авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Анна владимировна геномная вариабельность трематод (trematoda) на стадии промежуточного хозяина – моллюска

На правах рукописи

УДК 577.21 КОРСУНЕНКО АННА ВЛАДИМИРОВНА ГЕНОМНАЯ ВАРИАБЕЛЬНОСТЬ ТРЕМАТОД (TREMATODA) НА СТАДИИ ПРОМЕЖУТОЧНОГО ХОЗЯИНА – МОЛЛЮСКА 03.01.07 – молекулярная генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва 2010

Работа выполнена в лаборатории организации генома Учреждения Российской академии наук Института биологии гена РАН.

Научный консультант:

кандидат биологических наук Семенова Серафима Константиновна

Официальные оппоненты:

доктор биологических наук, профессор Чуриков Николай Андреевич кандидат биологических наук Симонова Ольга Борисовна

Ведущая организация: кафедра молекулярной биологии Московского Государственного Университета им. М.В. Ломоносова

Защита диссертации состоится «21» декабря 2010 года, в 11 часов на заседании диссертационного совета Д 002.037.01 при Учреждении Российской академии наук Институте биологии гена РАН по адресу: 119334 Москва, ул. Вавилова, д. 34/5.

С диссертацией можно ознакомиться в библиотеке Учреждения Российской академии наук Института молекулярной биологии им. В.А. Энгельгардта РАН по адресу: 119991 Москва, ул. Вавилова, д. 32.

Автореферат разослан «20» ноября 2010 года

Ученый секретарь диссертационного совета, кандидат фармацевтических наук Л.С. Грабовская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Совершенствование молекулярно-биологических и генно инженерных методов, а также наличие вычислительных алгоритмов, позволяющих обрабатывать объемные базы данных, определяет интенсивное развитие одного из современных направлений биологии, а именно геномики. Она изучает общие принципы построения геномов, а также особенности их структурно-функциональной организации в группах различного таксономического ранга. Эволюционный подход постепенно становится основным приемом для определения функций отдельных генов и их взаимодействия в пределах генома. Он позволяет предсказывать и идентифицировать функционально важные области генов, а также проследить за формированием элементов «непостоянства» генома.

Методы геномики и биоинформатики все чаще используют для выяснения общих закономерностей эволюции организмов, происхождения генетического полиморфизма и биоразнообразия.

Изучение геномов паразитических червей представляет актуальную фундаментальную задачу. Класс Трематоды, или Дигенетические сосальщики (Platyhelminthes: Trematoda) является одной из наиболее интересных групп паразитических червей. Она объединяет более 18000 видов (свыше 140 семейств) паразитов беспозвоночных и позвоночных животных, населяющих наземные и водные экосистемы [Скрябин, 1948;

Gibson et al., 2002]. Трематоды отличаются от остальных червей наличием сложного жизненного цикла, связанного со сменой животных-хозяев и чередованием нескольких последовательных партеногенетических и одного гермафродитного поколения. Все трематоды – эндопаразиты, обитающие во взрослом состоянии во внутренних органах позвоночных животных и человека, которые являются их дефинитивными (окончательными) хозяевами. Роль первого промежуточного хозяина всегда выполняют разные виды моллюсков, в теле которых сформировавшийся из оплодотворенной яйцеклетки мирацидий претерпевает регрессивный метаморфоз и дает начало первому партеногенетическому поколению – материнской спороцисте. В результате диплоидного партеногенеза в материнской спороцисте формируется следующее партеногенетическое поколение (партениты) – дочерние спороцисты или редии. Партениты дают начало церкариям – свободноплавающим личинкам, которые выполняют расселительную функцию. В конечном итоге, цикл завершается в организме окончательного хозяина, где развиваются половозрелые черви – мариты [Скрябин, 1948;

Гинецинская и Галактионов, 1978].

Ранее считалось, что партеногенетическое потомство трематод (церкарии), представляет собой совокупность генетически однородных особей (клон). Однако с помощью различных молекулярно-генетических маркеров у некоторых представителей трематод зарегистрировано наличие клональной генетической изменчивости. Так, например, в результате экспериментального заражения моллюсков Biomphalaria glabrata единичными мирацидиями Schistosoma mansoni обнаружена генетическая неоднородность церкарий из одной и той же спороцисты, а также различия между дочерними спороцистами, связанные с неравномерным распределением повторов W1 и W2. Предполагается, что в основе выявленной клональной изменчивости лежит механизм митотической рекомбинации [Grevelding, 1999;

Bayne and Grevelding, 2003].

Трематоды до сих пор остаются малоизученными с точки зрения структурной организации и эволюции генома. Только в 2009 г. были расшифрованы полные последовательности ядерных геномов двух представителей данного класса – возбудителей шистосоматоза человека S. mansoni и S. japonicum [Berriman et al., 2009;

Liu et al., 2009].

Показано, что геномы этих паразитов имеют ряд особенностей. Например, по сравнению с геномами других беспозвоночных они имеют относительно большой размер и низкую частоту генов, а длина интронов может значительно варьировать в пределах одного гена.

Кроме того, показано, что в протеоме S. japonicum отсутствует около 4000 белковых доменов, характерных для других многоклеточных организмов. Предполагается, что утрата около 1000 из этих доменов может быть отчасти обусловлена приспособлением к паразитическому образу жизни. Свыше трети генома шистосом млекопитающих составляют повторяющиеся последовательности, представленные тандемными и рассеянными повторами, а также мобильными элементами, преимущественно ретротранспозонами.

Помимо фундаментального значения исследование структурной организации генома трематод может иметь практическое приложение в медицине и сельском хозяйстве при разработке экспресс-методов генотипирования возбудителей заболеваний человека и животных, а также для создания нового поколения лекарств и усовершенствования вакцин.

Целью данной работы является исследование геномной вариабельности партеногенетического потомства (церкарий) различных видов трематод, выявленной с помощью RAPD-маркеров.

В работе были поставлены следующие задачи:

1. Оценить клональную RAPD-изменчивость церкарий отдельных видов в группах спороцистоидных и редиоидных трематод;

2. На примере двух видов трематод (Bucephalus polymorphus и Trichobilharzia szidati) оценить уровни и распределение внутривидовой RAPD-изменчивости церкарий;

3. С помощью метода полимеразной цепной реакции (ПЦР) амплифицировать, затем клонировать и секвенировать RAPDs отдельных представителей спороцистоидных и редиоидных трематод;

4. На основании полученных последовательностей разработать локус-специфичные праймеры и использовать наборы этих праймеров для амплификации новых последовательностей генома трематод;

5. Выявить структурные особенности полученных последовательностей: определить АТ/GС-содержание, провести поиск повторов, а также поиск гомологии с известными нуклеотидными и аминокислотными последовательностями шистосом млекопитающих (S.

mansoni, S. japonicum) из GenBank;

6. Разработать молекулярно-диагностическую систему, пригодную для детекции птичьих шистосом (возбудителей церкариального дерматита человека) на стадии промежуточного хозяина – моллюска.

Научная новизна и практическое значение работы. С помощью мультилокусных маркеров (RAPDs) впервые выявлено наличие клональной генетической изменчивости церкарий 10 видов трематод, относящихся к 9 семействам (Notocotylidae, Halipegidae, Echinostomatidae, Schistosomatidae, Strigeidae, Gorgoderidae, Bucephalidae, Diplostomatidae, Plagiorchiidae). На примере двух видов (Bucephalus polymorphus, Trichobilharzia szidati) впервые показана пригодность предложенных RAPD-маркеров для выявления популяционной структуры на уровне партеногенетического потомства трематод. Впервые выделены неизвестные ранее последовательности ядерного генома четырех видов трематод (Trichobilharzia franki, T. szidati, Bilharziella polonica, Echinoparyphium aconiatum), гомологичные ретроэлементам шистосом млекопитающих (S. mansoni, S. japonicum). На основе одной из полученных последовательностей разработана новая молекулярно диагностическая система для детекции птичьих шистосом из рода Trichobilharzia на стадии промежуточного хозяина – моллюска. Данная система пригодна для мониторинга природных очагов возбудителей церкариального дерматита человека.

Результаты работы могут быть использованы при создании новых генных тест-систем для видовой диагностики трематод, а также поиска генов устойчивости к действию антигельминтных препаратов. Они могут найти свое применение при разработке медико ветеринарных программ в соответствующих учреждениях РАН и РАСХН, таких как Центр паразитологии ИПЭЭ РАН, Всероссийский Институт гельминтологии им. К.И. Скрябина, ветеринарных академиях, институтах, факультетах и других учреждениях медико ветеринарного профиля.

Апробация работы. Основные результаты диссертационной работы были представлены на межрегиональной конференции «Паразитологические исследования в Сибири и на Дальнем Востоке» (Новосибирск, 15-20 сентября 2005 г.), международной конференции «Фауна, биология, морфология и систематика паразитов» (Москва, 19- апреля 2006 г.), международной конференции «Генетика в России и мире» (Москва, 28 июня 2 июля 2006 г.), 11-ом международном конгрессе по паразитологии (Scotland, Glasgow, 6- августа 2006 г.), международной конференции «The Biology of Genomes» (USA, Cold Spring Harbor, 8-12 мая 2007 г.), международной конференции «Вычислительная филогенетика и систематика» (Москва, 16-19 ноября 2007 г.), 10-ом европейском мультиколлоквиуме по паразитологии (France, Paris, 24-28 августа 2008 г.), международной конференции «Биоразнообразие и экология паразитов наземных и водных ценозов» (Москва, 9-11 декабря 2008 г.), V съезде Вавиловского Общества генетиков и селекционеров (Москва, 21-28 июня 2009 г.), международной конференции «Теоретические и практические проблемы паразитологии» (Москва, 30 ноября-3 декабря 2010 г.), а также межлабораторном семинаре ИБГ РАН (25 октября 2010 г.).

Публикации. По материалам диссертации опубликовано 13 работ, в том числе, статьи.

Структура и объем диссертации. Диссертация изложена на страницах и состоит из введения, обзора литературы, описания материалов и методов, изложения результатов и их обсуждения, выводов, списка литературы, включающего наименований, а также приложения (_ страниц). Работа содержит _ таблиц и _ рисунков.

МАТЕРИАЛЫ И МЕТОДЫ В работе использованы препараты ДНК зрелых свободноплавающих церкарий трематод, а также церкарий из спороцист и редий, паразитирующих в природных популяциях моллюсков из водоемов г. Москвы, Ярославской и Новосибирской обл., а также Белоруссии. Всего исследовано свыше 1000 церкарий 13 видов из 9 семейств трематод, собранных из 33 инфицированных пресноводных моллюсков 9 видов из 4 семейств.

Основными методами, использованными в работе, являются ПЦР со случайными (RAPD-фингерпринтинг) и локус-специфичными праймерами, клонирование и секвенирование ДНК, а также биоинформатический анализ данных с помощью алгоритмов поиска гомологии BLAST (http://www.ncbi.nlm.nih.gov). Поиск повторов в последовательностях проводили с использованием программ Tandem Repeat Finder, Inverted Repeat Finder и Spectral Repeat Finder. Построение дендрограмм генетических различий (GDxy), расчет стандартных индексов популяционно-генетического разнообразия (P и I), иерархическое разложение дисперсии (AMOVA) выполняли с помощью программ TREECON for Windows, POPGENE ver. 1.32 и ARLEQUIN ver 3.11 соответственно.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ 1. Исследование RAPD-изменчивости партеногенетического потомства у представителей различных семейств трематод 1.1. Клональная изменчивость спороцистоидных и редиоидных трематод Метод мультилокусного RAPD-фингерпринтинга применяли для выявления генетической изменчивости партеногенетического потомства (церкарий) трематод. Для каждого из изученных видов исследовали отдельных, единичных церкарий, выделенных из партенит – дочерних спороцист или редий, паразитирующих в организме одного моллюска хозяина. При сравнении церкарий внутри отдельных партенит мы использовали термин «клональная изменчивость». Совокупность свободноплавающих или незрелых церкарий из всех партенит моллюска-хозяина мы называли инфрапопуляцией.

Шесть случайных десятичленных праймеров (OPA01, OPA09, OPA10, OPA11, OPA17, P29) были использованы для выявления вариабельности партеногенетического потомства видов трематод, объединенных на основании морфологии партенит (спороцисты или редии) в две группы: спороцистоидные (семейства Schistosomatidae, Strigeidae, Gorgoderidae, Bucephalidae, Diplostomatidae, Plagiorchiidae) и редиоидные (семейства Notocotylidae, Halipegidae, Echinostomatidae). Примеры RAPD-спектров церкарий спороцистоидных (T.

szidati) и редиоидных (Halipegus sp.) трематод, полученные с помощью праймеров P29 и OPA17, представлены на рис. 1.

В табл. 1 приведены обобщенные оценки клональной изменчивости церкарий 6 видов спороцистоидных и 4 видов редиоидных трематод, полученные на основании анализа церкарий из 36 спороцист и 40 редий. Показателем изменчивости трематод каждого вида являлось среднее значение доли полиморфных локусов, выявляемых при использовании одного праймера для церкарий из одной партениты (спороцисты или редии) – P. Оказалось, что наибольшие значения данного показателя (24.5-29.4%) характерны для спороцистоидных трематод из 4 семейств: Schistosomatidae, Bucephalidae, Diplostomatidae, Plagiorchiidae. Для представителей семейств Gorgoderidae и Strigeidae выявлен более низкий уровень клональной изменчивости (17.8% и 7.5% соответственно). Несмотря на использование большого числа праймеров между церкариями редиоидных трематод (Notocotylidae, Halipegidae и Echinostomatidae) зарегистрирована незначительная изменчивость, варьировавшая в пределах 5.2-6.5%. При сравнении двух групп трематод оказалось, что уровень клональной изменчивости у спороцистоидных форм (22.5%) почти в 4 раза выше, чем у редиоидных трематод (6.2%).

а) Trichobilharzia szidati (Schistosomatidae). б) Halipegus sp. (Halipegidae).

Праймер P29 Праймер OPA Рисунок 1. Примеры RAPD-спектров церкарий спороцистоидных (а) и редиоидных (б) трематод. Обозначения: спц – спороциста;

ред – редия;

M – маркер молекулярных масс ( bp Ladder).

Таблица 1. Оценки клональной генетической изменчивости церкарий редиоидных и спороцистоидных трематод.

Число Число Вид Тип и число исследо- P, Семейство: вид трематод прайме моллюска-хозяина партенит ванных (%) ров церкарий Schistosomatidae: Lymnaea stagnalis 9 спц 43 2 29. Trichobilharzia szidati Diplostomatidae:

5 спц 32 3 27. Diplostomum Lymnaea stagnalis chromatophorum Bucephalidae:

4 спц 30 3 27. Dreissena polymorpha Bucephalus polymorphus Plagiorchiidae:

6 спц 31 3 24. Lymnaea palustris Plagiorchis mutationis Gorgoderidae:

5 спц 31 3 17. Dreissena polymorpha Phyllodistomum folium Strigeidae:

7 спц 34 3 7. Lуmnaea stagnalis Apatemon sp.

Halipegidae:

7 ред 41 4 6. Planorbis planorbis Halipegus sp.

Notocotylidae:

9 ред 51 6 6. Оpistorchophorus troscheli Notocotylus imbricatus Echinostomatidae:

12 ред 52 8 6. Echinoparyphium Lymnaea tumida recurvatum, 12 ред 52 8 5. Echinoparyphium aconiatum Lymnaea palustris Морфотипы:

Спороцистоидные 36 спц 201 2-3 22. Редиоидные 40 ред 196 4-8 6. Обозначения: спц – спороциста;

ред – редия;

P – среднее значение доли полиморфных локусов, выявляемых при использовании одного праймера для церкарий из одной партениты.

1.2. Клональная и популяционная изменчивость церкарий трематод Bucephalus polymorphus и Trichobilharzia szidati Для двух представителей спороцистоидных трематод мы оценили уровни и распределение внутривидовой RAPD-изменчивости церкарий. С этой целью были исследованы 37 церкарий из 9 спороцист Bucephalus polymorphus (Bucephalidae), выделенных из трех моллюсков Dreissena polymorpha, собранных в двух водохранилищах Волжского бассейна: Рыбинском (плесы Коприно, Молога) и Горьковском. Кроме того, мы исследовали 7 инфрапопуляций зрелых свободноплавающих церкарий (n=39) птичьей шистосомы T.

szidati из трех популяций: московские пруды в Алтуфьево и Олимпийской деревне, а также бассейн р. Каргат в Новосибирской области.

Для выявления изменчивости каждого из видов использовали по три случайных праймера: ОРА09, ОРА01, Р29 (для B. polymorphus) и ОРА09, OPA10, Р29 (для T. szidati). На основании суммарных RAPD-спектров для каждого вида была построена UPGMA дендрограмма генетических различий (GDxy), свидетельствующая о высокой внутривидовой изменчивости. Значения минимальных и максимальных различий для церкарий B.

polymorphus из одной и той же спороцисты варьируют от 0.14 до 0.28, тогда как различия между церкариями в пределах моллюска составили 0.14-0.39 (РK), 0.15-0.36 (РM) и 0.12-0. (Г) (рис. 2). Внутрипопуляционные вариации показателя GDxy у T. szidati оказались значительно выше (рис. 3). Так, различия между церкариями в пределах инфрапопуляций варьировали от 0.03 (Lsk2) до 0.62 (Lsm7). Между инфрапопуляциями РK и РM выявлен практически такой же уровень различий (0.43), как и между популяциями церкарий B.

polymorphus из Рыбинского и Горьковского водохранилищ (0.48). Различия между инфрапопуляциями T. szidati в пределах популяций из Алтуфьево и Олимпийской деревни составили 0.21-0.64 и 0.14-0.69 соответственно. В то же время, различия между двумя популяциями (0.74) оказались сопоставимыми с различиями между московской и сибирской (Каргат) выборками (0.80).

На дендрограммах отдельные подкластеры, соответствующие инфрапопуляциям, образованы церкариями B. polymorphus из трех исследованных моллюсков – РK, РM и Г (рис.

2), а также церкариями T. szidati из инфрапопуляций Lsm1, Lsm20, Lsm2, Lsm3, Lsm4, Lsk (рис. 3). Церкарии из инфрапопуляции Lsm7 разделились на две группы и объединились с подкластером Lsm1. Для трех изученных популяций T. szidati из Алтуфьево (Lsm1, Lsm7, Lsm20), Олимпийской деревни (Lsm2, Lsm3, Lsm4) и р. Каргат (Lsk2), а также рыбинской (РK, РM) и горьковской (Г) популяций B. polymorphus выявлена надежная дифференциация.

Рисунок 2. Дендрограмма генетических различий (GDxy) между церкариями из 9 спороцист Bucephalus polymorphus, выделенных из трех моллюсков Dreissena polymorpha, собранных в Рыбинском (Молога – РM, Коприно – РK) и Горьковском (Г) водохранилищах. Церкарии из одних и тех же спороцист обозначены одинаковыми цифрами (от 1 до 9). Цифрами в точках ветвления отмечены значения (50%) индекса бутстрепа (1000 реплик).

Численные значения коэффициентов генетической изменчивости (Р – доля полиморфных локусов;

I – среднее генетическое разнообразие), полученные для церкарий двух видов, подтверждают наличие высокой внутривидовой гетерогенности и подразделенности, выявленной в результате кластеризации на разных уровнях иерархии:

внутри спороцист (B. polymorphus), внутри инфрапопуляций (B. polymorphus, T. szidati), в пределах водоемов или популяций (B. polymorphus, T. szidati), в суммарной выборке из нескольких популяций (B. polymorphus, T. szidati).

Рисунок 3. Дендрограмма генетических различий между зрелыми церкариями Trichobilharzia szidati из трех популяций: пруды Алтуфьево, Олимпийской деревни, бассейн р. Каргат.

Обозначения: Lsm1, Lsm7, Lsm20, Lsm2, Lsm3, Lsm4, Lsk2 – инфрапопуляции церкарий;

цифрами в точках ветвления обозначены значения (50%) индекса бутстрепа (1000 реплик).

Анализ разложения генетического разнообразия (AMOVA), выполненный для церкарий двух видов, позволил получить статистически значимые оценки вклада в общее разнообразие каждого из соответствующих компонентов исследуемой иерархической системы. Анализ церкарий B. polymorphus показал, что различия между тремя моллюсками (инфрапопуляциями) составляют 23.5% от общего разнообразия, а остальные 76.5% распределены между церкариями внутри отдельных спороцист (53.0%) и между спороцистами в пределах моллюсков (23.5%). Наибольший вклад в общее разнообразие T.

szidati вносит изменчивость церкарий внутри инфрапопуляций (48.9%). При переходе на следующие уровни (между инфрапопуляциями из одного водоема;

между популяциями) вклад соответствующих компонентов в общее разнообразие уменьшается (32.3% и 18.8% соответственно).

Таким образом, RAPD-маркеры, предложенные нами, оказались пригодными для выявления популяционной структуры двух видов трематод на уровне партеногенетического потомства (церкарий): обнаружены генетические различия между церкариями в пределах популяций (внутри спороцист и инфрапопуляций;

между инфрапопуляциями), а также между популяциями. При этом наибольший вклад (53.0%) во внутривидовое разнообразие церкарий вносит клональная изменчивость – на уровне спороцист (B. polymorphus), тогда как межпопуляционные различия (T. szidati) характеризуются минимальными значениями дисперсии (18.8%).

2. Характеристика вариабельных RAPDs из генома церкарий трематод Trichobilharzia szidati, T. franki и Echinoparyphium aconiatum Для создания RAPD-клонотеки использованы два праймера (P29 и OPA10), которые давали наиболее высокие оценки клональной изменчивости у спороцистоидных трематод. С их помощью получены RAPD-спектры единичных церкарий трех видов спороцистоидных (T.

szidati, T. franki) и редиоидных (E. aconiatum) трематод. Для клонирования были отобраны отдельные полиморфные фрагменты из спектров единичных церкарий, а также фрагменты из спектров нескольких церкарий. В целом, из спектров незрелых, а также свободноплавающих церкарий T. szidati, T. franki и E. aconiatum отобрано 28 стабильно воспроизводящихся фрагментов (ампликонов) размером более 300 п.н. На рис. 4 в качестве примера приведено 10 фрагментов, выбранных для клонирования из RAPD-спектров T. szidati, полученных с помощью праймера OPA10.

Рисунок 4. RAPD-спектры церкарий Trichobilharzia szidati, полученные с помощью случайного праймера OPA10. Обозначения: Lsm7, Lsm20 – инфрапопуляции церкарий;

рамкой выделены клонированные ампликоны (Ts13-Ts22);

M – маркер молекулярных масс (100 bp Ladder).

Для каждого клонированного RAPD-ампликона проведено секвенирование 1- клонов. В результате секвенирования 33 клонов получено 32 последовательности, отличающихся между собой.

С помощью алгоритмов BLAST (blastn, blastx) для полученных последовательностей был проведен поиск значимой гомологии с аннотированными нуклеотидными и аминокислотными последовательностями шистосом млекопитающих (S. mansoni, S.

japonicum). В 12 последовательностях, размер которых составил 372-1505 п.н., обнаружено 14 регионов, гомологичных ретроэлементам S. mansoni, S. japonicum. В одной последовательности (Ts82-32) выявлено три региона, в остальных 11 последовательностях найдены единичные области гомологии. В целом, в 5 последовательностях T. szidati (Ts71 00, Ts74-83, Ts82-32, Ts85-90, Ts51-82) и одной последовательности T. franki (Tf47-26) обнаружено 7 регионов, гомологичных nLTR-ретротранспозонам (LINE) филогенетической клады (линии) RTE: SjCHGCS20 и SjR2 (n=5), а также SjCHGCS19 и Perere-3 (n=2). Кроме того, в последовательности Ech004 E. aconiatum выявлен регион, гомологичный nLTR ретротранспозону линии CR1 – Perere-5. В другой последовательности E. aconiatum (Ech001) выявлен регион, гомологичный LTR-ретротранспозону клады Gypsy/Ty3 – Saci-3. В двух последовательностях (Tf48-00, Ts83-28), выделенных из геномов T. franki и T. szidati, найдены регионы, гомологичные LTR-ретротранспозонам клады BEL – SjCHGCS16 и Saci- (n=2). В двух других последовательностях T. franki (Tf98-00) и T. szidati (Ts82-32), выявлены единичные регионы, гомологичные Penelope-подобным элементам – Perere-10 и SjPenelope- соответственно. Для всех перечисленных выше 13 регионов выявлена гомология (на аминокислотном уровне) с геном pol. В одной последовательности (Ts47-78) найден участок размером 55 п.н., гомологичный некодирующей области nLTR-ретротранспозона Perere-3.

Многие регионы имели в кодирующей области стоп-кодоны, инсерции/делеции кодонов, а также сдвиги рамки считывания. Размер участков гомологии варьировал от 35 до 459 п.н., а уровень сходства – от 25 до 80%. Наиболее сложная структура выявлена в последовательности Ts82-32 (рис 5). В ней идентифицировано четыре участка, два из которых (I, II) составляют регион, имеющий гомологию с Perere-3. В данном регионе выявлен сдвиг рамки считывания. Два других участка (III, IV), расположенных ближе к 3 концу, оказались гомологичными SjPenelope-2 и SjCHGCS20 соответственно.

Поиск повторов, выполненный для 12 исследованных RAPDs, показал наличие в их составе тандемных и рассеянных повторяющихся последовательностей. Доля прямых тандемно организованных повторов составила 4.7%, инвертированных – 17.3%. Доля рассеянных повторов (ди-, три- и тетрануклеотидных) оказалась равной 19.8%. Среднее содержание данных компонентов составило 35.6%.

Рисунок 5. Расположение трех регионов, гомологичных гену pol ретроэлементов Perere- (Schistosoma mansoni), SjPenelope-2 (S. japonicum) и SjCHGCS20 (S. japonicum) в последовательности Ts82-32 Trichobilharzia szidati. Регион, имеющий гомологию с Perere-3, включает участки I и II;

III и IV – регионы, гомологичные SjPenelope-2 и SjCHGCS соответственно;

области, в которых гомология отсутствует, обозначены черным цветом;

+1, +2, +3 – рамки считывания.

3. Характеристика нуклеотидных последовательностей из генома церкарий птичьих шистосом Trichobilharzia szidati и Bilharziella polonica, полученных с помощью праймеров, сконструированных на основе RAPDs С целью более подробного исследования областей, в которых локализованы обнаруженные нами регионы, гомологичные ретроэлементам S. mansoni, S. japonicum, из RAPD-клонотеки были выбраны 4 наиболее протяженные последовательности. На их основе сконструировано 14 специфичных праймеров. С помощью этих праймеров, использованных в различных комбинациях, получены спектры амплификации церкарий двух видов птичьих шистосом – T. szidati и B. polonica. На рис. 6 в качестве примера приведены спектры B.

polonica, полученные с использованием праймера TR47-78R. Из спектров T. szidati и B.

polonica для клонирования были выбраны преимущественно крупноразмерные фрагменты (n=21).

Рисунок 6. Спектры амплификации церкарий Bilharziella polonica, полученные с помощью праймера TR47-78R. Обозначения: спц – спороциста;

рамкой выделены клонированные ампликоны (BpN1, BpN2);

M – маркер молекулярных масс (100 bp Ladder).

В результате секвенирования 52 клонов получено 42 различающихся последовательности, размер которых варьировал от 304 до 1404 п.н. В данных последовательностях обнаружены прямые (9.4%) и инвертированные (22.4%) тандемно организованные повторяющиеся последовательности, а также рассеянные повторы (ди-, три и тетрануклеотидные), доля которых оказалась равной 19.1%. Среднее содержание тандемных и рассеянных повторов составило 41.6%.

С помощью биоинформатического анализа в 10 последовательностях выявлено регионов аминокислотной гомологии с геном pol различных ретротранспозонов S. mansoni и S. japonicum. При этом в двух последовательностях (Ts49-66, Bp60-58) обнаружено по два региона, а в остальных 8 последовательностях найдены единичные области гомологии. В целом, в 4 последовательностях T. szidati (Ts49-66, Ts76-85, Ts52-50, Ts72-64) и двух последовательностях B. polonica (Bp60-58, Bp70-00) обнаружено 8 регионов, гомологичных nLTR-ретротранспозонам клады RTE: SjCHGCS20 и SjR2 (n=3), а также SjCHGCS19 и Perere-3 (n=5). В трех последовательностях T. szidati (Ts53-51, Ts51-24, Ts48-65) выявлено три региона, гомологичных nLTR-ретротранспозонам клады CR1: Perere и Perere-7 (n=1), Perere-2, -5, -6 (n=1), Perere-8 (n=1). В последовательности Ts51-49 T. szidati выявлен единичный регион, сходный с LTR-ретротранспозоном линии Gypsy/Ty3 – SjCHGCS3.

Большая часть выявленных регионов имела инсерции/делеции кодонов, стоп-кодоны, а также сдвиги рамки считывания. Размер участков гомологии составил 39-1017 п.н., а уровень гомологии варьировал от 25 до 77%.

Таким образом, из генома четырех видов трематод (T. franki, T. szidati, B. polonica, E.

aconiatum) получено 54 новых, ранее неизвестных последовательностей (общий размер – тыс. п.н.). Содержание АТ-оснований оказалось равным 58.7%, а среднее содержание тандемных и рассеянных повторов составило 39.7%. В 22 последовательностях выявлено не сходных между собой регионов размером от 55 до 1017 п.н., имеющих гомологию с ретроэлементами шистосом млекопитающих из трех подклассов: ретротранспозонами, не содержащими длинных концевых повторов (LINE) – nLTR (76%), ретротранспозонами, имеющими длинные концевые повторы – LTR (16%), а также Penelope-подобными элементами – PLE (8%) (рис. 7).

Рисунок 7. Распределение регионов, выявленных в составе последовательностей из геномов четырех видов трематод (Trichobilharzia franki, T. szidati, Bilharziella polonica, Echinoparyphium aconiatum), по трем п/классам ретроэлементов. Обозначения: CR1, RTE – филогенетические клады nLTR-ретротранспозонов (nLTR);

Gypsy/Ty3, BEL – филогенетические клады LTR-ретротранспозонов (LTR);

PLE – Penelope-подобные элементы.

4. Разработка новой молекулярно-диагностической системы для детекции птичьих шистосом из рода Trichobilharzia (T. franki, T. szidati, T. regenti) на стадии промежуточного хозяина – моллюска Для того чтобы разработать молекулярно-диагностическую систему для детекции возбудителей церкариального дерматита человека – птичьих шистосом из рода Trichobilharzia – мы использовали последовательности, полученные в результате клонирования RAPDs двух видов трихобильгарций (T. franki и T. szidati). Одна из последовательностей T. franki (Tf98-00), гомологичная ретроэлементу Perere-10 S. mansoni (CAJ00247), оказалась пригодной для конструирования пары локус-специфичных праймеров (TR98F и TR98R), стабильно амплифицирующих не более 1-2 фрагментов в спектрах церкарий трех видов трихобильгарций (T. franki, T. szidati, T. regenti).

Использование этих праймеров в реакциях амплификации с ДНК T. franki из трех инфрапопуляций (Ram1, NLau15 и NLau17) позволило получить ампликон размером ~ п.н. (рис. 8). Амликон аналогичного размера получен также на ДНК церкарий и спороцист из 4 инфрапопуляций T. szidati (NLst10, BzLst5, Steplst4 и Lsm20) и двух инфрапопуляций T.

regenti (Rom1 и Rom2). Кроме того, у всех образцов T. szidati визуализирован дополнительный ампликон размером ~280 п.н., а у T. regenti – дополнительный ампликон размером ~230 п.н. Мы не обнаружили ни одного амплифицированного продукта при использовании в качестве матрицы ДНК трех других видов трематод: B. polonica (Schistosomatidae), Apatemon sp. (Strigeidae) и Diplostomum sp. (Diplostomatidae). Отсутствие продуктов амплификации наблюдалось и при использовании ДНК трех видов неинфицированных моллюсков (R. auricularia, L. stagnalis и R. ovata), которые являются хозяевами трех исследованных видов шистосом (T. franki, T. szidati и T. regenti соответственно).

Рисунок 8. Продукты амплификации, полученные с помощью локус-специфичных праймеров TR98F и TR98R в спектрах птичьих шистосом из рода Trichobilharzia при температуре отжига 60°C. Обозначения: спектры 1-3: T. franki (инфрапопуляции Ram1, NLau15 и NLau17 соответственно);

спектры 4-7: T. szidati (инфрапопуляции BzLst5, StepLst4, Lsm2 и Lsm20 соответственно);

спектры 8-9: T. regenti (инфрапопуляции Rom1 и Rom соответственно);

спектры 10, 11 и 12: Bilharziella polonica, Apatemon sp. и Diplostomum sp.

соответственно;

спектры 13, 14 и 15: Lymnaea stagnalis, Radix auricularia и R. ovata соответственно;

буквой “a” рядом с номером спектра отмечены профили амплификации ДНК спороцисты;

М – маркер молекулярных масс (100 bp Ladder).

Данные профили амплификации, полученные для исследованных трематод и моллюсков, стабильно воспроизводились при температуре отжига праймеров от 55°С до 60°С. При повышении температуры отжига до 65°С у всех трех видов оставался неизменным мажорный ампликон размером ~400 п.н., однако, только у T. szidati сохранялся дополнительный ампликон размером ~280 п.н.

Чтобы подтвердить пригодность разработанной системы для детекции птичьих шистосом на стадии моллюска были проведены два дополнительных эксперимента. В первом случае в реакции амплификации использовали ДНК, полученную из гомогената, содержащего фрагменты печени неинфицированного моллюска, смешанные в равных объемах (~1:1) со спороцистами паразита. Во втором случае в качестве матрицы использовали смесь (~1:1 по массе) ДНК паразита и хозяина. Для каждого из трех видов трихобильгарций (T. franki, T. szidati, T. regenti) исследовано по одной инфрапопуляции (Ram1, Lsm20, Rom2 соответственно). Независимо от способа получения ДНК-матрицы в спектрах присутствовали только ампликоны ожидаемого размера: по одному ампликону размером ~400 п.н. в спектрах T. franki и T. regenti и два – размером ~400 п.н. и ~280 п.н. в спектрах T. szidati.

С целью выявления внутри- и межвидовых различий в исследуемом участке ДНК проведено выравнивание 17 последовательностей, полученных в результате клонирования мажорных (~400 п.н.) ампликонов T. franki, T. szidati и T. regenti. Эти последовательности отличались как по длине, так и по составу (рис. 9). Шесть клонов T. franki отличались между собой только одной нуклеотидной заменой (трансверсией) и имели одинаковый размер – п.н. Восемь клонов T. regenti имели одинаковый размер (393 п.н.) и оказались идентичными.

Кроме того, последовательности T. franki, полученные для зрелых церкарий (Tf(cer)16– Tf(cer)18) и совокупности незрелых церкарий из одной спороцисты (Tf(cer)13–Tf(cer)15) не различались. Сходным образом, последовательности T. regenti, полученные для зрелых церкарий (Tr(cer)89–Tr(cer)92) и совокупности незрелых церкарий из одной спороцисты (Tr(sp)93–Tr(sp)96), не отличались между собой. Два клона T. szidati (Ts400(cer)19 и Ts400(cer)21) различались единичной транзицией и имели одинаковый размер – 391 п.н. По сравнению с основным ампликоном (Ts400(cer)19) последовательность минорного фрагмента T. szidati (Ts280(cer)23), размер которой составил 274 п.н., имеет 44 точечных замены и 5 участков точечных делеций разной протяженности (от 5 до 36 п.н.). При исключении из анализа делеций сходство между мажорным и минорным фрагментами ДНК T. szidati составляет 82%. Сравнительный анализ последовательностей мажорного ампликона выявил высокую степень гомологии между ПЦР-продуктами: 87% гомологии между последовательностями T. szidati и T. regenti и 85% – между T. franki и T. regenti. Сходство между последовательностями T. franki и T. szidati составило 83%.

10 20 30 40 50 60 70 80 90....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| Tf98-00 CCGGCCTTACTCCGACTGATGATGACAAGAAGAGCT-GGTTCAAATCTAAGCTGGCCGACGTTGCAAATCAATACCTTATTTCACCAACGTCATATTCCT Tf(cer)14 ---------...........................-...............................................................

Tf(cer)13 ---------...........................-...............................................................

Tf(cer)15 ---------...........................-...............................................................

Tf(sp)16 ---------...........................-...............................................................

Tf(sp)17 ---------...........................-...............................................................

Tf(sp)18 ---------...........................-...............................................................

Ts400(cer)19 ---------...........................-................CAT.....C...G....C.C....C.....TT...AA.........A Ts400(cer)21 ---------...........................-................CAT.....C...G....C.C....C.....TT...AA.........A Tr(cer)89 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(cer)90 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(cer)91 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(cer)92 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(sp)93 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(sp)94 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(sp)95 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Tr(sp)96 ---------...........................T....T.T........CT.T.....................C.....T.T..T..........A Clustal Consensus *************************** **** * ******** ***** *** **** **** ***** ** ********* 110 120 130 140 150 160 170 180 190....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| Tf98-00 AAATCCTCTCTGAAGAGCATCAAGG-AGCATTGAAAGTTCTCAAAGATAATGACAAAATTTTTATATTGCGACCTGACAAAGACCCAGGAGTGGTGATGA Tf(cer)14.........................-..........................................................................

Tf(cer)13.........................-....................................C.....................................

Tf(cer)15.........................-....................................C.....................................

Tf(sp)16.........................-....................................C.....................................

Tf(sp)17.........................-....................................C.....................................

Tf(sp)18.........................-....................................C.....................................

Ts400(cer)19......C...A............A.-...........C......GA.........G..C.G.....................GAT.CT....T...C...

Ts400(cer)21......C...A............A.-...........C......GA.........G..C.G.....................GAT.CT....A...C...

Tr(cer)89..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(cer)90..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(cer)91..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(cer)92..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(sp)93..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(sp)94..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(sp)95..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Tr(sp)96..G....T........A......AACG..........C......GA..............G.....C...............G.TT..........C...

Clustal Consensus ** *** ** ***** ****** ********** ****** ********* * * * *** *************** *** *** *** 210 220 230 240 250 260 270 280 290....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| Tf98-00 TCGACACAGATGACTACATCGCAGAGATAAAAACTGTGTTAAATGATGCGTTGAGGTTTAAAGTTGAAGACTGCCAGAAAGATAAGACAGATGCGGTTGA Tf(cer)14....................................................................................................

Tf(cer)13....................................................................................................

Tf(cer)15....................................................................................................

Tf(sp)16....................................................................................................

Tf(sp)17....................................................................................................

Tf(sp)18....................................................................................................

Ts400(cer)19.G....A...G............A....G.................CC.T.................CA.T..A.............G..C...A.C...

Ts400(cer)21.G....A...G............A....G.................CC.T.................CA.T..A.............G..C...A.C...

Tr(cer)89.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(cer)90.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(cer)91.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(cer)92.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(sp)93.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(sp)94.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(sp)95.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Tr(sp)96.G....A...G............A....G...G...C.........CC.A.................CA.T.A..............T......A.....

Clustal Consensus * **** * * ************ **** *** *** ********* * **** ************ * * ************* * *** * *** 310 320 330 340 350 360 370 380 390....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|..

Tf98-00 AAAACATATCACAAACGTACTGAGGGATCTTCTAAAGAAAAAAATGATTGATAACAATAAGTGCAATGAACTGAATACCCGAGGATACCGTTCGCCACTCATGTAAGGCCGG Tf(cer)14......................................................................................................--------- Tf(cer)13......................................................................................................--------- Tf(cer)15......................................................................................................--------- Tf(sp)16......................................................................................................--------- Tf(sp)17......................................................................................................--------- Tf(sp)18......................................................................................................--------- Ts400(cer)19....AG...........C.....CA....G.........G...T...C...C.......T..A..G...CT..T.AC.........................--------- Ts400(cer)21....AG...........C.....CA....G.........G...T...C...C.......T..A..G...CT..T.AC.........................--------- Tr(cer)89.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(cer)90.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(cer)91.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(cer)92.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(sp)93.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(sp)94.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(sp)95.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Tr(sp)96.....G...........C......A...............C..T....C..C.......C..A......TT....AC.........................--------- Clustal Consensus **** *********** ***** **** ********* ** *** ** **** ** ** ** *** ** * ******************* **** Рисунок 9. Выравнивание последовательностей ~400 п.н. ампликонов, полученных с помощью праймеров TR98F и TR98R в спектрах церкарий и спороцист трех видов трихобильгарций. Обозначения: Tf98-00, Tf(cer)13-Tf(sp)18 – последовательности Trichobilharzia franki;

Ts400(cer)19, Ts400(cer)21 – последовательности T. szidati;

Tr(cer)89-Tr(sp)96 – последовательности T. regenti;

cer – церкарии;

sp – спороциста;

точками обозначены нуклеотидные позиции, идентичные нуклеотидам в последовательности Tf98-00;

пунктиром обозначены делеции;

последовательность случайного праймера P29 заключена в рамку;

последовательности праймеров TR98F и TR98R выделены серым фоном.

ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ К наиболее интересным результатам нашего исследования относится явление клональной изменчивости партеногенетического потомства (церкарий), зарегистрированное у представителей 9 семейств трематод. Ранее использование RAPDs позволило выявить генетическую гетерогенность метацеркарий из спороцист Microphallus pygmaeus [Халтурин и др., 2000], а также изменчивость в клонах церкарий S. haematobium [Shiff et al., 2000].

Впервые явление клональной изменчивости было подробно изучено на церкариях S. mansoni, полученных при экспериментальном заражении моллюсков B. glabrata единичными мирацидиями, а также на дочерних спороцистах, выращенных in vitro на культуре клеток B.

glabrata. Предполагалось, что неравномерное распределение повторов W1 и W2 между церкариями в пределах спороцист, а также между спороцистами связано с митотической рекомбинацией, происходящей при размножении партенит [Grevelding, 1999;

Bayne and Grevelding, 2003]. Однако молекулярные или цитогенетические доказательства, подтверждающие рекомбинационные события в онтогенезе партенит, до сих пор не представлены.

Обнаруженные нами различия в уровне клональной изменчивости спороцистоидных и редиоидных трематод, по-видимому, свидетельствуют о разных путях эволюции генома в этих группах. Результаты более детального анализа генетической изменчивости церкарий, полученные на большем числе видов и с использованием различных молекулярно генетических маркеров, возможно, позволят судить об эволюции и взаимосвязях между отдельными семействами и видами спороцистоидных и редиоидных трематод.

Предлагаемые нами RAPD-маркеры оказались также пригодными для выявления популяционной структуры двух видов трематод (B. polymorphus и T. szidati) на уровне партеногенетического потомства. При этом оказалось, что наибольший вклад во внутривидовую RAPD-изменчивость церкарий вносит разнообразие внутри отдельных спороцист, т.е. клональная изменчивость.

Структурный анализ вариабельных RAPDs показал, что данные последовательности содержат тандемные (прямые, инвертированные) и рассеянные повторы (ди-, три- и тетрануклеотидные). Свыше 40% исследованных RAPDs включали области, имеющие значимую гомологию с ретроэлементами S. mansoni и S. japonicum. В последовательностях T.

szidati, T. franki, B. polonica и E. aconiatum наблюдалось преобладание АТ-оснований (58.7%), как и в геноме шистосом млекопитающих (65.9%) [Liu et al., 2009]. Среднее содержание тандемных и рассеянных повторов в последовательностях изученных трематод (39.7%) оказалось сопоставимым с общим содержанием повторяющейся ДНК в геноме S.

mansoni (40%) и S. japonicum (40.1%) [Berriman et al., 2009;

Liu et al., 2009]. Почти треть последовательностей суммарной клонотеки включала регионы, гомологичные ретроэлементам шистосом млекопитающих (nLTR, LTR, PLE). Большинство этих регионов (76%) оказались фрагментами nLTR-ретротранспозонов. Показано, что данный тип мобильных генетических элементов (МГЭ) преобладает и в геноме шистосом млекопитающих [Berriman et al., 2009;

Liu et al., 2009].

Ретротранспозоны и другие МГЭ обнаружены практически у всех эукариот и играют важную роль в эволюции и реорганизации геномов [Berg and Howe, 1989]. Важнейшим из механизмов, контролирующих экспрессию и частоту перемещений МГЭ, является система РНК-интерференции (РНКи) – защитная клеточная система, распознающая в клетке присутствие двухцепочечной РНК [Fire et al., 1998]. К настоящему моменту S. mansoni является единственным изученным представителем плоских червей, для которого продемонстрировано наличие РНКи [Boyle et al., 2003;

Skelly et al., 2003]. Недавно было показано, что одним из источников коротких интерференционных РНК, или siРНК (short interfering RNA) в геноме Drosophila являются определенные области – мастерлокусы регуляции активности МГЭ [Brennecke et al., 2007]. Данные локусы содержат большое количество дефектных копий мобильных элементов (в том числе, отдельные фрагменты МГЭ, а также копии, встроенные друг в друга), объединенных в кластеры, находящиеся под контролем промоторов. Не исключено, что фрагменты ретроэлементов, выявленные нами в геноме птичьих шистосом (T. szidati, T. franki, B. polonica) и E. aconiatum, могут служить источником коротких интерференционных РНК, использующихся для подавления экспансии мобильных элементов. Большая часть этих фрагментов (85%) содержит в кодирующей области стоп-кодоны, индели кодонов, а также сдвиги рамки считывания. Кроме того, в трех наиболее протяженных последовательностях, размер которых составил 928-1505 п.н., обнаружены фрагменты сразу нескольких элементов, расположенные последовательно.

Однако, возможно, что обнаруженные нами фрагменты не входят в состав мастерлокусов регуляции активности МГЭ. Тем не менее, они могут служить своего рода генетической “памятью” о мобильных элементах, действию которых подвергался геном в прошлом.

Учитывая тот факт, что транспозиции мобильных элементов могут изменять экспрессию генов, вызывать различные хромосомные перестройки, а также способствовать появлению новых генов, перемещения МГЭ в геноме, очевидно, вносят определенный вклад в формирование специфических признаков, повышающих адаптивность вида [Betran and Long, 2002;

Oliver and Greene, 2009]. Так, например, предполагается, что в результате дивергенции азиатских (S. japonicum) и африканских шистосом (S. mansoni) от общей азиатской предковой линии два семейства nLTR-ретротранспозонов (SR2 и Perere-3/SR3) подверглись множественным транспозиционным событиям в геноме S. mansoni, что, по-видимому, увеличило потенциал данного вида к специализации в новых условиях среды [Venancio et al., 2010]. Возможно, что транспозиционные взрывы МГЭ имели место и в эволюционной истории европейских видов птичьих шистосом, изученных нами.

С медицинской точки зрения птичьи шистосомы привлекают особое внимание тем, что они являются возбудителями церкариального дерматита человека. Вследствие сходства биохимического состава некоторых липидных фракций покровов птиц и человека церкарии птичьих шистосом способны проникать в кожу человека (неспецифического хозяина), вызывая аллергическую реакцию [Haas and van de Roemer, 1998]. Предложенная нами новая молекулярно-диагностическая система является специфичной к ДНК птичьих шистосом из рода Trichobilharzia, т.к. исключает амплифицирование ДНК трематод из других семейств (Strigeidae и Diplostomatidae), а также близкородственных птичьих шистосом из рода Bilharziella. Немаловажным для детекции паразита на стадии промежуточного хозяина является тот факт, что разработанные праймеры (TR98F и TR98R) не амплифицируют ДНК моллюсков R. auricularia, L. stagnalis, R. ovata, являющихся хозяевами соответствующих видов трихобильгарций. Одно из преимуществ предлагаемой тест-системы состоит в том, что она основана на использовании метода ПЦР с локус-специфичными праймерами и не требует секвенирования продуктов. Этот простой и дешевый способ детекции может найти широкое применение при мониторинге природных очагов возбудителей церкариального дерматита человека. Отметим, что обнаруженные нами межвидовые различия в интенсивности амплификации мажорного ампликона (~400 п.н.) могут свидетельствовать о различиях в копийности последовательностей, гомологичных последовательности Tf98-00;

для точной же оценки числа копий в дальнейшем необходимо провести блот гибридизационные эксперименты. В перспективе возможна разработка и видовой диагностики трихобильгарций на основании найденных видоспецифичных замен в составе последовательностей мажорного ампликона.

ВЫВОДЫ 1. С помощью RAPD-маркеров впервые выявлено наличие клональной генетической изменчивости церкарий 10 видов трематод, относящихся к 9 семействам (Notocotylidae, Halipegidae, Echinostomatidae, Schistosomatidae, Strigeidae, Gorgoderidae, Bucephalidae, Diplostomatidae, Plagiorchiidae). Показано, что эта изменчивость значительно выше в группе спороцистоидных трематод (22.5%) по сравнению с редиоидными формами (6.2%);

2. На примере двух видов (Bucephalus polymorphus, Trichobilharzia szidati) впервые показана пригодность предложенных RAPD-маркеров для выявления популяционной структуры на уровне партеногенетического потомства трематод: обнаружены генетические различия между церкариями одного вида в пределах популяций (внутри спороцист и инфрапопуляций;

между инфрапопуляциями) и между ними. Показано, что наибольший вклад во внутривидовую изменчивость церкарий вносит клональная изменчивость (разнообразие внутри отдельных спороцист);

3. В результате клонирования 49 ампликонов, выделенных из генома церкарий четырех видов трематод (Trichobilharzia szidati, T. franki, Bilharziella polonica, Echinoparyphium aconiatum), получено 74 различающихся последовательности. В 54 последовательностях найдены тандемные и рассеянные повторы, среднее содержание которых составило 39.7%;

4. С помощью биоинформатического анализа в 22 последовательностях выявлены регионы размером от 55 до 1017 п.н., имеющие гомологию с ретроэлементами шистосом млекопитающих (S. mansoni, S. japonicum), входящими в состав трех п/классов: nLTR (76%), LTR (16%) и PLE (8%). Большинство этих регионов оказались гомологичными кодирующей области (ген pol) и имели сдвиги рамки считывания, стоп-кодоны, а также инсерции/делеции кодонов;

5. На основе одной из последовательностей, имеющей гомологию с ретроэлементом Perere 10 S. mansoni, разработана новая молекулярно-диагностическая система для детекции трематод из рода Trichobilharzia (Schistosomatidae) на стадии промежуточного хозяина (моллюска).

Список работ, опубликованных по теме диссертации Статьи:

1. С.К. Семенова, Г.Г. Хрисанфова, А.В. Корсуненко, М.В. Воронин, С.А. Беэр, С.Н.

Водяницкая, Е.А. Сербина, Н.И. Юрлова, А.П. Рысков. Мультилокусная изменчивость партеногенетического потомства – церкарий трематод разных видов (класс Trematoda). Доклады Академии Наук, 2007, том 414, № 4, с. 570-573;

2. А.В. Корсуненко, А.В. Тютин, С.К. Семенова. Клональная и популяционная RAPD изменчивость церкарий из спороцист Bucephalus polymorphus (Trematoda:

Bucephalidae). Генетика, 2009, том 45, № 1, с. 73-80;

3. A.V. Korsunenko, G.G. Chrisanfova, A.P. Ryskov, S.O. Movsessyan, V.A. Vasilyev, S.K. Semyenova. Detection of European Trichobilharzia schistosomes (T. franki, T.

szidati, and T. regenti) based on novel genome sequences. Journal of Parasitology, 96(4), 2010, pp. 802-806;

Тезисы:

1. Г.Г. Хрисанфова, А.В. Корсуненко, М.В. Воронин, С.В. Беэр, Н.И. Юрлова, С.Н.

Водяницкая, С.К. Семенова. Сравнительный анализ RAPD-изменчивости личиночных стадий трематод разных видов и проблемы нестабильности генома партенит. Материалы межрегиональной научной конференции «Паразитологические исследования в Сибири и на Дальнем Востоке», Новосибирск, 15-20 сентября 2005, с. 224-225;

2. Хрисанфова Г.Г., Корсуненко А.В., Беэр С.А., Воронин М.В., Юрлова Н.И., Водяницкая С.Н., Семенова С.К. RAPD-изменчивость партеногенетических поколений и церкарий некоторых фуркоцеркарных трематод. Материалы международной научной конференции «Фауна, биология, морфология и систематика паразитов», Москва, 19-21 апреля 2006, с. 297-299;

3. Корсуненко А.В. RAPD-изменчивость и характеристика вариабельных участков генома партеногенетических поколений трематод. Материалы международной конференции «Генетика в России и мире», Москва, 28 июня-2 июля 2006, с. 98;

4. A. Korsunenko, G. Chrisanphova, M. Voronin, S. Be’er, S. Vodyanitskaya, N. Yurlova and S. Semyenova. RAPD-fingerprinting of free-swimming cercariae and cercariae isolated from daugther sporocysts of some trematode families. Thesis of the 11th International Congress of Parasitology, Scotland, Glasgow, 6-11 August (опубликовано на CD);

5. A. Korsunenko, G. Chrisanphova and S. Semyenova. RAPD variability of parthenogenetic progeny (cercariae) of two trematode species groups. Thesis of Cold Spring Harbor Laboratory Meeting “The Biology of Genomes”, USA, Cold Spring Harbor, 8-12 May 2007, p.192;

6. С.К. Семенова, А.А. Лопаткин, В.А. Васильев, Е.В. Корчагина, А.В. Корсуненко, Г.Г. Хрисанфова, А.П. Рысков. Филогеномика и молекулярная коэволюция на примере дигенетических сосальщиков (класс Trematoda). Материалы международной конференции «Вычислительная филогенетика и систематика», Москва, 16-19 ноября 2007, с. 293-296;

7. Chrisanfova G., A. Korsunenko, A. Lopatkin, M. Voronin, S. Be'er, O. Zazornova, S.

Vodyanitskaya, N. Yurlova, T. Dorojenkova, E. Heydorova, V. Mishenkov, T. Zhukova, E. Bychkova, S. Semyenova. Diversity of DNA sequences and species identification of cercariae of bird schistosomes obtained from Russian and Belarusian water ponds. Thesis of Xth European Multicolloquium of Parasitology, France, Paris, August 24-28 2008, pp.

110-111;

8. Корсуненко А.В., Тютин А.В., Семенова С.К. RAPD-изменчивость церкарий из спороцист Bucephalus polymorphus (Trematoda: Bucephalidae), паразитирующих на моллюсках Dreissena polymorpha (Bivalvia: Dreissenidae). Материалы международной научной конференции «Биоразнообразие и экология паразитов наземных и водных ценозов», посвященной 130-летию со дня рождения академика К.И.Скрябина, Москва, 9-11 декабря 2008, с. 170-173;

9. С.К. Семенова, Г.Г. Хрисанфова, В.А. Васильев, А.А. Лопаткин, А.В. Корсуненко, Е.В. Корчагина, А.П. Рысков. Молекулярная филогения и филогеография паразитических червей – трематод. Материалы V съезда Вавиловского Общества генетиков и селекционеров. Москва, 21-28 июня 2009, с. 301;

10. Корсуненко А.В., Хрисанфова Г.Г., Рысков А.П., Мовсесян С.О., Семенова С.К.

Разработка новой молекулярно-диагностической системы для детекции птичьих шистосом из рода Trichobilharzia (T. franki, T. szidati, T. regenti) на стадии моллюска хозяина. Материалы международной научной конференции «Теоретические и практические проблемы паразитологии», Москва, 30 ноября-3 декабря 2010, с. 181 183.

Регистрационные номера нуклеотидных последовательностей, депонированных в GenBank: GU980749–GU

 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.