов серо типа PUU. Наличие целого ряда отличий в первичной структуре исследованных участков генома изолированного вируса Ufa-2005 при сравнении с ранее выделен ными в этом регионе штаммами требует проведения дополнительных исследова ний, направленных на установление стабильности и возможности циркуляции это го штамма в последующие годы.

Исследование первичной аминокислотной последовательности гликопротеина G2 изолированного вируса Ufa- Функции гликопротеинов вируса до настоящего времени полностью не выяс нены. Предполагается, что данные белки участвуют в механизме проникновения вируса в клетку хозяина. Слияние вируса с клеткой происходит через клатрин зависимый эндоцитоз (Jin et al., 2002). Есть основания полагать, что один из бел ков распознает и присоединяется к рецептору клетки мишени 3 интегрину, ис пользуя в качестве кофактора белки DAF/CD55 (Krautkrmer and Zeier, 2008), или предположительно к поверхностному белку массой 30 кДа (Kim et al., 2002), а дру гой осуществляет процесс слияния вируса с эндосомальной мембраной клетки.

Описаны два класса поверхностных гликопротеинов вирусов, опосредующих слияние вируса с мембраной клетки, различающейся по структуре и расположе нию активного центра. Предполагается, что в активном центре белка находится пептид слияния (peptide fusion), непосредственно встраивающийся в мембрану клетки. Callaher с сотруд. (2001) описали первый класс белков слияния, который охватывает различные семейства не родственных вирусов: гемагглютинин вируса гриппа (семейство Ортомиксовирусы), гликопротеин gp41 вируса иммунодефици та человека (семейство Лентиовирусы), F белок (семейство Парамиксовирусы), гликопротеин GP2 вируса Эбола (семейство Филовирусы) (Epand, 2003). Им свой ственна трехмерная кольцевая закрученная, преимущественно -спиральная структура с пептидом слияния, расположенным ближе к N-терминальному концу.

Длина пептида слияния различается в зависимости от вируса, но обычно содержит два или более цистеиновых остатка, стабилизирующих его третичную структуру.

У второго класса пептид слияния находится во внутренней области в пределах 60 150 аминокислот N-терминальной части белка и образует петлю, фланкированная -складчатой структурой (Allison et al., 2001). Такая структура организации белка слияния характерна для Е1 белка вируса Синдбис, Е белка вируса леса Семлики, (семейство Тогавирусы) и для гликопротеина Gc(G2) – семейство Буньявирусы.

Исследования выделенного на территории Республики Башкортостан гена гликопротеина G2 (Gс) вируса Ufa-2005 серотипа PUU с использованием пакета программ DNA star и ТМНММ (http://www.cbs.dtu.dk/services/TMHMM), позволи ли выявить определенное структурное сходство предполагаемого пептида слияния белка G2 (Gс) вируса Ufa-2005 с пептидом слияния других представителей родов семейства Буньявирусы, а также с представителями семейства Тогавирусы.

Анализ выведенной аминокислотной последовательности выявил некоторые функциональные участки, исходя из чего, нами предложена схема предполагаемо го белка слияния вируса. (рис. 4). Также обнаружено соответствие области пепти да слияния гликопротеина G2 вируса пептиду слияния у представителей родов се мейства Буньявирусы и Тогавирусы.

Рис. 4. Распределение консервативных аминокислот в гликопротеине G Пуумала вируса семейства Буньявирусы.

Показано, что область гликопротеина G2(Gс) (рис. 4), которая соответствует пептиду слияния у представителей родов Тосповирусы, Хантавирусы, Ортобунья вирусы, Найровирусы, а также для представителей семейства Тогавирусы: SIN, SFV, WEEV и включает 20 – 40 а.о. Консервативные аминокислотные остатки (рис. 5), отмеченные вертикальными стрелками, формируют пептид слияния у представителей вирусов семейства Буньявирусы и Тогавирусы. Идентичность аминокислот, формирующих пептид слияния, в отдельно взятом роду исследован ных нами вирусов в пределах одного семейства превышает 70%. Из анализа выве денных аминокислотных последовательностей у вируса Анды пептид слияния за нимает участок с 738 по 781 а.о., у вируса Ufa-2005 - с 745 по 788 а.о. и находится в аминоконцевой части гликопротеина G2(Gс).

Выявленные нами аминокислотные последовательности пептида слияния обогащены гидрофобными аминокислотами, в том числе, с высоким углом пово рота – глицином и пролином, ароматическими – фенилаланином и триптофаном.

Положение цистеиновых остатков, а также триптофана – высококонсервативно, что является важным фактором при формировании третичной структуры глико протеина Рис. 5. Сравнительный анализ пептидов слияния у представителей семейств Буньявирусы и Альфавирусы.

Для сравнительного анализа и поиска области пептида слияния, из базы дан ных NCBI были взяты следующие последовательности: семейство Буньявирусы, род Тосповирусы (AB274026, NC003620, NC008307, AY871097, AY574054), род Ортобуньявирусы род Найровирусы (AY286445, AY593725, NC001926);

(DQ206448, DQ211636, DQ81354);

род Хантавирусы патогенные (AB297666, U14136, NC005223, AJ410616, L37903, EF117248, L08754, AF030552, AY363179, AF288656, DQ285047, DQ284451) и Ufa-2005;

хантавирусы не патогенные:

(U36803, DQ825771, AY363179, L08756, X55129) и представители семейства Тога вирусы: X77425, J02363, DQ422027.

Предполагается, что цистеиновые остатки в пептиде слияния образуют петлю с экспонированным триптофаном, который внедряется в плазматическую мембра ну клетки мишени. Дисульфидные связи в пептиде слияния у вируса Анды обра зуются между 738 и 773 а. о., 754 и 780 а. о. (Tischler et al., 2005), у вируса Ufa 2005 – между 745 и 780 а. о., 761 и 787 а. о. Аминокислотные последовательности в белке слияния у представителей семейств Буньявирусы и Тогавирусы различа ются;

тем не менее, обнаруживается определенное структурное сходство в поло жениях аминокислот (глицин, пролин, фенилаланин, триптофан), играющих важ ную роль в структурной организации пептида слияния. Анализ гидрофобно гидрофильных профилей Е1 белка у вируса Синдбис и G2 вируса Ufa-2005 также выявил выраженную закономерность между этими белками (за исключением не которых районов (рис. 6).

Гидрофобно-гидрофильные профили гликопротеинов вирусов практически совпадают, несмотря на то, что вирусы относятся к разным семействам. Вероятно, механизм проникновения вирусов SIN и изолированного нами вируса один и тот же, опосредованный соответственно гликопротеинами Е1 и G2, и, следовательно, определяется общей закономерностью в структурной организации этих белков.

Рис. 6. Гидрофобно-гидрофильные профили Е1 белка вируса Синдбис и G вируса Ufa-2005 Вертикальными линиями выделены области, соответствующие пептиду слияния и также трансмембранному району у двух вирусов Сравнительный анализ фрагмента аминокислотной последовательности, со ответствующей пептиду слияния гликопротеина G2 вируса Ufa-2005 и аналогич ных описанных раннее последовательностей пептидов слияния рода Хантавирусы – HTN, SEU, AND, представителей рода Флебовирусы – SAN, а также представи телей семейства Тогавирусы – SIN, SRF позволили выявить значительную гомоло гию между этими участками. Основываясь на данных сравнительного анализа аминокислотных последовательностей гликопротеинов G2 буньявирусов и Е1 то гавирусов, мы можем предположить, что гликопротеин G2 изолированного вируса Ufa-2005 относится к белкам слияния.

Клонирование и изучение экспрессии гена G2 вируса Ufa- Для подбора праймеров была использована нуклеотидная последователь ность штамма CG-1820 (М29979) серотипа PUU. Полученный ПЦР-продукт, пред ставляющий собой фрагмент кДНК копии М-сегмента, длиной 1543 п.н., соответ ствующий полной кодирующей последовательности гена G2, был клонирован в вектор pGEM-Tеasy. Клонированный ген G2 не имел инициирующего кодона, так как триплет ATG находится в гене белка G1. В связи с этим нами были подобраны праймеры: 5'-ctagtctgaattctggtaatggttcatcacttaattg-3' и 5'- ggttcatgaattcattgtaatggctgccag-3', включающие инициирующий ATG кодон. Для создания экспрессирующей конст рукции с геном G2 из вектора pGEM-G2 методом ПЦР был наработан полнораз мерный ген G2. Амплифицированный фрагмент с ATG кодоном, был встроен в ген lac-Z бактериального вектора pBluescript II SК– после последовательности, коди рующей первые 40 а.к. b-галактозидазы под контролем lac-промотора. В результа те были получены рекомбинантные клоны pBluescript-G2 (рис. 7), среди которых после электрофоретического фракционирования в агарозном геле были отобраны плазмиды со вставкой для дальнейшего рестрикционного анализа (рис. 8).

12 3 4 5 6 7 8 9 10 11 12 Рис. 7. Электрофоретический анализ ДНК рекомбинантных клонов.

1, 8 – плазмида pBluescript;

2, 6, 7, 9 – плазмида без вставки;

3, 4, 5, 10, 11, 12, 13 – рекомбинантные плазмиды Для рестрикционного анализа рекомбинантных клонов с целью определения ориентации вставки гена G2, использовали эндонуклеазу PstI. Уникальный сайт PstI имеется в полилинкерной области вектора и в последовательности вставки (сайт для рестриктазы PstI – 243 нуклеотид от 5' концевой части гена).

12 34 5 6 7 8 9 10 11 Рис. 8. Электрофореграмма продуктов рестрикции ДНК рекомбинантных клонов pBluescript-G2, несущих ген G2 белка.

1, 12 - ДНК бактериофага / BssTI;

2, 4, 6, 7, 8, 9- рекомбинантные клоны pBluescript-G2 : PstI, не содержащие нужную вставку;

3, 7 - рекомбинантные кло ны pBluescript-G2 в прямой ориентации;

5, 11 - рекомбинантные клоны pBluescript-G2 в обратной ориентации.

Гидролиз плазмид серии pBluescript-G2 рестриктазой PstI, содержащей вставку в прямой ориентации, давал фрагменты длиной 1313 и 3230 п.н., в обрат ной ориентации - 4287 и 256 п.н.

Предполагалось, что в полученных клонах pBluescript-G2 ген гликопротеина G2 хантавируса Ufa-2005 будет экспрессироваться в E. coli с образованием гиб ридного белка в результате снятия репрессии с промоторного участка гена lac Z лактозного оперона индуктором ИПТГ. Секвенирование с использованием прай мера к Т7 промотору (5'– taatacgactcactataggggaattg – 3') подтвердило, что клони рованный ген G2 находится в одной рамке считывания с lac-Z фрагментом. В то же время, после проведения электрофоретического фракционирования в ПААГ ДСН геле клонов с рекомбинантным вектором pBluescript-G2, которые прокульти вировали в условиях индукции, не было обнаружено полосы, соответствующей по массе(57-60 кДа) рекомбинантному белку G2. Причины отсутствия экспрессии белка не удалось выяснить. Поэтому на следующем этапе работы, ген G2 с вектора pBluescript-G2 был вырезан и клонирован в экспрессирующий вектор рPinPoint по сайтам рестрикции HindIII и BamHI (Promega. США). Векторная система рPin Point состоит из трех плазмид. Каждая плазмида имеет сдвиг на один нуклеотид в области полилинкера (МСS), что позволяет синхронизировать промотор lac-Z стрептавидин с клонированным геном.

Определение нуклеотидных последовательностей рекомбинантных клонов pPinPoint-G2 подтвердило, что ген G2 был клонирован в нужной рамке считыва ния. При инициации трансляции с AUG кодона должен синтезироваться гибрид ный белок, включающий 128 а.о. белка стрептавидина и полноразмерный белок G2. Для исследования экспрессии гена G2 вируса Ufa-2005 бактериальные клетки E. coli (штамм JM109), трансформированные векторами серии рPinPoint-G2, куль тивировали в условиях индукции. В качестве контроля использовали клетки тех же самых клонов, отобранные до индукции. В большинстве случаев результат был отрицательным, т. е. в опытных образцах белковый продукт с ожидаемой молеку лярной массой не был зарегистрирован. Однако в некоторых клонах методом элек трофоретического фракционирования в ПААГ-ДСН геле было отмечено появле ние белка, отсутствовавшего в контрольных образцах. Молекулярный вес данного белкового продукта соответствовал молекулярной массе комбинированного стреп тавидин-G2 белка и составил 70-76 кДа. Уровень синтеза рекомбинантного белка в клетках E. coli значительно варьировал от мало заметной до хорошо видимой по лосы на электрофореграмме (рис. 9).

Рис. 9. ПААГ-ДСН гель-электрофорез белков.

1, 2 – клоны до индукции;

4, 5, 6 – клоны после индукции;

3 – маркерные белки (“Serva”, Германия): химотрипсиноген A – 25 кDa, -галактозидаза Е.coli – 116 кДа, бычий альбумин- 67 кDa, яичный альбумин – 45 кDa, лактат дегидрогеназа – 35 кДа, эндонуклеаза рестрикции Bsp98I – 25кДа, -лактоглобин – 18,4 кДа.

Стрелкой отмечена полоса, соответствующая белку стрептавидин-G Определение антигенных свойств рекомбинантного белка G вируса Ufa-2005 методом ИФА Антигенные свойства рекомбинантного белка G2 выявили иммунофермент ным анализом, используя тест-систему для определения антигенов хантавирусов «Хантагност», разработанную Институтом полиомиелита и вирусных энцефалитов РАМН имени М. П. Чумакова, согласно рекомендациям производителя (рис. 10).

Оптическую плотность измеряли на спектрофотометрическом оборудовании «Унискан» при длине волны 492нм. Для данной тест-системы положительными считаются пробы, оптическая плотность которых в лунках с антихантавирусным IgG превосходит оптическую плотность лунок с нормальным IgG более чем в раза.

IgG человека IgG человека вирусный IgG вирусный IgG нормальный нормальный антиханта антиханта 0,273 0, A 1,923 0, 0.445 0,422 0,362 0, B 0,300 0,291 0,289 0, C 0,587 0,643 0,416 0, D 0,523 0,608 0,347 0, E 0.374 0,368 0,355 0, F 0,402 0,382 0,212 0, G H 2,303 0,498 1,316 0, К+ К– Рис. 10. Иммуноферментный анализ рекомбинантного белка G вируса Ufa- К+ - контроль с вирусным антигеном К– - нормальный IgG человека По результатам измерения оптической плотности положительными являют ся клоны А1 и Н1, разница оптической плотности в которых соответственно равна 6,24 и 4,62. В контроле разница оптической плотности превышала более чем в раза. Остальные образцы показали отрицательный результат, т.е. в них экспрессия рекомбинантного белка происходила с низкой эффективностью. Из результатов иммуноферментного анализа можно сделать вывод, что полученные клоны А1 и Н1 штамма E coli JM 109, трансформированные плазмидой рPinPoint-G2, синтези ровали рекомбинантный белок G2.

Заключение Выделен и получен полноразмерный ген вирусного гликопротеина G2 хан тавируса Ufa-2005. Сравнительный анализ нуклеотидных последовательностей изолированного вируса Ufa-2005 показал, что данный вирус имеет генетически общее происхождение со штаммами, выделенными ранее в Республике Башкорто стан из рыжей полевки (Clethrionomys glareolus). Были выявлены замены в нуклео тидной последовательности выделенного гена G2 от соответствующих участков первичной структуры M-сегмента штаммов: CG-1820, CG17, К27. Наличие целого ряда отличий в первичной структуре исследованного участка М сегмента вируса Ufa-2005 требует проведения дополнительных исследований, направленных на ус тановление стабильности и возможности циркуляции вируса в последующие годы.

Сконструированы векторные системы pGEM-G2, pBluescript-G2 и рPinPoint G2, кодирующие ген гликопротеина G2. Плазмидные конструкции могут исполь зоваться в качестве донора гена G2 при получении рекомбинантной вакцины в дрожжевой векторной системе(Pichia pastoris) и ДНК-вакцины. Следует отметить, что плазмида была получена на основе серотипа PUU – основного возбудителя ГЛПС в Республике Башкортостан.

Выводы 1. Амплифицирован, клонирован и секвенирован ген гликопротеина G2 хан тавируса, выделенного из органов грызунов и крови больных во время вспышки ГЛПС 2001-2005 гг. на территории Республики Башкортостан.

2. Показано, что исследуемый хантавирус Ufa-2005 относится к серотипу Пуумала и имеет общее генетическое происхождение со штаммами, выделенными ранее на данной территории.

3. Из анализа нуклеотидной и выведенной из нее аминокислотной последо вательности клонированного гена гликопротеина G2 и сравнение с аналогичными последовательностями исследованных ранее вирусов предполагается, что глико протеин G2 Ufa-2005 относится к белку слияния.

4. Получена генетическая конструкция на основе вектора рPinPoint, способ ная экспрессироваться в клетках E. coli, содержащая полную последовательность кодирующей области гена поверхностного гликопротеина G2 исследуемого ханта вируса под контролем индуцируемого бактериального промотора lac Z.

5. Показано, что синтезируемый в клетках E. coli белок G2 содержит анти генные детерминанты, определяемые иммуноферментным анализом тест-системой «Хантагност», и может быть использован для диагностических целей.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ

1. Хасанова С.С., Хайбуллина С.Ф., Ли Л.Е., Мухаметханов Н.Х., Веселов С.Ю., Кулагин В.Ф. Поиск условий экономичного синтеза рекомбинантного нуклеокап сидного белка вируса ГЛПС для создания тест-систем // БашГУ. – Итоги биологи ческих исследований за 2000 г. – Уфа. – 2001. вып. 6. – С. 67 – 68.

2. Мухаметханов Н. Х., Хасанова С.С. Получение и клонирование гена G2 ханта вируса в вектор pGEM-T // Cборник материалов и тезисов научно-практической конференции «Медицина будущего». – Сочи. –2002. – С. 70.

3. Хайбуллина С.Ф., Хасанова С.С., Магазов Р.Ш., Морзунов С.П, Кулагин В.Ф., Алсынбаев М.М., Ли. Л.Е, Мухаметханов Н.Х. Разработка штаммов – продуцентов рекомбинантных белков вируса ГЛПС// БащГУ. – Итоги биологических исследо ваний за 2002 г. –Уфа. – 2003. вып. 8. – С.37 – 42.

4. Мухаметханов Н.Х., Баймиев А.Х., Кулагин В.Ф., Туйгунов М.М. Получение рекомбинантного гликопротеина G2 вируса Пуумала. // Материалы Всероссийской научно-практической конференции: история изучения и современное состояние эпидемиологии, патогенеза, диагностики, лечения и профилактики. – Уфа.- 2006. С. 151-156.

5. Мухаметханов Н.Х., Баймиев А.Х. Получение рекомбинантного белка G2 ханта вируса серотипа PUU // Тихоокеанский медицинский журнал (перечень ВАК).

2008.– № 2. С. 86-89.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.