авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Pages:   || 2 |

Создание интегрированной геномно-протеомной системы для типирования и изучения патогенов бактериальной и вирусной природы

-- [ Страница 1 ] --

На правах рукописи

Ильина Елена Николаевна «Создание интегрированной геномно-протеомной системы для типирования и изучения патогенов бактериальной и вирусной природы» 03.00.04 - биохимия

Автореферат диссертации на соискание ученой степени доктора биологических наук

Москва 2009

Работа выполнена в Федеральном государственном учреждении Научно исследовательский институт физико-химической медицины Федерального медико биологического агентства

Научный консультант:

доктор биологических наук, профессор Говорун Вадим Маркович

Официальные оппоненты:

член-корреспондент РАН, доктор химических наук, профессор Габибов Александр Габибович доктор биологических наук, профессор Северинов Константин Викторович доктор биологических наук, профессор Колесанова Екатерина Федоровна

Ведущая организация: Учреждение Российской академии медицинских наук Научно-исследовательский институт эпидемиологии и микробиологии имени почт ного академика Н.Ф.Гамалеи РАМН.

Защита диссертации состоится « 22 » октября 2009 года в_часов на заседании Диссертационного совета Д 001.010.01 при Учреждении Российской академии медицинских наук Научно-исследовательском институте биомедицинской химии имени В.Н.Ореховича РАМН (ИБМХ РАМН) по адресу: 119121, г. Москва, Погодинская ул., д.10.

С диссертацией можно ознакомиться в библиотеке ИБМХ РАМН.

Автореферат разослан «_» _2009 года

Ученый секретарь диссертационного совета, кандидат химических наук Карпова Елена Анатольевна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

.

Актуальность проблемы.

Болезни бактериальной и вирусной природы занимают лидирующие позиции в структуре заболеваемости в России [Гос. доклад Роспотребнадзора, 2008], а инфекци онные осложнения у пациентов хирургических и терапевтических стационаров пред ставляют угрозу жизни и являются реальной причиной длительной потери трудоспо собности. Серьезную проблему, обусловленную увеличение интенсивности курсов химиотерапии, представляет замещении дикой популяции возбудителей штаммами с множественной лекарственной устойчивостью, обладающими большей вирулентно стью и патогенностью. На этом фоне задачи, связанные с созданием и реализацией новых эффективных средств идентификации, характеристики и типирования клини чески-значимых патогенов, выглядят актуальными и своевременными.

Развитие методов обнаружения, описания структуры и функции природных биополимеров, к числу которых принадлежат молекулы нуклеиновых кислот и бел ков, во многом изменило наши представления о скорости мутационных процессов, предопределяющих природную вариабельность бактерий и вирусов и способствую щих формированию устойчивости к используемым химиотерапевтическим средствам.

В этой связи возникла насущная необходимость модернизации применяемых в клинической микробиологии диагностических и исследовательских средств. Акту альным стало создание и внедрение интегральных высокопроизводительных измери тельных систем, способных давать исчерпывающее представление о микробном со обществе в испытуемой пробе и определять клинически значимые свойства микроор ганизмов в максимально сжатые сроки на основании молекулярного анализа.

Традиционные методы идентификации и характеристики возбудителя, осно ванные на бактериологическом посеве, имеют ряд недостатков, к числу которых от носятся длительность исследования, лимитированная скоростью деления микробной клетки, относительная дороговизна метода, необходимость привлечения большого числа квалифицированных специалистов в силу сложности автоматизации аналитиче ских процедур. Кроме того, значительная часть патогенных микроорганизмов, в част ности представители анаэробной бактериальной флоры, фактически не анализируется в большинстве клинических лабораторий из-за трудности культивирования.

Изобретение и внедрение в медицинскую практику методов ПЦР-диагностики позволило сократить сроки анализа клинического образца для идентификации труд нокультивируемой бактериальной флоры и вирусов [Глик, 2002]. Однако, этот подход оказался недостаточным для установления профиля чувствительности и штаммового типирования микроорганизмов, необходимых для выбора рациональной фармакоте рапии и осуществления эпидемиологического надзора.

Приоритетность данного исследования состоит в создании уникальной геном но-протеомной измерительной системы, позволяющей выявлять механизмы форми рования лекарственной устойчивости микроорганизмов на молекулярном уровне, а также прогнозировать микроэволюционные события, изучая мутационные процессы в бактериальных и вирусных популяциях. Компоненты такой системы могут быть ис пользованы в мониторинге клинически-значимых микроорганизмов, а также приме нены в решении фундаментальных вопросов функционирования бактериальной клет ки.

Комбинация технологий генетического и протеомного типирования с исполь зованием матрично-активированной лазерной десорбции/ионизации времяпролетной масс-спектрометрии (МАЛДИ ВМС), как универсального анализатора, обеспечивает быструю идентификацию микрофлоры, позволяет осуществить молекулярное типи рование штаммов, провести оценку лекарственной устойчивости.

Созданные системы предназначены для одновременного исследования геном ных локусов, задействованных в формировании устойчивости бактерий к разным классам антимикробных препаратов (АМП), по одной универсальной технологии.

Кроме того, объединение технологии анализа на ДНК-чипе и созданных на основе МАЛДИ ВМС систем регистрации генетических детерминант устойчивости открыва ет перспективы установления профиля чувствительности патогена непосредственно в клиническом материале от пациента, минуя стадию культивирования in vitro.

Для иллюстрации возможностей созданной измерительной платформы объек тами исследования были выбраны клинически значимые микроорганизмы – Mycobacterium tuberculosis, Streptococcus pneumoniae, Neisseria gonorrhoeae, вирусы гепатита В и С, изучение которых безусловно актуально для практического здраво охранении России. Так, в 2007 году в России уровень заболеваемости на 100 тыс. на селения составил 82,9 для туберкулеза;

60,34 для гонореи;

5,8 и 3,58 для вирусных ге патитов В и С, соответственно [Гос. доклад Роспотребнадзора, 2008], что на порядок превышает аналогичные показатели для стран Евросоюза и США [ВОЗ, 2008].

В ряде стран изменчивость возбудителей этих заболеваний и их распростране ние контролируются в рамках международных и национальных программ, например International Union Against Tuberculosis and Lung Disease (IUATLD) (www.iuatld.org) или National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP) США (www.cdc.gov/nchhstp). В России соответствующие национальные программы находятся в стадии формирования и нуждаются в разработке и внедрении средств эффективного молекулярного мониторинга возбудителей бактериальных и вирусных инфекций.

Цель работы: создание и реализация вертикально интегрированной платфор мы геномно-протеомного типирования патогенов бактериальной (гонококк, пневмо кокк, микобактерии туберкулеза) и вирусной (вирусы гепатита В и С) природы для обеспечения широкомасштабного эпидемиологического мониторинга, определения факторов вирулентности и патогенности и изучения новых молекулярных механиз мов формирования лекарственной устойчивости.

Задачи исследования были:

1. Разработка и внедрение в практику комплексной технологии на основе времяпро летной МAЛДИ масс-спектрометрии для высокопроизводительного выявления нуклеотидных полиморфизмов в геномах бактерий и вирусов. Демонстрация воз можности комбинированного анализа биоматериала с применением технологии ДНК-чипов и масс-спектрометрического исследования.

2. Разработка и использование молекулярно-генетических тестов для типирования вирусов гепатита С и В, определение их аналитических характеристик.

3. Оптимизация и осуществление процедуры прямого масс-спектрометрического профилирования бактерий и оценка возможности его применения для типирования и видовой идентификации клинически значимых микроорганизмов.

4. Создание средств молекулярного типирования российской популяции M. tuberculosis и N. gonorrhoeae. Сопоставление информативности методов проте омного и геномного типирования бактерий.

5. Проведение широкомасштабных молекулярно-эпидемиологических исследований географически неоднородных групп (коллекций) штаммов гонококка, микобакте рий туберкулеза, пневмококка. Оценка основных тенденций генетической измен чивости в микробных популяциях на территории Российской Федерации.

6. Разработка нового алгоритма обнаружения неизвестных молекулярных механиз мов лекарственной устойчивости у бактерий и его демонстрация на примере ана лиза гонококка с привлечением протеомных исследований и моделирования ген ных (метаболических) сетей.

Научная новизна Впервые реализована возможность комбинированного применения новых мо лекулярных технологий – прямого МАЛДИ масс-спектрометрического профилирова ния бактериальных белков и исследования на ДНК-чипах – для видовой идентифика ции типичных представителей грамотрицательной и грамположительной флоры.

Впервые разработаны и реализованы в скрининге клинических изолятов пнев мококка, туберкулеза и гонококка высокопроизводительные системы выявление гене тических детерминант резистентности, в которых использован метод минисеквениро вания с последующей МАЛДИ масс-спектрометрической детекцией.

Впервые способ обнаружения однонуклеотидных полиморфизмов на основа нии МАЛДИ масс-спектрометрического анализа продуктов реакции минисеквениро вания использован для типирования возбудителей трансфузионных вирусных гепати тов В и С.

Для клинических изолятов S. pneumoniae и N. gonorrhoeae впервые определен спектр генетических мутаций, достоверно ассоциированных с устойчивостью к пени циллину, фторхинолонам, тетрациклину. Молекулярно-эпидемиологическое исследо вание коллекций клинических изолятов N. gonorrhoeae и M. tuberculosis, собранных в разных регионах РФ, позволило получить актуальную информацию о распростране нии генетических маркеров лекарственной устойчивости в микробных популяциях.

Впервые молекулярно-генетические особенности российской популяции M. tuberculosis и N. gonorrhoeae изучены с применением методов мультилокусного типирования (VNTR, NG-MAST, MLST), описаны новые сиквенс-типы, депонирован ные в мировые базы данных.

Впервые описан феномен резистентности к спектиномицину, обусловленный изолированной мутацией в рибосомальном белке S5;

выявлены нарушения в системе транслокации белков внешней мембраны, способствующие снижению чувствитель ности гонококка к пенициллинам, тетрациклинам, макролидам;

установлено вовлече ние в развитие толерантности к цефтриаксону механизмов, ответственных за выжива ние бактериальной клетки в условиях осмотического стресса.

Практическая значимость В практическом аспекте разработанная геномно-протеомная система характе ристики микроорганизмов решает задачи: 1) адекватной видовой идентификации па тогенов, 2) оценки профиля лекарственной устойчивости, 3) характеристики локаль ной (географической, временной) структуры популяции/субпопуляции возбудителя, отслеживания клонального родства и путей распространения инфекции.

На основании сопоставления спектра мутаций, выявляемых в генах мишений действия антибиотиков с фенотипом изолята, для каждого включенного в исследова ние микроба (S. pneumoniae, N. gonorrhoeae, M. tuberculosis) установлены генетиче ские маркеры, достоверно ассоциированные с формированием устойчивости к приме няемым в терапии этих инфекций лекарственным препаратам. Аналитическая чувст вительность предложенного способа установления генетически-детерминированной лекарственной устойчивости составила от 82 % до 96 % для разных групп препаратов, что демонстрирует перспективность применения этого подхода в практическом здра воохранении.

Для повышения эффективности мониторинга вирусных и бактериальных ин фекций разработаны, утверждены и внедрены в практику отечественного здравоохра нения наборы реагентов для выявления геномной ДНК N. gonorrhoeae, вируса гепати та В, РНК вируса гепатита С методом полимеразной цепной реакции - «Гонопол» «Полигеп В» и «Полигеп С» ТУ–9398-405-17253567-96, ТУ-9398-410-17253567-97.

Разработанные схемы молекулярно-генетического мониторинга N. gonorrhoeae и M. tuberculosis реализованы при выполнении в рамках Федеральной целевой про граммы «Предупреждение и борьба с заболеваниями социального характера (2002 2006 годы)» государственных контрактов № 03/ЦП «На проведение процедуры гено типирования, молекулярно-эпидемиологического мониторинга изолятов гонококка, выделенных из разных регионов Российской Федерации» от 1 ноября 2004 г.;

№ 24- «На проведение работ по генетическому типированию выделенных штаммов гоно кокка» от 23 сентября 2005 г.;

№ 06/365 на проведение работы по теме «Мониторинг лекарственной устойчивости микобактерий туберкулеза в Российской Федерации с использованием технологии масс-спектрометрии» от 15 марта 2006 г.

Разработанные технологии внедрены в клинико-лабораторную практику ГУ Центральный научно-исследовательский институт туберкулеза РАМН, ФГУ Государ ственный научный центр дерматовенерологии Минздравсоцразвития.

Апробация работы Основные результаты работы доложены и обсуждены на ежегодных итоговых конференциях НИИ ФХМ (2005 - 2008 г.г.), 15-ой и 16-ой Международных конфе ренциях по патогенным нейссериям (15th IPNC, Cairns, Australia, 2006, 16th IPNG, Рот тердам, 2008), 17-ом и 18-ом Европейских конгрессах по клинической микробиологии и инфекционным болезням (17th ECCMID, Мюнхен, 2007, 18th ECCMID, Барселона, 2008), 46-ой Междисциплинарной конференции по антибиотикам и антимикробной химиотерапии (47th ICAAC, Сан-Франциско, 2006), Международной научно практической конференции «Разработка противотуберкулезных терапевтических агентов нового поколения. Проблемы, подходы, перспективы» (Химки, 2006), VIII Российской конференции «Современные проблемы антимикробной терапии» (Моск ва, 2006), 55-ой Конференции Американского общества масс-спектрометрии (55th ASMS, Индианаполис, 2007), 39-ой Всемирной конференции по здоровью легких (39th Union World Conference on Lung Health, Париж, 2008), 3-ей и 4-ой Международных конференциях «Геномика, протеомика, биоинформатика и нанотехнологии для меди цины» (3rd GPBNM, Новосибирск, 2006, 4th GPBNM, Москва, 2008).

Публикации. По материалам диссертации опубликованы 39 печатных работ, из которых 34 в рекомендованных ВАК РФ изданиях.

Структура и объем диссертации. Диссертация изложена на 265 страницах машинописного текста;

состоит из введения, обзора литературы, экспериментальной части, включающей материалы и методы исследования, результаты, обсуждение и выводы. Работа иллюстрирована 51 таблицой и 41 рисунками;

библиографический указатель включает 514 публикаций, из которых 23 в изданиях на русском языке.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

1. Материалы и методы.

Объектами исследования служили лабораторные штаммы E. coli DH5, N. gonorrhoeae ATCC 49226, S. pneumoniaе ATCC 49619, а также клинические изоляты S. pneumoniaе (n = 234), M.

tuberculosis (n = 693), N. gonorrhoeae (n = 585), N. meningitidis (n = 15), непатогенные нейссерии (n = 15). Клинический материал включал мазки слизистой влагалища (n = 24) от пациенток с бактериаль ным вагинозом, соскобы из уретры, с головки полового члена и крайней плоти (n = 60) от пациентов с баланопоститом, образцы сывороток крови (n = 329) больных вирусными гепатитами В и С. Все бак териальные изоляты прошли стандартную процедуру видовой идентификации и тестирования лекар ственной чувствительности.

МАЛДИ масс-спектрометрическое профилирование. Свежие бактериальные клетки (1-2 ко лонии), находящиеся в стационарной фазе роста, переносили в 300 мкл деионизированной воды, пе ремешивали и добавляли 900 мкл этанола. Осадок после центрифугирования (15 мин х 14000 об/мин) растворяли в 20 мкл смеси 50 % ацетонитрила, 35 % муравьиной кислоты. Полученный последую щим центрифугированием супернатант анализировали с помощью масс-спектрометра MicroflexTM (Bruker Daltonics, Германия), применяя -циано-4-гидроксикоричную кислоту в качестве матрицы.

Для записи, обработки и анализа масс-спектров использовали flexControl 2.4 и flexAnalysis 2.4 (Bruker Daltonics, Германия). Кластерный анализ, сопоставление получаемых масс-спектров с имеющимися базами данных производили с помощью программного пакета Biotyper 1.1 (Bruker Daltonics, Герма ния).

Протеомное картирование. Свежие клетки N. gonorrhоeae, находящиеся в стационарной фазе роста, отмывали в физиологическом растворе и обрабатывали смесью нуклеаз. Белки переосаждали метанол/хлороформом и растворяли в буфере, содержащем 8 М мочевины, 2 М тиомочевины, 2 % амфолинов (рН 3 – 10), 100 мМ ДТТ, 16,7 % раствора (30 % СHAPS + 10 % NP40). Концентрацию белка в образцах измеряли по методу Бредфорда с помощью Quick start Bradford dye reagent (Bio-Rad, США). При необходимости белки метили цианинами CyDye3-DIGE и CyDye5-DIGE (GE Healthcare, Великобритания) согласно рекомендациям фирмы-производителя. В первом направлении (изоэлек трофокусирование) использовали 4 % ПААГ, 8 М мочевину и 4 % амфолины (GE Healthcare, Велико британия) рН 3-10, либо ИПГ стрипы 3-10 (Bio-Rad, США). Изоэлектрофокусировку осуществляли в режиме 100 В – 200 В– 300 В – 400 В – 500 В – 600 В – по 45 минут, 700 В – 10 часов, 900 В – 1 час.

По завершению изоэлектрофокусирования гели или ИПГ-стрипы вымачивали в буфере 62,5 мМ Tris HCl, pH 6,8, 6 М мочевины, 30 % глицерола, 2 % додецилсульфата натрия, 20 мМ ДТТ, в течение мин, переносили на поверхность градиентного полиакриламидного геля (9 – 16 %) и проводили элек трофорез во втором направлении. Электрофореграммы сканировали при длине волны 532 нм и нм на сканере TyphoonTrio (GE Healthcare, Великобритания) и анализировали программой PDQuest 8.0 (Bio-Rad, США). Дифференциальные белковые пятна вырезали из геля и подвергали трипсиноли зу. Полученные образцы анализировали с помощью MALDI-TOF/TOF Ultraflex II (Bruker Daltonik, Германия), используя 2,5-дигидробензойную кислоту в качестве матрицы. Идентификацию белков производили методом пептидного фингерпринта с использованием программы Mascot Peptide Fingerprint (Matrix Science, США).

Экстракция нуклеиновых кислот. Геномную ДНК бактериальных возбудителей, вируса гепа тита В, а также тотальную ДНК из клинического материала выделяли набором «ДНК экспресс» ООО НПФ Литех (ТУ- 9398-450-17253567-03). Выделение РНК ВГС и амплификацию фрагментов 5’ нетранслируемой области вирусного генома проводили с помощью набора «Полигеп С» OOO НПФ Литех (ТУ –9398-409-17253567-97).

Минисеквенирование с последующей МАЛДИ ВМС. Амплификацию целевых локусов бакте риальных и вирусных геномов проводили в буферной смеси, содержащей 66 мМ Tris-HCl, pH 9,0;

16,6 мM (NH4)2SO4;

2,5 мM MgCl2, по 250 мкМ каждого dNTP, 1 ед Taq-полимеразы (Promega, США) и по 5 пмоль специфичных праймеров в объеме 25 мкл. Реакцию осуществляли в амплификаторе DNA Engine Tetrad 2 (MJ Research, США), по универсальному профилю: 94 С – 5 мин.;

94 С – сек., 60 С – 15 сек., 72 С – 15 сек., 35 циклов. Дефосфорилирование 5’-концевых фосфатных групп dNTP в прошедшей амплификацию реакционной смеси проводили в ходе инкубации с 0,5 ед щелоч ной фосфатазы арктических креветок (Fermentas, Литва) в течение 20 минут при 37 С и последую щей инактивации фермента прогреванием в течении 10 мин при 85 С. Предназначенные для секве нирования образцы дополнительно обрабатывали 5 ед экзонуклеазой I E. coli (Fermentas, Литва) в аналогичных условия инкубации.

Реакцию минисеквенирования проводили в 10 мкл реакционной смеси 66 мМ Tris-HCl, pH 9,0;

16,6 мМ (NH4)2SO4;

2,5 мМ MgCl2;

по 0,2 мМ необходимых dNTP и/или ddNTP;

по 10 пмолей со ответствующих праймеров и 2 Ед TermiPol DNA Polymerase (Solis Biodyne, Эстония), используя в качестве матрицы амплифицированные фрагменты бактериальных или вирусных геномов. Реакцию осуществляли по профилю: 94 С – 20 сек, 60°С – 20 сек, 72 С – 15 сек, 70 циклов в амплификаторе DNA Engine Tetrad 2 (MJ Research, США). Для очистки продуктов реакции минисеквенирования в пробирку вносили 1 мг катион-обменной смолы SAC-50 (АНО «Синтез полимерных сорбентов») и инкубировали 15 мин при комнатной температуре. Сорбент осаждали центрифугированием. Супер натант (0,2-1 мкл) анализировали с помощью масс-спектрометра MicroflexTM (Bruker Daltonics, Гер мания), применяя 3-гидроксипиколиновую кислоту в качестве матрицы. Для записи, обработки и анализа масс-спектров использовали flexControl 2.4 и flexAnalysis 2.4 (Bruker Daltonics, Германия). По наличию в масс-спектрах продуктов реакции пиков, соответствующих ионам определенной ожидае мой молекулярной массы, судили о нуклеотидном контексте в данном положении.

Секвенирование фрагментов геномой ДНК проводили модифицированным методом Сенгера с использованием ABI Prism Terminator Cycle Sequencing Ready Reaction Kit и прибора ABI BigDye Prism 3100 Genetic Analyzer (Applied Biosystems, США) в соответствии с прилагаемыми инструк циями. Сборку и сравнение нуклеотидных последовательностей проводили с использованием моду лей ContigExpress и AlignX программного пакета «Vector NTI 9.0» (Informax Inc., США).

Исследование на ДНК-чипах. Видоспецифичные олигонуклеотидные зонды в концентрации 0,1 мM в 50 мM Na2HPO4 разносили на стеклянные слайды CodeLink (GE Healthcare, Великобрита ния), используя автоматический репликатор (SDDC-2 Microarrayer, Virtek Vision, США). Нанесенные зонды фиксировали в парах NaCl в течение 12 часов. Затем стекла инкубировали 30 мин в растворе 0,1 М Tris-HCl, рH 9,0, 50 мМ этаноламин при 60°C, 2 раза промывали водой, инкубировали 30 мин в растворе 4х SSC, 0,1 % додецилсульфат натрия при 60°C, снова промывали водой и высушивали. Для контроля процесса разнесения и пространственной локализации реакционных полей использовали меченый олигонуклеотидный зонд Cy3 - 5’aaggccgttgccaatatcggcg 3’- NH2.

Амплификацию проводили в 20 мкл смеси 66 мМ Tris-HCl, pH 9,0;

16,6 мM (NH4)2SO4;

2,5 мM MgCl2;

0,1 мг/мл желатина, 800 мкМ dATP, dGTP и dTTP, 200 мкМ dCTP, 1 пмоль Cy3DyeTM-dCTP (GE Healthcare, Великобритания), 1 ед. Taq-полимеразы (Promega, США), 2 пмоль и 20 пмоль прямо го и обратного универсальных праймеров по программе 93°C – 30 сек, 58°C – 30 сек, 72°С – 30 сек, 50 циклов. Ампликоны (15 мкл) смешивали с 15 мкл буфера 4x SSC;

0,1 % додецилсульфат натрия, инкубировали 5 мин при 94°С, вносили под гибридизационные камеры на стекла и помещали в тер мостат на 12 часов при 60°С. После гибридизации стекла освобождали от камер и 2 раза промывали 1 % раствором додецилсульфат натрия. Прошедшие процесс гибридизации и отмывки ДНК-чипы сканировали с помощью прибора Typhoon Trio (GE Healthcare, Великобритания). Результаты гибри дизации оценивали с помощью программного пакета TotalLab v 2.01 (Nonlinear Dynamics), принимая за положительный сигнал превышение фона на 12 % в 3-х из 4-х точках, соответствующих одному зонду. Суждение о присутствии конкретного микроорганизма выносили на основании регистрации гибридизации с соответствующим зондом.

Транскрипционный анализ. РНК N. gonorrhoeae выделяли SV Total RNA Isolation System (Promega, США) и немедленно подвергали обратной транскрипции с 200 ед обратной транскриптазы (Fermentas, Литва) в прилагающемся буфере с использованием рандомизированных праймеров дли ной 8 нт. ПЦР в реальном времени проводили в 30 мкл смеси, содержащей 66 мМ TrisHCl, рН 9,0, 16,6 мM (NH4)2SO4, 2 мМ MgCl2, 0,1 мМ SibrGreenTM, по 150 мкМ каждого dNTP, 1 ед Taq полимеразы (Promega, США) и по 5 пмоль соответствующих праймеров. Реакцию осуществляли в приборе AB Prizm 7000 (Applied Biosystems, США) по профилю: 94°С – 3 мин и 94°С – 30 сек, 60°С – 15 сек, 72°С – 30 сек, 35 циклов. Уровень экспрессии анализируемых генов оценивали относительно экспрессии генов «домашнего хозяйства» abcZ (putative ABC transporter) и adk (adenylate kinase).

Методы молекулярного типирования. Серотип гонококка устанавливали по принципу макси мальной гомологии при сравнении нуклеотидной последовательности гена porВ анализируемого изо лята с представленными в базе данных GenBank. Мультиантигенное типирование N. gonorrhoeae (NG-MAST) и мультилокусное секвенирование (MLST) осуществляли по методикам, описанным ра нее [Martin, 2004;

Bennett, 2007]. Анализ числа тандемных повторов в геномах изолятов M.

tuberculosis осуществляли по методикам Mazars, 2001 и Supply, 2006. Сполиготипирование осуществ ляли по протоколу Kamerbeek, 1997 с использованием набора «Spoligotyping Kit» (Isogen Lifescience, Нидерланды).

Статистические расчеты проводили с помощью программного пакета Statistica 6.0. Все тесты проводили для уровня значимости p0,05. Наличие ассоциации исследуемых фенотипических и гене тических признаков оценивали методом -квадрат Фишера. Для оценки вариабельности генетических локусов использовали индекс аллельного полиморфизма (h) [Selander, 1986]. Дискриминирующую способность методов типирования оценивали на основании индекса разнообразия Симпсона (D) [Simpson, 1949].

2. Результаты и их обсуждение 2.1. Создание геномно-протеомной платформы молекулярного типирова ния микроорганизмов.

На основании современных методов анализа природных биополимеров – бел ков и нуклеиновых кислот – были разработаны технологии, позволяющие решать круг задач, связанных с видовой идентификацией, оценкой профиля лекарственной чувствительности и молекулярного типирования клинически-значимых микроорга низмов. К ним относятся методики, базирующиеся на МАЛДИ ВМС – прямое белко вое профилирование, идентификация однонуклеотидных полиморфизмов ДНК мини секвенированием, а также исследование на ДНК-микроматрицах.

Протокол прямого белкового профилирования, включающий обработку бакте риальных клеток и параметры снятия МАЛДИ масс-спектров, был отработан на лабо раторном штамме E. coli DH5. За основу метода была взята кислая экстракция бел ков и пептидов, позволяющая наиболее полно выделять основные рибосомальные белки, составляющие 20 % от общего пула белков E. coli [Arnold, 1998]. Подобранные условия прямого МАЛДИ масс-спектрометрического профилирования позволили по лучить спектр E. coli, качественный состав которого аналогичен спектру, заявленному ранее для штамма E. coli К-12 [Ryzhov, 2001].

Реакция минисеквенирования с последующей детекцией продуктов МАЛДИ ВМС была использована для обнаружения в бактериальных или вирусных геномах полиморфных локусов, ответственных за формирование лекарственной устойчивости или позволяющих установить генотип патогена. Впервые подобная система разрабо тана в компании Sequenom для анализа однонуклеотидных полиморфизмов в геноме человека [Storm, 2002], приоритет применения этой технологии в области исследова ния прокариот принадлежит коллективу автора [Ilina, 2005].

Разработанные системы представляют собой последовательность процедур, разделенных условно на три блока: амплификация специфических фрагментов геном ной ДНК, потенциально содержащих искомые полиморфизмы, осуществление реак ций минисеквенирования в присутствии заданного набора dNTP/ddNTP, масс спектрометрическое исследование продуктов удлинения праймеров с последующим выводом о нуклеотидном контексте в точке полиморфизма (рис. 1).

Рисунок 1. Схематичное представление реакции минисеквенирования с последующей МАЛДИ ВМС детекцией. Внутренние олигонуклеотидные праймеры прилегают к точке полимор физма (вариабельные нуклеотиды выделены жирным). Терминирующие процесс элонгации праймера дидезоксинуклеотиды обозначены звездочкой. Исходные праймеры и продукты реакции минисекве нирования выделены рамкой. Масс-спектры продуктов минисеквенирования различны для дикого (а) и мутантного (в) генотипов.

Для включенных в исследование микробов был осуществлен подбор праймер ных систем, предназначенных для селективной специфичной амплификации локусов и их последующего анализа согласно разработанному протоколу минисеквенирова ния. Используемая схема предполагает регистрацию детерминант устойчивости, обу словленных как приобретением мобильных генетических элементов (для S.

pneumoniae и N. gonorrhoeae), так и мутациями в специфических хромосомных локу сах бактерий (для S. pneumoniae, N. gonorrhoeae, M. tuberculosis). По аналогичному принципу сформулированы системы, направленные на установление генотипа виру сов гепатита В и С. С целью уменьшения себестоимости и повышения производи тельности анализа, нами были отработаны универсальные условия амплификации, использован мультипраймерный формат минисеквенирования, минимизировано ко личество операций по переносу и разведению образцов, все процедуры адаптированы к формату 96-ти и 384-х луночной плашки.

Ограничением использования прямого масс-спектрометрического профилиро вания для идентификации микробных возбудителей в биологическом образце являет ся необходимая стадия культивирования. Хотя возможность тестирования колоний непосредственно с чашки первичного посева существенно повышает эффективность метода, проблема идентификации медленно растущей и/или трудно культивируемой флоры остается не решенной. В этой связи мы использовали комплементарную тех нологию ДНК-микроматриц (ДНК-чипов), ранее показавшую свою состоятельность для изучения микробного разнообразия в клиническом материале [Bouchara, 2009;

You, 2008] и пищевых продуктах [Kim, 2008].

В ходе работы был создан оригинальный ДНК-чип, предназначенный для видо вой идентификации 50-ти микробов и ориентированный на изучение микробиоцено зов слизистых урогенитального и бронхо-легочного трактов. Мишенью для иденти фикации служили видоспецифичные фрагменты генов 16S рРНК. Использование ри босомальных генов в качестве мишеней для идентификации было обуловлено их мак симальной представленностью в базах данных, а также относительным консерватиз мом, что облегчает задачу подбора универсальных праймеров для амплификации всей совокупности микроорганизмов. Наряду с уникальными видоспецифичными зондами в дизайн ДНК-чипа включен универсальный зонд, комплементарный консервативно му участку анализируемых фрагментов генов rrs, позволяющий контролировать про цесс гибридизации.

В качестве носителя при создании ДНК-чипа нами выбраны стеклянные слайды CodeLink (GE Healthcare, Великобритания), предназначенные для присоединения оли гонуклеотидов через аминогруппу путем образования ковалентной связи с эфиром N гидроксисукцидина, покрывающего поверхность слайда. Несмотря на существование множества аналогов, за счет высокой реакционной способности эфира N гидроксисукцидина данный способ позволяет добиться высокой плотности посадки олигонуклеотидов, а также упростить и ускорить протокол иммобилизации [Lindroos, 2001]. Аналитическая специфичность разработанной технологии составила в среднем 96,0 %, что наряду с чувствительностью 103-104 микробных клеток, позволяет гово рить о пригодности это подхода для анализа условно-патогенной флоры.

2.2. Применение разработанных методик в молекулярном мониторинге бактериальных и вирусных патогенов.

2.2.1. Масс-спектрометрическое профилирование клинических изолятов S. pneumoniae и N. gonorrhoeae.

Методикой прямого МАЛДИ масс-спектрометрического профилирования ис следованы грамположительные -гемолитические стрептококки (S. pneumoniae и близкородственные «зеленящие» стрептококки) и грамотрицательные бактерии рода Neisseria.

Масс-спектры кислого экстракта клеток грамположительных стрептококков, содержащие около 60 пиков, не отличались по представительности от масс-спектров грамотрицательных Е. coli и нейссерий (около 70 пиков), что иллюстрирует универ сальность отработанного протокола (рис. 2). Большинство воспроизводимо регистри руемых масс соответствовало массам рибосомальных белков протестированных мик робов – 11/19 для пневмококка, 14/20 для N. gonorrhoeae и 11/17 для N. meningitidis (табл. 1).

Таблица 1. Перечень воспроизводимых пиков (частота регистрации 0,7), регистрируемых при МАЛДИ масс-спектрометрическом профилировании лабораторных штаммов S. pneumoniae ATCC 49619, N. gonorrhoeae ATCC 49226 и клинического изолята N. meningitidis_547. Пики, предположительно соответ ствующие рибосомальным белкам, выделены жирным. Идентичные для N. gonorrhoeae и N. meningitidis пики обозначены серым.

Neisseria gonorrhoeae ATCC 49226 Neisseria meningitides_537 (serogroup B) S. pneumoniae ATCC Тип Тип M M M № Тип иона № № M f D M f D M f D иона иона (match) (match) (match) M+H+ M+H+ M+2H+ 1 4474 1 4473 RL36 1 4489 0,9 4489 RL36 1 4196 1 8387 RL M+H+ 2 4511 0,8 2 4419 1 4421 RL 9377* M+2H+ M+2H+ 3 4534 3 4689 1 RS20 2 4688 0,7 9377* RS M+2H+ 4 4718 4 4784 1 9570 RL M+2H+ 5 5010 1 5010 5 5044 1 10089 RL M+H+ M+H+ M+2H+ 6 5052 1 5051 RL34 3 5051 1 5051 RL34 6 5201 1 10403* RS M+2H+ M+H+ 4 5115 0,7 10230* RS19 7 5309 0,7 5304* RL M+2H+ 5 5129 0,8 8 5833 0, 7 5130 0,9 10259* RS 8 5484 0,7 6 5541 0,9 9 5873 M+H+ 7 5624 0,7 10 5951 9 5908 1 5907 RL M+H+ M+H+ 10 5946 1 8 5937 1 5937 RL33 11 6265 1 6267* RL M+H+ 11 6053 0,9 12 6614 9 6342 1 6342 RL M+H+ M+H+ 10 6431 0, 12 6404 1 6402* RL32 13 6638 1 6640* RL M+H+ M+H+ M+H+ 13 7080 1 7078 RL29 11 7078 1 7078 RL29 14 6751 1 6752* RL M+H+ M+H+ 15 6887 14 7227 1 7226* RL35 12 7226 0,7 7226* RL M+H+ 15 8068 1 9350 0, 13 16 7983 1 7987 RL M+H+ M+H+ 16 8167 1 8165 RL31 17 8390 1 8387* RL M+H+ 18 9513 17 8225 1 8224* RS M+H+ M+H+ M+H+ 18 9379 1 9377* RS20 14 9377 0,9 9377* RS20 19 10089 1 10089 RL M+H+ M+H+ 19 9570 1 9568* RL27 15 9557 0,8 9554* RL M+H+ M+H+ 20 10260 1 10259* RS19 16 10237 0,7 10237* RS 17 11248 0, M – среднее значение экспериментальных m/z для каждого пика (использованы масс-спектры, полученные в ходе 10 независимых экспериментов);

f – частота регистрации пика;

M (match) – масса белка согласно SwissProt/TrEMBL базе данных (Da) * - с учетом потери N-концевого метионина.

Тип иона – только для пиков, соотнесенных с конкретными белками D – описание белка согласно SwissProt/TrEMBL базе данных (а) (b) Рисунок 2. МАЛДИ масс-спектры экс трактов клеток штаммов S. pneumoniae ATCC 49619 (a), N. gonorrhoeae ATCC 49226 (b), и N. meningitidis_547 (c), отснятые при использо вании -циано-4-гидроксикоричной кислоты в качестве матрицы. По шкале абсцисс отложены значения m/z, по шкале ординат – относитель ная интенсивность пиков, регистрируемая при масс-спектрометрическом анализе.

(c) Несмотря на таксономическое (филогенетическое) родство N. gonorrhoeae и N.

meningitidis, только 6 пиков оказались общими в МАЛДИ масс-спектрах обоих видов.

МАЛДИ масс-спектрометрическое профилирование зеленящих стрептококков (n = 3) и клинических изолятов идентифицировались как S. pneumoniae согласно па нели иммунологических и биохимических тестов (n = 25), продемонстрировало неод нородность исследуемой группы (рис. 3, А).

В настоящее время проблема надежной и однозначной дифференциации S.

pneumoniaе от других представителей -гемолитических стрептококков – S. mitis, S.

oralis и др. однозначно не решена. Такое положение дел вынуждает использовать MLST в качестве референс-метода, устанавливающего видовую принадлежность штамма [Ip, 2006], что было реализовано в текущем исследовании и позволило вы явить различную видовую принадлежность 25-ти клинических изолятов – 19 иденти фицированы как S. pneumonia и 6 – как не пневмококки.

Выделенная группа, так называемые псевдопневмококки, имела аллельный профиль, отличный от «истинных» пневмококков, однако обладала свойственным пневмококку фенотипом ( гемолиз, оптохин чувствительность и растворение в со лях желчи). По данным масс-спектрометрического профилирования эта группа, хотя и образовывала отдельный кластер, все равно относилась к общему пулу пневмокок ков, тогда как зеленящие стрептококки имели однозначно отличные масс-спектры.

Полученные нами данные хорошо иллюстрирую ситуацию, сложившуюся в по следние годы в области видовой таксономии гемолитических стрептококков, обу словленной их высокой степенью гомологии. Неоднозначность видовой идентифика ции на основании биохимических тестов и последовательностей гена 16S рРНК [Woo, 2008] приводит к существованию отличных мнений о таксономической принадлеж ности тех или иных групп штаммов, их роли в инфекционном процессе. И если кли ническая необходимость дискриминации пневмококков от зеленящих стрептококков не вызывает сомнений, то выделение группы псевдопневмококков является весьма спорным вопросом [Carvalho, 2003;

Arbique, 2004].

А В Рисунок 3. Сравнительный анализ масс-спектров, полученных для исследуемой группы стрептококков (А) и нейссерий (В). Выделены изоляты, не относящиеся к виду S. рneumoniae, соглас но MLST.

Продемонстрированная ранее возможность эффективной дискриминации зеле нящих стрептококков на основании прямой масс-спектрометрии [Friedrichs, 2007] бы ла подтверждена в нашем исследовании с применением других протоколов тестиро вания. Сравнительный анализ масс-спектров кислых белковых экстрактов зеленящих стрептококков и пневмококков позволил предположить, что такой подход будет ис пользован в практике. Кроме того, была продемонстрирована принципиальная воз можность кластеризации псевдопневмококков в отдельную группу, что открывает перспективы для раздельного мониторинга этих бактерий и, возможно, дальнейшего исследования S. pseudopneumoniae с целью установления его роли в развитии легоч ных патологий.

МАЛДИ масс-спектрометрическое профилирование лабораторного штамма (n = 1) и клинических изолятов (n = 278) N. gonorrhoeae показало однородность полу чаемых профилей в исследуемой группе. Отдельно следует отметить, что в целом МАЛДИ масс-спектры, отснятые для гонококка по разработанному протоколу, суще ственно богаче аннотированных ранее при исследовании гемофильных бактерий, в том числе и N. gonorrhoeae [Haag, 1998].

Сравнительный анализ полученных масс-спектров (пик-листов) выявил три пи ка со значениями m/z 4473, 5051 и 8165, соответствующих рибосомальным белкам RL36, RL34 и RL31 штамма N. gonorrhoeae ATCC 49226 и меняющихся у ряда изоля тов на 4487, 5081 и 8146. Подобные изменения зарегистрированы для пиков, соотне сенных с рибосомальными белками RS20 и RL27 N. meningitidis (табл. 2).

Секвенирование соответствующих генов N. gonorrhoeae (rpmJ, rpmH и rpmE), и N. meningitidis (rpsT и rpmA) подтвердило существование в каждом из них однонук леотидного полиморфизма, приводящего к аминокислотной замене. Теоретически рассчитанное изменение массы белка при данной замене совпало с регистрируемым в масс-спектрометрическом анализе.

Таблица 2. Регистрируемые изменения в последовательностях рибосомальных белков соот ветствующие наблюдаемым отличиям в МАЛДИ масс-спектрах клинических изолятов N. gonorrhoeae и N. meningitidis.

Описание Ген Нуклеотидные Аминокислотные Расчитанная масса, Дa m/z замены замены (SwissProt/TrEMBL) N. gonorrhoeae 4473 RL36 rpmJ wt wt G19A Val7Ile 5051 RL34 rpmH wt wt G109A Ala37Thr 8166 RL31 rpmE wt wt G29A Arg10His N. meningitidis 9378 RS20 rpsT wt wt G169A Val57Ile 9557 RL27 rpmA wt wt G79A Gly27Ser Среди исследованной группы изолятов N. gonorrhoeae обнаружены четыре ва рианта сочетаний меняющихся значений m/z этих белков. Учитывая неизменность ос тальных значений m/z в спектре, выделено четыре типа МАЛДИ масс-профилей (про теотипов) гонококка. Исследуемая выборка гонококков (n = 278) распределилась сле дующим образом: подавляющее большинство – 236 (84,9 %) относились к протеотипу 1 (m/z 4473/5051/8165), соответствующему контрольному штамму N. gonorrhoeae ATCC 49226;

26 изолятов (9,4 %) были отнесены к протеотипу 2 (m/z 4487/5051/8165);

15 изолятов (5,4 %) к протеотипу 3 (m/z 4487/5051/8147) и 1 изолят (0,4 %) – к протеотипу 4. Индекс разнообразия Симпсона при таком типировании со ставил 0,27.

Наблюдаемые незначительные отличия качественного состава масс-спектров в группе клинических штаммов гонококка согласуются с нашим представлением о кон сервативности рибосомальных белков. Высокая гомогенность качественного состава масс-спектров делает невозможным применения этого подхода для типирования го нококка, однако, открывает перспективы для видовой идентификации возбудителя.

При относительной внутривидовой стабильности масс-спектров исследованных изо лятов N. gonorrhoeae и N. meningitidis, МАЛДИ масс-профили, накопленные для раз ных видов бактерий рода Neisseria, демонстрируют существенные различия в числе и положении пиков. Этот тезис был подтвержден в ходе кластерного анализа накоплен ных масс-профилей близкородственных бактерий – менингококков (n = 15) и непато генных нейсерий (n = 15) (рис. 3, В). Непатогенные нейссерии сформировали доста точно гетерогенную группу, полностью отличную от N. gonorrhoeae и N. meningitidis.

В целом, результаты, полученные в ходе тестирования гетерогенных коллекций клинических изолятов S. pneumonia и N. gonorrhoeae, а также близкородственных им видов бактерий, подтверждают возможность применения нового, основанного на МАЛДИ ВМС, способа видовой идентификации микробов, в том числе при монито ринге бактериальных инфекций.

2.2.2. Исследование микробного сообщества при бактериальном вагинозе женщин и неспецифическом баланопостите мужчин на ДНК-микроматрицах Для определения эффективности созданного нами ДНК-чипа мы исследовали клинический материал от пациентов с признаками неспецифических воспалительных процессов в урогенитальной сфере – бактериального вагиноза у женщин и неспеци фического баланопостита у мужчин. Надо отметить, что тезис об инфекционной при роде этих заболеваний до сих пор является предметом дискуссий, в силу наблюдае мых неудач на фоне антимикробной терапии, с одной стороны, и низкой высеваемо сти микробной флоры при проводимом бактериологическом исследовании, с другой.

В группе мужчин, страдающих баланопоститами, наиболее часто выявлялись анаэробные грамотрицательные бактерии. Их наличие в содержимом препуциального мешка и отделяемом уретры обнаружено у 45/60 (75 %) пациентов. В 27/60 (45 %) случаях анаэробные бактерии были единственными микробными агентами, выявлен ными при первичном баланопостите. Среди них обнаружены микроорганизмы рода Prevotella – 14/27 (52 %) случаев, Bacteroides – 8/27 (27 %) случаев, Mobiluncus – 5/ (19 %). В 9/27 (15 %) случаев выявлены различные ассоциации перечисленных ана эробных микроорганизмов. В 18/60 (30 %) случаях установлено сочетание анаэробной флоры с другими микроорганизмами – G. vaginalis, Ureaplasma spp., M. hominis, E.coli, S. agalactiae.

На данной стадии исследования отмечена тенденция к более легкому клиниче скому течению баланитов и баланопоститов, вызванных только анаэробными бакте риями, и утяжеление характера наблюдаемого воспаления при сочетании анаэробной флоры с U. urealyticum, M. hominis, G. vaginalis. Включение в схему терапии таких больных пероральных препаратов метронидазола позволило достичь выраженного клинического эффекта в виде эпителизации эрозивных дефектов и исчезновения бо лезненности в течение 3 – 4 дней.

Характерный для бактериального вагиноза микробный пейзаж наблюдался у всех пациенток, включенных в исследование (n = 12). Однако, спектр выявляемой микрофлоры и информативность получаемых данных отличались для бактериологи ческого и молекулярно-генетического исследования (рис. 4).

Число пациентов 6 Бакт ериология до лечения 4 Бакт ериология после лечения ДНК-чип до лечения ДНК-чип после лечения ide pp nd spp is M.va m V. pp La rea inis cil m re riu li s E. spp cp va p M alis nc e nu la idi St e o al c o sp G. s sp ilu na A tu ba icu F. rvu ep s c t.c ss ec U. h om rm gin a S. cus C a us ba E ob gi ida pto m cto ly t c le ide pa u fa.

ro u cte Ba ne ry Co Рисунок 4. Результаты лабораторного тестирования клинических образцов от пациенток с бактериальным вагинозом до и после антибактериальной терапии. Проведено сопоставление данных бактериологического исследования и анализа на ДНК-чипе. Маркерные для бактериального вагиноза микроорганизмы выделены рамкой.

Так, по данным культурального посева почти во всех образцах выявлены S. epidermidis (12/12, 100 %), Corynebacterium spp (10/12, 83 %), которые не являются маркерами бактериального вагиноза и относятся к сопутствующей флоре. Примене ние технологии анализа на ДНК-чипе на стадии лабораторного обследования позво лило выявить у 10/12 (83 %) пациенток присутствие анаэробных бактерий семейства Bacteroidales (B. fragilis, B. caccae, B. stercoris, P. melanogenica), V. parvula, A. vaginae, F. nucleatum, M. сurtisii, обнаружение которых с помощью стандартного бактериоло гического посева, как правило, затруднено.

Наблюдаемое снижение частоты обнаружения G. vaginalis и урогенитальных микоплазм при тестировании на ДНК-чипе может быть объяснено очаговой природой локализации возбудителя в слизистой влагалища, что влечет за собой отличия в мик робном составе двух образцов, взятых у одного пациента.

Зафиксированные изменения в спектре микрофлоры, выявляемой на фоне ан тимикробной терапии, касались преимущественно маркерной для бактериального ва гиноза флоры (выделены рамкой на рис. 4), тогда как сопутствующие микроорганиз мы были обнаружены во всех образцах, проанализированных бактериологическими методами. В этой ситуации тестирование образцов с помощью ДНК-микроматриц по зволило получить дополнительную информацию о состоянии микробиоценоза влага лища. В частности, обнаружение у пациентки A. vaginae, свидетельствует о недоста точной эффективности проведенного курса терапии и необходимости продолжения лечения, а «отсутствие» какой-либо флоры в 3-х образцах является сигналом резкого снижения общего титра бактерий менее 104 КОЕ/мл, что требует назначения курса заместительной терапии.

Высокая частота обнаружения трудно культивируемой флоры в проведенных исследованиях позволила нам предположить, что данная технология может быть ис пользована в качестве дополнительного метода тестирования при анализе биоценозов, потенциально включающих анаэробную и микроаэрофильную флору, особенно для оценки эффективности антибактериальной терапии.

2.2.3. Тестирование генетических маркеров резистентности микобактерий туберкулеза, пневмококка, гонококка и оценка их вклада в формирование ус тойчивого фенотипа.

Мониторинг изменений в профиле лекарственной чувствительности бактери альных патогенов занимает ведущее место в мероприятиях по борьбе с ними. Сегодня понятно, что необходимо не просто регистрировать факт появления устойчивых изо лятов, но и выявлять молекулярные изменения, предопределяющие эти процессы. По следнее особенно важно для разграничения хромосомных и плазмидных механизмов реализации резистентности, имеющих разную скорость распространения в микробной популяции.

Анализ опубликованных данных позволил нам систематизировать информацию об известных генетических механизмах формирования лекарственной устойчивости микобактрий туберкулеза, пневмококка и гонококка к различным классам лекарст венных препаратов, применяемым в терапии соответствующих инфекционных забо леваний. В данном случае всю совокупность анализируемых признаков можно раз бить на две группы – наличие/отсутствие гена, что легко детектируется с привлечени ем амплификационных технологий, и однонуклеотидные замены в генах-мишенях, для детекции которых в рамках данного исследования разработаны оригинальные ди агностические системы, реализующие принцип минисеквенирования с последующей масс-спектрометрической детекцией.

Адекватность разработанного подхода обнаружения генетически детерминированной лекарственной устойчивости, его пригодность для осуществле ния молекулярно-эпидемиологического мониторинга были продемонстрированы в ходе тестирования клинических изолятов S. pneumoniaе (n = 234), M. tuberculosis (n = 693) и N. gonorrhoeae (n = 585), фенотип которых был установлен на основании бактериологического тестирования.

Изучение закономерностей распространения генетических маркеров резистент ности среди клинических изолятов S. рneumoniaе Для S. pneumoniae был проведен анализ генетических маркеров лекарственной устойчивости к -лактамным антибиотикам и фторхинолонам, поскольку пеницил лин, цефотаксим, наряду с моксифлоксацином являются препаратами выбора в тера пии пневмококковых инфекций.

При выборе значимых маркеров формирования устойчивости пневмококка к -лактамным антибиотикам были отобраны три гена – pbpA, pbp2b и pbpX, продукты которых – пенициллин связывающие белки (ПСБ) 1, 2b и 2Х, рассматриваются как первичные мишени действия данного класса АМП [Zapun, 2008]. Поскольку единого мнения о первичном сайте возникновения мутаций, обуславливающих устойчивость S. pneumoniaе к -лактамным антибиотикам не существует, мутации в этих генах рас сматривались независимо, с учетом возможного кумулятивного эффекта.

По данным генетического тестирования, 55/169 (32,5 %) изолятов относились к дикому генотипу (не содержали мутаций в исследованных локусах), что достоверно ассоциировалось с чувствительностью к пенициллину ( 2 = 143,3, p0,001). Среди ос тавшейся части выборки были выявлены восемнадцать различных комбинаций гене тических маркеров, потенциально вовлеченных в формирование резистентности пневмококка к пенициллину. В целом, из 120 изолятов S. pneumoniaе со сниженной чувствительностью к пенициллину мутации в рассмотренных ПСБ были обнаружены в 111 (92,5 %) случаях (табл. 3), что реально свидетельствует о высокой диагностиче ской чувствительности метода.

Таблица 3. Распределение изолятов пневмококка по категориям чувствительности к пени циллину, установленным по критериям CLSI (www.clsi.org) для каждого генетического варианта, сформированного согласно рабочей гипотезе: S – чувствительные, I – с промежуточной чувствитель ностью, R – устойчивые.

Категория чувствительности, N (%) N (%) Генотип изолята, согласно тестированию генов ПСБ S I R 55 (32,5) 46 (88,5) 9 (11,5) wt 12 (7,1) 3 (25,0) 9 (75,0) pbp2bmut 5 (3,0) 4 (80,0) 1 (20,0) pbp2bmut, pbpAmut pbpX Ile371Thr, pbp2bmut 1 (0,6) 1 (100) pbpX Gln552Glu, pbp2bmut 11 (6,5) 11 (100) pbpX Ile371Thr, pbp2bmut, pbpAmut 25 (14,8) 25 (100) pbpX Gln552Glu, pbp2bmut, pbpAmut 2 (1,2) 2 (100) pbpX Asn605Thr, pbp2bmut, pbpAmut 3 (1,8) 2 (66,7) 1 (33,3) pbpX Ile371Thr, Asn605Thr, pbp2bmut 2 (1,2) 1 (50,0) 1 (50,0) pbpX Ile371Thr, Asn605Thr, pbp2bmut, pbpAmut 52 (30,7) 13 (25,0) 39 (75,0) pbpX Ile371Thr, Gln552Glu, Asn605Thr, pbp2bmut, pbpAmut 1 (0,6) 1 (100) Всего 169 (100) 49 (30,0) 66 (38,1) 54 (31,9) Поскольку достоверной информации о кумулятивном эффекте мутаций в транспептидазном домене ПСБ 1А нет, и оценить его в рамках настоящего исследо вания не представлялось возможным, мутации в pbpA гене мы не дискриминировали и рассматривали в совокупности как pbpAmut, приравненные по частоте к аминокис лотным заменам в Thr574 кодоне. Исходя из аналогичных предпосылок, был сформи рован pbp2bmut генотип, равный по частоте встречаемости заменам Thr445Ala. Стоит отметить, что в последних работах именно этот маркер фигурирует как значимый для процесса развития пневмококком устойчивости к -лактамным антибиотикам [Izdebski, 2008]. При рассмотрении мутаций, выявленных в транспептидазном домене ПСБ 2Х, обращает на себя внимание факт обнаружения чувствительных изолятов с генотипом Thr338mut, Arg384Gly. Несмотря на то, что мутации в этих кодонах являют ся первыми описанными маркерами устойчивости пневмококка к пенициллинам, сей час появляется все больше данных противоречащих этой точки зрения [Maurer, 2008].

При рассмотрении собственных результатов была принята рабочая гипотеза об отсут ствии влиянии изолированных мутаций в Thr338 и Arg384 кодонах на чувствительность пневмококка. В этом случае генотипы Thr338mut, Arg384Gly приравнивались к дико му типу (wt), а при наличии других замен в pbpX они просто не учитывались. Полу ченное распределение изолятов S. pneumonia с различными генотипами по трем кате гориям чувствительности к пенициллину представлено в табл. 3.

Выполненный анализ позволил нам выделить полиморфизмы, наиболее ин формативные для предсказания генетически-детерминированной устойчивости пнев мококка к пенициллину. В этот список попали любые мутации в транспептидазном домене ПСБ 2В, в первую очередь Thr445Ala, сопровождающиеся изменениями в ПСБ 1А и/или ПСБ 2Х.

Традиционно транспептидазный домен ПСБ 2Х рассматривался как первичная мишень накопления мутаций при формировании устойчивости пневмококка к пени циллину [Carapito, 2006;

Mouz, 1999]. Однако, в настоящем исследовании выявлены изолята, имеющие дикий генотип по ПСБ 2Х, но реализующие устойчивость за счет вовлечения ПСБ 1А на фоне мутаций в ПСБ 2В. Этот факт дает основание утверждать о существовании альтернативных механизмов резистентности S. pneumoniae к пени циллину. И хотя изолированные мутации в ПСБ 2В, по нашим данным, не обеспечи вают клинически-значимое снижение чувствительности S. pneumoniae к пенициллину, именно их следует рассматривать как ранний маркер формирования устойчивости пневмококка к -лактамным антибиотикам.

Дополнительное подтверждение эта точка зрения получила при рассмотрении мутаций в ПСБ 2Х. Среди обнаруженных аминокислотных замен удалось выделить три, по-видимому, независимо возникающие мутации – Ile371Thr, Gln552Glu, Asn605Thr, которые достоверно приводят к снижению чувствительности пневмокок ка к пенициллину. Данный вывод частично согласуется с работой Maurer, 2008, в ко торой мутации Gln552Glu и Asn605Thr также выделены как маркерные. В тоже время канонические мутации – Thr338Ala, Pro, Gly в активном центре фермента на ряду с Arg384Gly, по-видимому, играют лишь вспомогательную роль в формирова нии клинической устойчивости. Обсуждая вариабельность транспептидазного домена ПСБ 2Х, необходимо отметить отсутствие изолятов с мутациями Phe 339Met и Met400Thr, что может объясняться региональными особенностями S. pneumoniaе и требует дальнейших исследований для уточнения этого предположения.

Диагностическая значимость установленных маркеров устойчивости пневмо кокка к пенициллину – pbp2bmut, pbpАmut и замены в кодонах Ile371, Gln552 и Asn605 гена pbpX, была продемонстрирована путем сравнения распределения «выведенных» на основании генотипа категорий чувствительности с данными бактериологического тестирования этой же выборки (рис. 5).

Рисунок 5. Сопоставление распределения изолятов по категориям чувствительности к пени циллину на основании данных генетического и бактериологического тестирования. Категория «устойчивые» включает все изоляты со сниженной чувствительностью к пенициллину.

Полученное распределение, не имеющее достоверных отличий между двумя методами тестирования (р0,05), указывает на адекватность выбранных маркеров и перспективность применения генетического исследования как для индивидуальной оценки чувствительности пневмококка к -лактамным антибиотикам, так и для мони торинга распространения генетических детерминант устойчивости в популяции.

Сходное по идеологии исследование распределения мутаций в генах гираз (gyrA, gyrB) и топоизомераз (parC, parE) позволило установить ассоциацию одновре менного обнаружения мутаций в генах gyrA и parC с клинической устойчивостью S.

pneumoniae к фторхинолонам. Наличие мутаций только в одном из рассмотренных генов не приводит к формированию значимой устойчивости к левофлоксацину и мок сифлоксацину, что не противоречит данным литературы [Balsalobre, 2003;

Heather, 2007], однако может рассматриваться как маркер начавшихся мутационных процес сов в популяции.

В целом, высокая диагностическая чувствительность отобранных генетических маркеров дает основание утверждать о применимости разработанной системы геном ного сканирования мутаций как в диагностических целях, так и в мониторинге лекар ственной устойчивости пневмококка, что особенно важно для своевременного пре дотвращения распространения изолятов, несущих детерминанты устойчивости на фо не клинической чувствительности к -лактамным антибиотикам и фторхинолонам.

Молекулярный мониторинг генетически детерминированной лекарственной устойчивости клинических изолятов M. tuberculosis В ходе исследования впервые осуществлено молекулярное типирование об ширной коллекции клинических изолятов M. tuberculosis (n = 693), собранных из раз ных регионов России, по 13-ти маркерным сайтам, расположенным в четырех локусах геномной ДНК – RRDR гена rpoB, ген katG и регуляторная область inhA и ген embB – мутации в которых обуславливают устойчивость к рифампицину (RIF), изониазиду (INH) и этамбутолу (EMB).

Всего мутации в RRDR обнаружены у 323 (88,0 %) из 369 устойчивых к RIF изолятов M. tuberculosis. В проанализированной выборке найдено шестнадцать вари антов однонуклеотидных замен в кодонах 533, 531, 526, 516 и 511 гена rpoB и один вариант вставки между кодонами 513 и 514. Ни один из изолятов не имел изменений в кодонах 513 и 522. Среди замен преобладали мутации в Ser 531, обнаруженные у 42,5 % от общего числа изолятов. Наибольшее число вариантов мутаций – семь – вы явлены в His526 среди 32 (4,6 %) изолятов. Четыре варианта замен найдено в Asp516 у 28 (4,0 %) образцов. Всего мутации в кодонах 531 и 526 гена rpoB, приводящие к вы сокому уровню устойчивости к RIF, выявлены у 327 (47,2 %) микобактерий, в кодо нах 533, 516, 511, ассоциированные с умеренной устойчивостью, – у 44 (6,3 %).

Среди 324 изолятов, чувствительных к RIF по методу абсолютных концентра ций, 266 (82,0 %) не несли мутаций в изучаемой области гена rpoB. У 58 изолятов вы явлены мутации в RRDR, из них у 39-ти – в Ser531. Однако, определение ингибирую щей концентрации RIF для этих микобактерий показало, что 15 из них устойчивы к концентрациям RIF меньшим или равным критической. Данное наблюдение подчер кивает актуальность генетического тестирования, поскольку устойчивость таких изо лятов не выявляется в ходе регламентированного Приказом № 109 МЗ РФ бактерио логического тестирования, однако может иметь клиническое значение при после дующей химиотерапии.

Генетические маркеры устойчивости к INH (мутации в локусах katG и inhA) обнаружены в общей сложности у 426 (92,2 %) изолятов из 462 фенотипически ус тойчивых. Устойчивость оставшейся группы изолятов может быть вызвана мутация ми в других генах, например, kasA (ген -кетоацил-АПБ-синтетазы), ndh (ген НАДН дегидрогеназы), ahpC (ген алкилгидропероксидредуктазы), потенциально вовлечен ных в процесс формирования устойчивости к INH и не затронутых в данном исследо вании. Изолированные мутации в кодоне Ser315 гена katG обнаружены у 402 (58,0 % от общего числа) изолятов, в области inhA – у 9 (1,3 %). Сочетание мутаций в обоих локусах наблюдалось в 59 (8,5 %) случаях. В целом у 461 (66,5 %) изолятов выявлены мутации, приводящие к высокому уровню устойчивости к INH.

Среди 231 изолятов, чувствительных к INH по методу абсолютных концентра ций, 187 (81,0 %) не несли мутаций в изучаемых областях. Обнаружение в оставших ся образцах мутаций в локусе inhA и кодоне Ser315 гена katG может свидетельствовать о начавшемся процессе формирования клинической устойчивости к INH.

Обладая высокой аналитической чувствительностью – до 50 микробных клеток в образце – примененная методика обнаружения генетически-детерминированной ус тойчивости к RIF и INH продемонстрировала высокую диагностическую чувстви тельность – 88 % и 92 %, соответственно. Этот факт дает основание утверждать о применимости технологии минисеквенирования с последующей МАЛДИ ВМС для анализа клинического материала – мокрота, бронхо-альвеолярный лаваж, минуя ста дию бактериологического посева.

Известно, что структура мутаций и частоты встречаемости мутантных кодонов у M. tuberculosis различаются в зависимости от географии выделения штамма [Bttger, 2008]. Среди исследованных в нашей выборке изолятов наиболее часто то чечные мутации, обуславливающие устойчивость к RIF, были обнаружены в кодонах Ser351, His526 и Asp516 гена rpoB, составляя 76,6 %, 10,7 % и 9,2 % от общего числа му таций, соответственно. Подобное распределение характерно для многих регионов Российской Федерации [Gryadunov, 2005;

Nikolayevsky, 2004]. Однако, в ряде облас тей наблюдаются и некоторые отличия. В частности, в Северо-Западном регионе от мечается преобладание замен в Gln513 RpoB (10,0 %) над мутациями в Asp516 (3,3 %) [Gryadunov, 2005], тогда как в настоящей выборке подобная замена была обнаружена лишь у одного устойчивого к RIF изолята.

Общая частота встречаемости точечных мутаций в кодонах Met306 и Gly406 гена embB среди резистентных к EMB изолятов была невысокой – около 54,0 % (97 из 181). Наши данные согласуются с представленными ранее для Северо-западного ре гиона России (от 48,6 до 54,0 %) [Gryadunov, 2005] и Латвии (52,0 %) [Toungoussova, 2002], что свидетельствует о низкой информативности выявления этих мутаций при мониторинге устойчивости к EMB.

С другой стороны, в группе чувствительных изолятов 63 из 71 (88,7 %) не име ли перечисленных мутаций. Для шести из оставшихся восьми изолятов ингибирую щая концентрация EMB составила 2 мг/л, что объективно не позволяет рассматривать их как чувствительные. Все это подчеркивает значимость генетического тестирова ния, поскольку устойчивость таких изолятов не обнаруживается при стандартном бактериологическом исследовании, но может повлиять на эффективность терапии.

В тоже время, обнаружена достоверная связь между частотой встречаемости мутаций в гене embB и числом препаратов, к которым устойчив изолят (табл. 4).

Мутации в кодонах Met306 и Gly406 встречались достоверно чаще среди мульти резистентных (MDR) изолятов (113/204;

55,4 %), чем среди моноустойчивых и чувст вительных (4/81;

4,9%) (2 = 60,99;

р0,001). Стоит отметить, что пять из восьми изо лятов, чувствительных к EMB, но имеющих мутации в гене embB, имели MDR фено тип. При сравнении относительных частот мутаций в кодонах Met306 и Gly406 гена embB в двух группах: MDR-изоляты, не имеющие генетических детерминант устой чивости к рифампицину и изониазиду, и MDR-изоляты, содержащие мутации в генах rpoB, katG и локусе inhA, значимых различий обнаружено не было (2 = 0,02;

р=0,90).

Таким образом, генетические детерминанты MDR и мутации в гене embB не связаны между собой, несмотря на то, что наблюдается статистически значимая ассоциация этих замен с MDR фенотипом.

Таблица 4. Частоты встречаемости мутаций в кодонах 306 и 406 гена embB в зависимости от профиля лекарственной устойчивости изолята M. tuberculosis.

Фенотипическая Число Число изолятов с мута р устойчивость изолятов циями в гене embB;

N(%) Чувствительные группа сравнения 43 Устойчивые к одному препа 24 1 (4,1) 1,8 0, рату;

RIF или INH или EMB Устойчивые к двум препара там;

RIF,INH или RIF,EMB 29 8 (27,5) 13,34 0, или INH, EMB Устойчивые к трем препара 169 96 (57,1) 45,97 0, там;

RIF, INH и EMB - устойчивость определена методом абсолютных концентраций. RIF – рифампицин, INH – изониазид, EMB – этамбутол.

Ранее подобное наблюдение было сделано для мутаций в кодоне Met306 гена embB [Мокроусов, 2002], однако мутации в кодоне Gly406, как маркер MDR фенотипа, до настоящего времени не рассматривались.

Учитывая, что распространение множественной лекарственной устойчивости представляет особую проблему во многих областях медицины, включая фтизиатрию, очевидна необходимость в развитии и внедрении новых подходов для быстрого выяв ления MDR-изолятов M. tuberculosis. Исходя из наблюдения ассоциации мутаций в локусах embB306/406 с MDR-фенотипом, мы предприняли попытку оценить возмож ности использования данного генетического локуса для быстрой диагностики MDR.

В исследованной выборке анализ локусов embB306/406 для определения MDR фенотипа обладал низкой диагностической чувствительностью – около 55,0 % (102/185), но высокой специфичностью – 95,0 % (77/81). При этом диагностическая чувствительность определения MDR на основании двух генетических маркеров – ло кусы rpoB и katG/inhA - составила 89,2 % (165/185), однако при использовании трех локусов – embB306/406, rpoB и katG/inhA – чувствительность возрастала до 94,6 % (175/185).

Таким образом, использование комбинированного анализа перечисленых гене тических локусов может рассматриваться как достаточно интересный и перспектив ный подход, при помощи которого можно повысить эффективность своевременного обнаружения MDR-изолятов M. tuberculosis, и обеспечить разработку мероприятий по предотвращению их появления и распространения в человеческой популяции.

Изучение закономерностей распространения генетических маркеров резистент ности среди клинических изолятов N. gonorrhoeae.

В исследование включены 15 генетических локусов, для которых в литературе имеются указания на причастность к формированию устойчивости гонококка к при меняемым в практике АМП [Hu, 2005;

Ropp, 2002;

Lindbck;

2006]. В настоящей ра боте впервые все известные механизмы резистентности N. gonorrhoeae рассмотрены в совокупности, показана возможность прогнозировании лекарственной устойчивости на основании генетического тестирования и осуществлено молекулярное типирование клинических изолятов, собранных в различных регионах России.

О наличие плазмидных механизмов резитентности к пенициллину и тетрацик лину судили на основании обнаружения гена blaTEM1 –лактамазы и TetM детерми нанты, соответственно. Для оценки специфических хромосомных механизмов форми рования устойчивости к пенициллину, тетрациклину и фторхинолонам, в первом слу чае рассмотрены мутации генов ponA и penA, кодирующих ПСБ 1 и 2, во втором – му тация в гене rpsJ, кодирующем рибосомальный белок S10, в третьем – мутации в QRDR генов гиразы (gyrA) и топоизомеразы IV (parC).

Кроме того, исследованы мутации в кодирующей и промоторной областях гена mtrR, продукт которого отвечает за активацию неспецифического эффлюкса АМП и мутации в локусе penB гена porВ, приводящие к снижению проницаемости мембран ного белка порина для ксенобиотиков. Перечисленные механизмы являются неспе цифическими в отношении исследуемых АМП. Поскольку мутации в локусе penC ге на pilQ мембранного белка секретина носят вспомогательный характер [Zhao, 2005], они не были включены в общую панель генетических тестов.

Проведенный анализ встречаемости генетических детерминант лекарственной устойчивости показал, что их отсутствие достоверно ассоциируется с клинической чувствительностью N. gonorrhoeae к исследованным классам АМП. Также в катего рию чувствительных попали большинство гонококков, имеющих изолированные му тации в локусах penB, mtrR, penA или rpsJ, потенциально вовлеченных в формирова ние устойчивости к пенициллинам и тетрациклинам (табл. 5).

При исследовании молекулярных механизмов устойчивости к пенициллину, для 54 (11,6 %) изолятов, относящихся к дикому генотипу (отсутствие мутаций в хромосомных локусах и гена blaTEM1), установлена достоверная ассоциация с чувстви тельным фенотипом ( 2 = 134,3, p0,001). Для остальных изолятов были выявлены одиннадцать различных комбинаций генетических маркеров, потенциально вовле ченных в формирование резистентности к пенициллину.

Четыре генотипа (ponAmut, penAmut), (ponAmut, penAmut, mtrRmut), (ponAmut, penAmut, penBmut), и (ponAmut, penAmut, penBmut, mtrRmut) преобладали в исследованной выборке и были обнаружены у 39 (8,4 %), 62 (13,4 %), 76 (16,4 %), и 133 (28,7 %) изолятов, соот ветственно. Для всех этих генотипов была показана достоверная ассоциация с невос приимчивостью гонококка к пенициллину ( =281,7, p0,001).

Таблица 5. Чувствительность к пенициллину, тетрациклину, ципрофлоксацину изолятов N.

gonorrhoeae с различными генотипами. S – чувствительные, I – изоляты с промежуточным уровнем устойчивости, R – устойчивые изоляты. Категории установлены в соответствии с рекомендациями CLSI (www.clsi.org). Серым выделены генотипы, достоверно ассоциированные с резистентностью.

N (%) изолятов по чувствительности к АМП N (%) Генотип p изолятов S I R Пенициллин wt 54 (11,6) 49 (90,7) p0, 5 (9,3) 0 (0,0) penAmut 51 (9,4) 25 (49,0) p0, 24 (47,1) 2 (3,9) mtrRmut 1 (0,2) 1 (100,0) 0 penBmut 2 (0,4) 2 (100,0) 0 penAmut, penBmut 7 (1,5) 2 (28,6) p0, 5 (71,4) penAmut, 5mtrRmut 15 (3,2) 5 (33,3) p0, 9 (60,0) 1 (6,7) penAmut, penBmut, 5mtrRmut 6 (1,3) 3 (50,0) p0, 3 (50,0) penAmut, ponAmut 39 (8,4) 6 (15,4) p0, 31 (79,5) 2 (5,1) penAmut, ponAmut, 5mtrRmut 62 (13,4) 6 (9,7) p0, 51 (82,3) 5 (8,0) penAmut, penBmut, ponAmut 76 (16,4) 6 (7,9) p0, 63 (82,8) 7 (9,2) penAmut, penBmut, ponAmut, 5mtrRmut 133 (28,7) 15 (11,3) p0, 95 (71,4) 23 (17,3) blaTEM1pres 18 (3,9) 0 p0, 3 (16,7) 15 (83,3) Всего 464 120 (25,9) 289 (62,2) 55 (11,9) Тетрациклин wt 91 (19,6) 76 (83,5) p0, 15 (16,5) mtrRmut 3 (0,6) 3 (100,0) 0 penBmut 3 (0,6) 2 (66,7) p0, 1 (33,3) rpsJmut 59 (12,7) 18 (30,5) p0, 30 (50,8) 11 (18,7) rpsJmut, 5mtrRmut 78 (16,8) 21 (26,9) p0, 21 (26,9) 36 (46,2) rpsJmut, penBmut 87 (18,8) 18 (20,7) p0, 22 (25,3) 47 (54,0) rpsJmut, penBmut, 5mtrRmut 139 (30,0) 29 (20,9) p0, 32 (23,0) 78 (56,1) tetMpres 4 (0,9) 0 p0, 0 4 (100,0) Всего 464 167 (40,0) 119 (25,6) 178 (38,4) Ципрофлоксацин wt 150 (32,2) 149 (99,3) p0, 1 (0,7) mtrRmut 85 (18,3) 82 (96,5) p0, 0 3 (3,5) gyrAmut 17 (3,7) 2 (11,8) p0, 1 (5,9) 14 (82,3) parCmut 4 (0,1) 1 (25,0) p0, 0 3 (72,0) gyrAmut, 5mtrRmut 6 (1,3) 2 (33,3) p0, 0 4 (66,7) parCmut, 5mtrRmut 13 (2,8) 2 (15,4) p0, 0 11 (84,6 ) gyrAmut, parCmut 70 (15,1) 1 (1,4) p0, 0 69 (98,6) gyrAmut, parCmut, 5mtrRmut 119 (25,6) 12 (10,1) p0, 0 107 (89,9) Всего 464 251 (54,1) 2 (0,4) 211 (45,5) – совокупность генетических детерминант, отобранных для изучения закономерностей формирова ния устойчивости к пенициллину, тетрациклину и фторхинолонам, соответственно;

– достоверность различий между изолятами, относящимися к различным категориям чувствитель ности внутри одного генотипа (использован двухсторонний точный критерий Фишера);

– wild type (дикий тип) – отсутствие изменений нуклеотидной последовательности в локусах, вовле ченных в формирование устойчивости к пенициллину, тетрациклину и фторхинолонам, соответст венно;

– совокупность нуклеотидных мутаций, обнаруженных как в кодирующей области гена mtrR, так и в его промоторе;

– комбинация присутствия гена blaTEM1 или tet(M) детерминанты с любыми вариациями нуклеотид ных последовательностей других локусов;

Присутствие гена blaTEM-1 обнаружено у 18 изолятов со следующей географиче ской принадлежностью: Санкт-Петербург (n = 5), Самара (n = 5), Москва (n = 4), Че боксары (n = 1), Мурманск (n = 1), Нижний Новгород (n = 1), Екатеринбург (n = 1).

Все изоляты, содержащие tetM-детерминанту (n = 4), относились к Московскому ре гиону, что свидетельствуют о большей распространенности плазмидных маркеров ре зистентности в субпопуляции гонококка крупных промышленных и торговых центров с числом жителей, превышающим один миллион. Однако, общая частота встречаемо сти плазмидных факторов устойчивости в популяции гонококка оказалась низкая – менее 4,0 % для исследуемой выборки.

Настоящее исследование позволило внести некоторые коррективы в сложив шуюся картину формирования резистентности гонококка к пенициллину. Так, изоли рованная мутация Asp345а в ПСБ 2 (ген penA ) традиционно рассматривалась как пер вая ступень приобретения устойчивости к пенициллину, приводящая к увеличению МПК до 0,12 – 0,25 мг/л [Brannigan, 1990;

Dowson, 1989]. В нашем исследовании эта закономерность не нашла подтверждения. Для изолятов с penAmut генотипом (n = 51), равно как и для 28 изолятов, несущих изолированные мутации в локусах penB или mtrR в сочетании с penA, не удалось выявить достоверной ассоциации с устойчивым фенотипом (p0,05). Большинство устойчивых к пенициллину изолятов гонококка (n = 310) имели мутации в генах penA и ponA в комбинации с любым вариантом нук леотидной последовательности в локусах penB и mtrR. И хотя ранее замена Leu421Pro в ПСБ 1 (ген ponA) рассматривалась только как дополнительная ступень в процесс формирования устойчивости к пенициллину [Ropp, 2002], настоящие данные свидетельствуют о важности этой мутации. Сходные результаты были получены в более узком исследовании (без анализа локусов penB и mtrR) на выборке из 120 гоно кокков [Vernel-Pauillac, 2006]. Закономерно, что высокая устойчивость к пенициллину характерна для изолятов гонококка, несущих мутации во всех исследованных облас тях.

Как и следовало ожидать, большинство устойчивых к тетрациклину изолятов гонококка либо несли плазмидную Tet(M) детерминанту (n = 4), либо имели мутации в локусах rspJ, mtrR и penB хромосомной ДНК. Изоляты N. gonorrhoeae, в которых перечисленные маркеры не обнаружены (n = 91), были чувствительны или умеренно устойчивы к тетрациклину (МПК 1,0 мг/л). Аналогичная тенденция наблюдалась для 6 изолятов с мутациями в локусах mtrR или penB.

Хотя для 59 гонококков, несущих изолированную мутацию Val 45Met в рибо сомальном белке S10 (ген rpsJ), не удалось установить связь с устойчивым феноти пом (p0,05), остальные выявленные у 304 изолятов генотипы – (rpsJmut, mtrRmut), (rpsJmut, penBmut), and (rpsJmut, penBmut, mtrRmut), достоверно ассоциировались с лекар ственной устойчивостью ( 2 = 163,1, p0,001). Настоящее заключение полностью со гласуется с первоначальной точкой зрения на мутацию в гене rpsJ как дополнитель ный механизм развития устойчивости к тетрациклину [Hu, 2005].

Продемонстрирована достоверная ассоциация между выявлением различных комбинаций мутаций в QRDR гиразы (ген gyrA) и топоизомеразы (ген parC) и устой чивостью гонококка к фторхинолонам ( = 404,1, p0,001). Стоит отметить, что два генотипа – (gyrAmut, mtrRmut) и (parCmut) встречались крайне редко, что не позволило объективно оценить их роль в формировании резистентности.

В целом, анализ распределения отдельных маркеров и их сочетаний в группах чувствительных и устойчивых изолятов гонококка позволил отобрать генотипы, при годные для прогнозирования лекарственной устойчивости гонококка к пенициллину, тетрациклину и фторхинолонам с высокой достоверностью (p0,01) (выделены серым в табл. 5). Достоверность предсказания фенотипической устойчивости на основании отобранных маркеров (генотипов) составила 90,3 % для фторхинолонов, 91,1 % для пенициллина и 81,9 % для тетрациклина. Однако, даже в случае тетрациклина, детер минанты резистентности к которому отобраны с наименьшей достоверностью (р0,01), нет значимых различий при сопоставлении «выведенных» на основании ге нотипа категорий чувствительности с данными бактериологического исследования (рис. 6).

Рисунок 6. Сопоставление распределения изо лятов гонококка (n = 129) по категориям чувствитель ности к тетрациклину на основании данных генетиче ского и микробиологического тестирования. Катего рия «устойчивые» включает все изоляты со сниженной чувствительностью к тетрациклину.

В ходе работы продемонстрирована также возможность обнаружения генетиче ских детерминант устойчивости в препаратах геномной ДНК N. gonorrhoeae, выде ленной непосредственно из клинического материала. При такой постановке анализа первичная идентификация гонококка может быть осуществлена любыми методом ге нодиагностики, в том числе с применением ДНК-микроматриц. Сходная идеология прослеживается в исследовании Martin, 2007, продемонстрировавшем возможность молекулярного типирования ДНК гонококка, экстрагированной из ткани.

В совокупности, рассмотренные результаты тестирования клинических изоля тов пневмококка, гонококка, туберкулеза иллюстрируют качественный скачок в про цессе реформирования существующих систем мониторинга путем внедрения средств молекулярного анализа. Выбор перечисленных возбудителей, как модельных для соз дания на основе МAЛДИ ВМС технологии выявления нуклеотидных полиморфизмов в геномах бактерий применительно к тестированию лекарственной устойчивости, был обусловлен их несомненной клинической значимостью и позволил нам продемонст рировать универсальность разработанной методики для грамположительных (S.

рneumoniaе, M. tuberculosis) и грамотрицательных (N. gonorrhoeae) бактерий. Причем, если гонококк можно охарактеризовать как типичный микроб с хорошо развитыми адаптивными механизмами регулирования проницаемости клеточной стенки и эф флюкса, легко обменивающийся генетическим материалом с другими микроорганиз мами, то микобактерии, ограниченные малопроницаемой восковой капсулой, пред ставляют замкнутую систему, возникновение лекарственной устойчивости в которой происходит исключительно за счет геномных мутаций.

2.2.4. Молекулярно-генетическое исследования популяционного полимор физма вирусов гепатита В и С.

Используя технологическую платформу, эффективно примененную для обнару жения генетически-детерминированной лекарственной устойчивости бактериальных патогенов, нами были разработаны методы молекулярного типирования ДНК ВГВ и РНК ВГС, позволяющие оценить вариабельность этих вирусов.

На основании сравнительного анализа последовательностей pre-S1/pre-S2 облас ти ДНК ВГВ и 5’ нетранслируемой области (5’ UTR) РНК ВГС выделены кластеры типоспецифичных однонуклеотидных замен, регистрация которых дает возможность установить генотип вируса, и подобраны соответствующие олигонуклеотидные прай меры для проведения реакций амплификации и минисеквенирования с последующей МАЛДИ ВМС детекцией.

Методику типирования ВГВ применили для исследования образцов сыворотки, полученных от 260 пациентов с хроническим гепатитом В. В 103 (39,6 %) образцах обнаружена ДНК ВГВ. Среди них у 7 (6,8 %) больных установлен генотип A ВГВ, у (3,9 %) - генотип C, и у 86 (83,5 %) - генотип D. У шести пациентов (5,8 %) выявлено смешанное инфицирование генотипами D и С вируса.

Полученные нами данные отличаются от представлений, сложившихся по ре зультатам исследования 2000 года, когда на европейской части России доминировал генотип D ВГВ (99 %), а остальные генотипы практически не встречались [Morozov, 2000]. Обнаружение генотипов А и С среди проанализированных образцов можно объяснить интенсивной миграцией населения из Якутии, Кавказского и Азиатского региона, где процентное соотношение генотипов А и С относительно генотипа D на много выше. В пользу этого утверждения свидетельствует меньшее разнообразие ге нотипов ВГВ, выявленных в Санкт-Петербурге [Писарева, 2007], где уровень мигра ции объективно ниже.

Система генотипирования ВГС была апробирована на ВГС-позитивных образ цах из лабораторного банка сывороток, протестированных также аллель-специфичной амплификацией для установления генотипа вируса [Ильина, 2002]. Среди исследо ванных 69 образцов генотип вируса 1а выявлен в 4,5 % случаях, 1в – 48 %, 2а – 4,5 %, 3а – 29 %, 4 – 1,5 %. В 8 (12 %) образцах регистрируется микст-инфекция.

Долгое время о распространенности различных генотипов ВГС на территории РФ судили по данным НИИ вирусологии им. Ивановского [Львов, 1997], деклариро вавших тотальное преобладание 1b генотипа вируса. Эпидемиологическая картина распространенности различных генотипов ВГС в Москве не отличалась от таковой по стране в целом. Наши данные указывают на снижение доли генотипа 1b среди ВГС инфицированных жителей Москвы и возрастание числа пациентов, инфицированных 3а генотипом ВГС и имеющих микст-инфекцию. Кроме того, применение предло женной схемы типирования позволило выявить генотип 4 ВГС, что повысило эффек тивность методики до 100 %.



Pages:   || 2 |
 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.