авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Получение моноклональных антител и днк-аптамеров для идентификации энтерогеморрагических эшерихий o157 серогруппы

На правах рукописи

ЛУНЕВА Нина Михайловна ПОЛУЧЕНИЕ МОНОКЛОНАЛЬНЫХ АНТИТЕЛ И ДНК-АПТАМЕРОВ ДЛЯ ИДЕНТИФИКАЦИИ ЭНТЕРОГЕМОРРАГИЧЕСКИХ ЭШЕРИХИЙ O157 СЕРОГРУППЫ 03.02.03 микробиология 03.01.06 биотехнология (в том числе бионанотехнологии)

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Оболенск 2012

Работа выполнена в Федеральном бюджетном учреждении науки «Государственный научный центр прикладной микробиологии и биотехнологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека РФ Научные руководители:

доктор биологических наук, профессор Шемякин Игорь Георгиевич кандидат биологических наук Козырь Арина Владимировна

Официальные оппоненты:

Афанасьев Станислав Степанович, заслуженный деятель науки, доктор медицинских наук, профессор;

Федеральное бюджетное учреждение науки “Московский научно-исследовательский институт эпидемиологии и микробиологии им Г. Н. Габричевского” Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека РФ, заместитель директора по биотехнологии Светоч Эдуард Арсеньевич, доктор ветеринарных наук, профессор;

Федеральное бюджетное учреждение науки «Государственный научный центр прикладной микробиологии и биотехнологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека РФ, заведующий отделом молекулярной микробиологии

Ведущая организация: Федеральное казенное учреждение здравоохранения "Ставропольский научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека РФ

Защита состоится 21 декабря 2012 г. в 13 ч на заседании диссертационного совета Д 350.002.01 при Федеральном бюджетном учреждении науки «Государственный научный центр прикладной микробиологии и биотехнологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека РФ по адресу: 142279, Московская обл., Серпуховский р-н, п. Оболенск, ФБУН ГНЦ ПМБ).

С диссертацией можно ознакомиться в библиотеке Федерального бюджетного учреждения науки «Государственный научный центр прикладной микробиологии и биотехнологии» Автореферат разослан ноября 2012 г.

Ученый секретарь диссертационного совета Фурсова Надежда Константиновна ОБЩАЯ ХАРАКТЕРИСТИКА ДИССЕРТАЦИИ Актуальность темы. Острые кишечные инфекции (ОКИ) чрезвычайно широко распространенные в современном мире инфекционные заболевания человека.

Существенный удельный вес среди возбудителей ОКИ занимают патогенные Escherichia coli (Малый, 2011).

В последние несколько десятилетий наибольшую медицинскую и эпидемиологическую актуальность приобрела группа энтерогеморрагических эшерихий. Заболевание, вызванное энтерогеморрагическими эшерихиями, протекает тяжело и чревато развитием серьезного осложнения, представляющего реальную угрозу для жизни больного, гемолитического уремического синдрома (ГУС). При развитии ГУС острая почечная недостаточность наблюдается в 55–70% случаев, при этом смертность может составлять 3-7% (Banatvala et al., 2001).

Энтерогеморрагические эшерихии представлены различными серогруппами, наибольшее эпидемиологическое значение из которых имеет O157 серогруппа.

Ассоциированные с этой группой возбудителей заболевания регистрируются по всему миру, включая Россию (Степаншин и др., 2005;

Effler et al., 2001;

Allison, 2002;

Gillespie et al., 2005).

Отличительной чертой энтерогеморрагических эшерихий является продуцирование веротоксинов (шига-токсинов Stx1 и Stx2), являющихся основными факторами патогенности возбудителей данной группы (Rowe, 1993). При этом показано, что при заражении штаммами, продуцирующими только Stx2, развивается более тяжелая форма заболевания, чем при заражении штаммами, продуцирующими Stx1 или оба токсина одновременно (Kleanthous et al., 1990).

В настоящее время для идентификации энтерогеморрагических эшерихий О157 серогруппы на территории Российской Федерации используются различные методы исследования, в том числе бактериологические и серологические.

Бактериологический метод идентификации E. coli O157:H7 основан на отсутствии у возбудителя фермента бета-D-глюкуронидазы и неспособности ферментировать сорбитол в течение 24 часов.

Серологическая идентификация предусматривает выявление "О"- и "Н" антигенов в реакции агглютинации на стекле с поликлональными эшерихиозными сыворотками или латекс-агглютинации с использованием латексных частиц, также приготовленных на основе поликлональных сывороток (МУК 4.2.992-00, 2001).

Однако интенсивность выделения возбудителя от больных постепенно снижается в течение болезни, достигая 50% и более низкого уровня через 5-8 дней от начала заболевания (Begue, 1998). Гемолитический уремический синдром обычно развивается спустя, как минимум, одну неделю после первых признаков диареи, и вероятность выделения возбудителя к этому времени путем простого высева на дифференциально-диагностические среды существенно уменьшается.

Кроме того, необходимо отметить, что Е. coli О157 серогруппы имеют антигенное родство с другими эшерихиями, что в ряде случаев затрудняет их серологическую идентификацию при использовании диагностикумов на основе поликлональных сывороток.

Также необходимо отметить, что схема идентификации E. coli О157:H7/H- в настоящее время построена в основном на использовании диагностических препаратов производства зарубежных фирм (МУК 4.2.2963-11, 2011), что затрудняет их широкое применение в сети практических лабораторий.

Из всего выше сказанного можно сделать заключение, что на данный момент существует потребность в разработке современных отечественных препаратов для выделения и идентификации энтерогеморрагических эшерихий, разработанных на основе более стандартных и высокоспецифичных реагентов.

Повысить эффективность обнаружения, выделения и идентификации Е. coli О157 серогруппы можно путем предварительного селективного концентрирования микробных клеток возбудителя с помощью иммуномагнитной сепарации, а для разработки современных методов иммуноанализа в качестве альтернативы поликлональным сывороткам использовать моноклональные антитела (МКА).

Наравне с использованием моноклональных антител одним из перспективных направлений в области создания высокочувствительных диагностических тест-систем является применение в качестве специфических диагностических лигандов аптамеров одноцепочечных молекул нуклеиновых кислот, специфически связывающихся с мишенью за счет образования вторичных структур.

Анализ научно-технической и патентной литературы показал, что наиболее эффективным подходом к созданию высокочувствительных тест-систем на основе аптамеров является иммуно-аптамерная ПЦР (полимеразная цепная реакция), один из вариантов иммуно-ПЦР. Комбинация моноклональных антител и аптамеров, используемая в данном диагностическом методе позволяет выявлять целевой микроорганизм или его антигены с высокой специфичностью, а детекция с помощью ПЦР в режиме реального времени существенно увеличить чувствительность анализа по сравнению с классическим иммуноферментным анализом (ИФА).

В настоящее время зарубежными исследователями активно ведутся работы по получению аптамеров, специфичных к различным мишеням, в том числе к возбудителям инфекционных заболеваний (Camille et al., 2008;

Cao et al., 2009;

Duan et al., 2012;

Lee et al., 2012).

В России исследования по получению мишень-направленных аптамеров для диагностики возбудителей инфекционных заболеваний до настоящего времени не проводились, в то же время развитие данного направления может являться важным дополнением к разрабатываемым технологиям высокочувствительной экспресс диагностики.

Цель работы. Получение моноклональных антител и ДНК-аптамеров, перспективных для использования в качестве специфических лигандов в составе высокоэффективных отечественных диагностических тест-систем для выявления и идентификации энтерогеморрагических эшерихий О157 серогруппы и секретируемого фактора патогенности шига-токсина 2.

Задачи исследования:

1. Получение МКА к диагностически значимым антигенам E. coli серогруппы, отбор антител, перспективных для разработки O иммунодиагностических тест-систем.

2. Изучение свойств отобранных МКА, оценка их диагностической значимости с использованием различных форматов иммуноанализа: непрямого ИФА, «сэндвич» ИФА, дот-блот анализа, латекс-агглютинации, а также системы селективного концентрирования микробных клеток возбудителя с использованием магнитных частиц.

3. Получение аптамеров, специфичных в отношении микробных клеток E. coli O157 серогруппы, изучение их свойств.

4. Разработка диагностической тест-системы на основе иммуно-аптамерной ПЦР с использованием полученных моноклональных антител и аптамеров.

5. Разработка эффективной технологии отбора аптамеров к секретируемому фактору патогенности энтерогеморрагических эшерихий шига-токсину 2.

6. Получение аптамеров, специфичных в отношении секретируемого фактора патогенности энтерогеморрагических эшерихий шига-токсина 2 с применением разработанной технологии, изучение их свойств.

Научная новизна:

1. Впервые в мире предложена универсальная технология отбора аптамеров к рекомбинантным белкам на основе сконструированного химерного белка, содержащего целевой белок-мишень, последовательность глютатион-S-трансферазы для связывания белка на магнитных частицах с иммобилизованным глютатионом, и пептидный субстрат, содержащий уникальный сайт расщепления протеазой (летальным фактором Bacillus anthracis).

2. Определены первичные и вторичные структуры полученных ДНК-аптамеров, специфичных в отношении E. coli O157 серогруппы и шига-токсина 2.

Практическая значимость:

1. Получены и депонированы в Государственную коллекцию патогенных микроорганизмов и клеточных культур («ГКПМ-Оболенск») гибридомы-продуценты высокоспецифичных МКА к О-антигену энтерогеморрагических Е. coli О157 серогруппы.

2. Изготовлены экспериментальные образцы тест-системы в формате латекс агглютинации для выявления и идентификации энтерогеморрагических Е. coli О157 серогруппы, проведены их межлабораторные и комиссионные испытания.

3. Получены ДНК-аптамеры, высокоспецифичные в отношении микробных клеток E. coli O157 серогруппы, а также секретируемого фактора патогенности энтерогеморрагических эшерихий шига-токсина 2.

4. Оформлена заявка на Патент «Способ специфического отбора высокоаффинных молекул ДНК (ДНК-аптамеров) к рекомбинантным белкам» № 2012141216/10 (066419) от 27.09.2012.

Методы исследования. В исследовании использовались микробиологические (культивирование используемых в работе микроорганизмов, в том числе штаммов E. coli продуцентов рекомбинантных белков), биотехнологические (получение и культивирование гибридом, наработка МКА в асцитических жидкостях), иммунологические (ИФА, дот-блот анализ, латекс-агглютинация) и молекулярно генетические (методы ПЦР, конструирование экспрессионных векторов) методы.

Положения, выносимые на защиту:

1. Полученные МКА высокоспецифичны в отношении О-антигена энтерогеморрагических E. coli O157 серогруппы.

2. Диагностические тест-системы на основе полученных МКА обладают высокой специфичностью и чувствительностью определения;

максимальная чувствительность анализа (1104 м.к./мл) достигается при использовании системы селективного концентрирования микробных клеток возбудителя и последующей их детекцией в непрямом ИФА.

3. Полученный в результате отбора на микробные клетки E. coli O157:H ДНК-аптамер характеризуется высокой специфичностью в отношении мишени.

4. Разработанная тест-система на основе иммуно-аптамерной ПЦР обеспечивает специфическую детекцию микробных клеток E. coli O157 серогруппы с чувствительностью до 1103 м.к./мл.

5. Разработанная технология отбора аптамеров к рекомбинантным белкам позволяет избежать неспецифического отбора последовательностей, связывающихся с твердой фазой, таким образом, повышая эффективность отбора.

6. ДНК-аптамер, полученный с применением разработанной технологии, характеризуется высокой специфичностью в отношении секретируемого фактора патогенности энтерогеморрагических эшерихий шига-токсина 2 и может применяться в качестве специфического лиганда в составе диагностических тест систем.

Личный вклад соискателя. Экспериментальные результаты, представленные в диссертации, получены лично автором в сотрудничестве, главным образом, с к.б.н.

А.В. Козырь, к.б.н. А.В. Колесниковым, к.б.н. Е.В. Беловой, д.б.н., проф.

И.Г. Шемякиным. В исследованиях также принимали участие к.б.н.

Р.М. Шайхутдинова, А.Е. Хлынцева, О.Н. Красавцева. На защиту вынесены только те положения и результаты экспериментов, в получении которых роль автора была определяющей.

Апробация работы. Материалы диссертации доложены и представлены на:

Научно-практической конференции МУиС Роспотребнадзора, ФГУН ГНЦ ПМБ, «Биологическая безопасность в современном мире» (Оболенск, 2009);

Десятой юбилейной научно-практической конференции молодых ученых «Актуальные вопросы клинической и экспериментальной медицины» (Санкт-Петербург, СПбМАПО, 2010);

Научно-практической школе-конференции МУиС научно исследовательских организаций Роспотребнадзора «Современные технологии обеспечения биологической безопасности» (Оболенск, 2010);

VII Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика – 2010» (Москва, 2010);

IV Международной научной заочной конференции «Научные достижения биологии, химии и медицины в сфере экологии, здоровья и качества жизни человека» (Москва, 2012), III Международной научно практической конференции «Современная медицина и фармацевтика: анализ и перспективы развития» (Москва, 2012);

12-ой Международной конференции «Nutrition & Diagnostics» (Прага, 2012), V Международной научно-практической конференции «Современная медицина и фармацевтика: анализ и перспективы развития» (Москва, 2012), 5-й Международной конференции «Baltic Meeting on Microbial Carbohydrates» (Суздаль, 2012).

План и аннотация диссертации обсуждены и одобрены на заседании Ученого совета ГНЦ ПМБ 28 января 2010 г., протокол № 1., с изменениями, утвержденными Ученым советом от 19 ноября 2012 г., протокол № 11.

Результаты исследований доложены на заседании межлабораторного научного семинара ГНЦ ПМБ 9 ноября 2012 г., протокол № 26.

Публикации. Основное содержание работы

отражено в 11 научных публикациях, в том числе в одной статье, опубликованной в рецензируемом журнале, рекомендованном ВАК, и в одном Патенте РФ на изобретение (Заявка № 2012141216/10 (066419) от 27.09.2012).

Объем и структура диссертации. Диссертация изложена на 157 страницах машинописного текста и включает следующие разделы: введение, обзор литературы, материалы и методы исследования, результаты исследования с их обсуждением, заключение, выводы, список сокращений, список литературы, включающий 22 работы отечественных и 228 – зарубежных авторов, и благодарности.

Работа иллюстрирована 18 рисунками и 16 таблицами.

СОДЕРЖАНИЕ ДИССЕРТАЦИОННОГО ИССЛЕДОВАНИЯ Материалы и методы исследования Штаммы микроорганизмов. В работе использовались штаммы E. coli O157 серогруппы (E. coli O157:H7/H-), штаммы E. coli других серогрупп и гетерологичных микроорганизмов, полученные из Государственной коллекции патогенных микроорганизмов и клеточных культур («ГКПМ-Оболенск») ФБУН ГНЦПМБ и из Коллекции музея живых культур Иркутского НИПЧИ Сибири и Дальнего востока. В работе использовались клинические и выделенные от сельскохозяйственных животных штаммы E. coli O157:H7, любезно предоставленные д.в.н., профессором Э.А. Светочем.

Получение МКА. Гибридизацию осуществляли по стандартному протоколу (Khler et al, 1975). Первичный скрининг гибридных клонов осуществляли в непрямом ИФА (Егоров и др., 1991). Наработку МКА проводили in vivo, на мышах линии BALB/с. Очистку моноклональных антител осуществляли на основании данных о принадлежности МКА к определенному классу иммуноглобулинов: G или М: на колонке с белком G-сефарозой или c субстратом DEAE (Amersham, Швеция).

Характеристика МКА. Подклассы моноклональных антител определяли с помощью стрипов «IsoQuickTM Strips for Mouse Monoclonal Isotyping» (Roche Diagnostic Corporation, Германия). Константы аффинности МКА рассчитывали по методу Beatty (Beatty et al, 1987). Молекулярные массы легких и тяжелых цепей иммуноглобулинов определяли в ПААГ-электрофорезе (в полиакриламидном геле) в денатурирующих условиях. Подбор диагностически значимых пар МКА осуществляли в «сэндвич»-ИФА, биотинилирование антител проводили по методу Duk (Duk et al., 1994).

Для разработки системы селективного концентрирования микробных клеток E. coli O157 серогруппы на основе магноиммуносорбентов методом перйодатного окисления (Nakane, 1974) получали конъюгаты пероксидазы хрена со специфическими антителами. Для получения магноиммуносорбентов (МИС) МКА иммобилизовали на магнитных частицах на основе оксида железа с алюмосиликатом, активированных полиглюкином (Пат. РФ № 2138813, 1999). Учет результатов производили с помощью планшетного спектрофотометра xMark (Bio-Rad, США) при длине волны 492 нм.

Для разработки тест-системы для определения Е. coli О157 серогруппы в реакции латекс-агглютинации МКА иммобилизовали на латексных частицах, синтезированных в Институте биоорганической химии им. акад. М.М. Шемякина и Ю.А. Овчинникова РАН, согласно протоколу производителя. Постановку реакции осуществляли в 96-ти луночных V-образных планшетах (Greiner, Германия).

Для получения аптамеров исходную комбинаторную библиотеку ДНК синтезировали в ЗАО «Евроген» (Россия) по заказу ФБУН ГНЦ ПМБ. Библиотека имела следующую последовательность: 5’CATACGTTCGACTGCTAC N GTGAGATGTACAGACTAG, где N45 вариабельная область, состоящая из 45 нуклеотидов.

Получение рекомбинантной В-субъединицы шига-токсина 2. ДНК штамма Е. coli О157:Н7 5999 амплифицировали с использованием праймеров, специфичных к 5’- и 3’-концам кодирующей области stxB2 и клонировали в экспрессионный вектор на основе pET-HIS (Пат. РФ № 2361921, 2007). Рекомбинантный белок продуцировали в Е. coli BL21(DE3) и очищали с помощью металл-хелатной хроматографии.

Отбор аптамеров осуществляли по технологии SELEX (Tuerk et al, 1990).

Соотношение микробных клеток Е. coli О157:Н7 с исходной библиотекой ДНК составляло 1106 молекул ДНК на 1 микробную клетку. Связавшиеся с микробными клетками последовательности ДНК амплифицировали с использованием прямого 5’-(6-карбоксифлюоресциин, FAM) cat-acg-ttc-gac-tgc-tac и обратного 5’-(P) cta-gtc праймеров. Фосфорилированную цепь ДНК расщепляли tgt-aca-tct-cac 5’-экзонуклеазой фага лямбда в течение 1 часа при 37С. Получение одноцепочечных молекул ДНК контролировали в 10% ПААГ-электрофорезе (в полиакриламидном геле) с мочевиной. Для получения индивидуальных последовательностей аптамеры клонировали в стандартный вектор pBluescriptII SK-) (Novagen, Германия).

Оценку эффективности связывания аптамеров с мишенью и их специфичности осуществляли с помощью анализа, аналогичного ИФА с использованием биотинилированных аптамеров, амплифицированных с использованием прямого праймера 5’-(FAM-spacer 9-biotin-spacer 9) cat-acg-ttc-gac tgc-tac, и конъюгата нейтравидин-пероксидазы хрена (Pierce, США). Концентрация аптамеров для проведения анализа составляла 0,5 мкг/лунку.

Для конструирования химерного белка использовали вектор на основе pET-GST (Пат. РФ № 2355769, 2007). Конструкт создавали последовательным встраиванием последовательностей, кодирующих глютатион-S-трансферазу, линкерную последовательность, являющуюся субстратом для летального фактора (LF) B. anthracis (пептид RRKKVYPYPMK), В-субъединицу Stx2.

Иммуно-аптамерная ПЦР. Для проведения анализа использовали МИС на основе МКА 13Е8 и ДНК-аптамер в качестве специфических лигандов для связывания микробных клеток E. coli O157 серогруппы. Детекцию образовавшегося комплекса осуществляли методом ПЦР в режиме реального времени (ПЦР-РВ) с использованием набора реагентов для проведения ПЦР-РВ в присутствии SYBR Green I (Синтол, Россия).

Определение структуры аптамеров. Определение первичной структуры аптамеров методом капиллярного секвенирования осуществлялось компанией ЗАО «Евроген». Анализ вторичных структур аптамеров проводили с помощью алгоритма – «GeneBee RNA secondary structure prediction».

Результаты исследования и обсуждение Получение высокоспецифичных МКА Одной из задач в ходе проводимого нами исследования являлось получение стабильных гибридных клонов, продуцирующих моноклональные антитела (МКА) к возбудителям энтерогеморрагического колита E. coli O157 серогруппы, перспективные для использования в качестве компонентов иммунодиагностических тест-систем. В соответствии с поставленной задачей МКА получали к поверхностным антигенам данного микроорганизма, а именно к О-антигену, определяющему серогрупповую принадлежность возбудителя.

Всего в ходе работ было получено 7 стабильных гибридных клонов, продуцирующих МКА к микробным клеткам E. coli O157:H7. Исследование специфической активности МКА в дот-блот анализе показало, что 3 из 7 антител 5D7, 13E8, 15G7 специфически взаимодействуют со штаммами E. coli O157:H7/H- и не проявляют перекрестной активности в отношении штаммов E. coli других серогрупп и гетерологичных микроорганизмов (таблица 1). Данные МКА были отобраны для дальнейшей работы и детально охарактеризованы: определены подклассы иммуноглобулинов, массы легких и тяжелых цепей, антигенная специфичность, а также константы аффинности антител по отношению к микробным клеткам E. coli O157:H7 (рисунок 1).

Было установлено, что все 3 МКА относятся к подклассу иммуноглобулинов G1, молекулярные массы тяжелых цепей МКА 5D7 и МКА 13Е8 составляют 53 кДа, МКА 15G7 52 кДа. Молекулярные массы легких цепей МКА 5D7 и МКА 13Е составляют 23 кДа, МКА 15G7 22 кДа. Установлено, что более высокой аффинностью по отношению к микробным клеткам Е. coli О157:H7 обладает МКА 13Е8 – (1,6 0,12) 109 М-1, константы аффинности МКА 5D7 и МКА 15G7 имели более низкое значение - (2,40,31) 107 и (3,10,18) 108 М-1 соответственно.

Специфичность МКА 5D7, 13Е8 и 15G7 в отношении антигена, с которым происходит их связывание, подтверждали методом иммуноблоттинга с препаратом липополисахарида (ЛПС) Е. coli О157:Н7. В результате было установлено, что на блоте все МКА выявляют характерную для О-цепи ЛПС «лестницу» в районе 43-55 кДа.

Диагностическую значимость полученных МКА оценивали с использованием методов иммуноанализа, получивших в настоящее время наибольшее распространение в диагностике энтерогеморрагических эшерихий О157 серогруппы: ИФА, дот-блот анализа, системы селективного концентрирования микробных клеток возбудителей на основе магноиммуносорбентов и последующей детекцией в ИФА, а также латекс агглютинации (таблица 2).

Одним из вариантов твердофазного иммуноферментного анализа для детекции возбудителей инфекционных заболеваний является «сэндвич»-ИФА. К преимуществам данного метода можно отнести то, что выявление микробных клеток возбудителя или целевых антигенов осуществляется с использованием двух специфических антител (связывающих и детектирующих), что значительно уменьшает вероятность возникновения ложноположительных результатов. Для подбора оптимальных пар антител каждое из них испытывали в «сэндвич»-ИФА в качестве связывающего и детектирующего. Было установлено, что оптимальными парами МКА, обеспечивающими при совместном использовании наибольшую чувствительность определения микробных клеток Е. coli О157 серогруппы (1105 м.к./мл) являются пары 5D7 + 13Е8 и 13Е8 + 13Е8. Пару МКА 5D7 + 13Е8 в дальнейшем использовали для разработки системы селективного концентрирования микробных клеток возбудителя на основе магноиммуносорбентов.

Таблица 1 Изучение специфической и перекрестной активности МКА методом дот-блот анализа МКА Штамм микроорганизма 1106 м.к./мл 13Е 2G11 10F4 12D2 13F 5D7 15G Е. coli О157:Н7 5168 ++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 5999 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6025 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6030 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6032 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6036 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6222 +++ +++ +++ +++ +++ +++ ++ Е. coli О157:Н7 6225 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6226 +++ +++ +++ +++ +++ +++ ++ Е. coli О157:Н7 6241 +++ +++ +++ +++ +++ +++ +++ Е. coli О157:Н7 6246 +++ +++ +++ +++ +++ +++ ++ E. coli О157:H- +++ +++ +++ +++ +++ +++ +++ Е. coli О6 Е. coli О111 168/ Е. coli О55 3912/ Е. coli О55 Е. coli О86 Orskow Е. coli Ewing 227 ++ ++ Е. coli Salmonella enteritidis 11272 +++ +++ +++ Salmonella typhi Salmonella typhimurium 79 +++ Salmonella paratyphi A Shigella dysenteriae Shigella flexneri Shigella sonnei Yersinia enterocolitica Yersinia pseudotuberculosis III Brucella abortus Vibrio cholerae non O1 9741-P Campylobacter jejuni Л- Proteus vulgaris Примечание: (+++) высоко интенсивное окрашивание;

(++) – слабое окрашивание;

() отсутствие окрашивания Рисунок 1 Характеристика моноклональных антител: А. Определение молекулярной массы легких и тяжелых цепей МКА (М маркер молекулярного веса);

Б. Результаты анализа по определению подклассов МКА с помощью иммунохроматографических стрипов;

В. Определение антигенной специфичности МКА Таблица 2 Оценка диагностической значимости полученных МКА Формат иммуноанализа МКА Непрямой Дот-блот Латекс- Магнитная «сэндвич»-ИФА ИФА анализ агглютинация сепарация Пара МКА м.к./мл (м.к./мл) (м.к./мл) (м.к./мл) (м.к./мл) 5D7 + 5D 5D 1105 1105 2,5105-1106 5D7 + 13Е8 5D7 + 15G 13Е8 13Е8 + 13Е8 1105 1105 2,5105-1106 13Е8 + 5D7 13Е8 + 15G7 15G7 + 15G 5105 5105 5105-1106 15G7 15G7 + 5D 15G7 + 13Е8 Чувствительность и специфичность тест-систем оценивали в ходе лабораторных испытаний со штаммами Е. coli О157:Н7/H- в концентрациях от до 1103 м.к./мл, а также со штаммами Е. coli других серогрупп и гетерологичных микроорганизмов в концентрации 1107 м.к./мл.

В результате было установлено, что все тест-системы специфически выявляли штаммы Е. coli О157:Н7/H- и не проявляли перекрестной реактогенности в отношении других исследованных микроорганизмов, при этом наибольшая чувствительность определения микробных клеток возбудителей (1104 м.к./мл) достигалась при использовании тест-системы на основе магноиммуносорбентов.

Эффективность тест-системы в формате латекс-агглютинации также была подтверждена в ходе межлабораторных и комиссионных испытаний. На тест-систему был разработан комплект нормативной документации, включающий инструкцию по применению и технические условия (ТУ 9388-114-78095326-2010).

Таким образом, в ходе проведенных работ было показано, что полученные к О-антигену Е. coli О157 серогруппы моноклональные антитела обладают характеристиками, позволяющими с высокой эффективностью использовать их в качестве компонентов современных высокоспецифичных иммунодиагностических тест-систем для выявления микробных клеток возбудителей данной серогруппы.

Получение ДНК-аптамеров Вторым направлением нашего исследования являлось получение ДНК-аптамеров, перспективных для выявления и идентификации микробных клеток энтерогеморрагических Е. coli О157 серогруппы и шига-токсина 2 в составе диагностических тест-систем.

Отбор аптамеров осуществляли по технологии SELEX (systematic evolution of ligands by exponential enrichment), являющейся одним из подходов к скринингу комбинаторных библиотек, и состоящей из последовательных раундов отбора.

Каждый раунд включал в себя: 1) инкубацию библиотеки ДНК с мишенью;

2) амплификацию связавшихся (в случае позитивного отбора) или не связавшихся (в случае негативного отбора) с мишенью последовательностей методом ПЦР;

3) получение одноцепочечных молекул ДНК с помощью 5’-экзонуклеазы фага лямбда для проведения следующего раунда.

Для амплификации библиотеки на раундах отбора использовали модифицированные праймеры, один из которых содержал на 5’- конце 6-карбоксифлюоресцеин (FAM), а второй фосфатную группу. Данная модификация праймеров позволяла электрофоретически контролировать расщепление фосфорилированной цепи ДНК 5’-экзонуклеазой фага лямбда и получение одноцепочечных последовательностей ДНК (рисунок 2).

М 1 2 Рисунок 2 10% ПААГ-электрофорез ПЦР-продуктов и одноцепочечной ДНК, полученных в раунде отбора аптамеров (окрашивание бромистым этидием):

М – маркер молекулярной массы с шагом 50 пар нуклеотидов (New England Biolabs, США);

1 – супернатант, полученный после последней промывки микробных клеток со связавшимися аптамерами;

2 – двухцепочечный продукт ПЦР-амплификации аптамеров, связавшихся с микробными клетками;

3 – одноцепочечная ДНК, образующаяся в результате обработки двухцепочечного ПЦР-продукта 5’-экзонуклеазой фага лямбда Отбор аптамеров к микробным клеткам Е. coli О157:Н Для получения аптамеров использовали инактивированную культуру Е. coli О157:Н7 5999 в концентрации 1108 м.к./мл на каждом раунде позитивного отбора. Негативный отбор проводили со штаммами E. coli O6 25922 АТСС, E. coli O55 3912/41, Shigella dysenteriae 1362, Salmonella typhi 13311 ATCC, Yersinia enterocolitica var. 1 Красноярск-6, Yersinia pseudotuberculosis III 1 в той же концентрации.

Всего было проведено 14 раундов отбора и получено 46 клонов, содержащих индивидуальные аптамерные последовательности.

Специфичность полученных аптамеров и эффективность их связывания с микробными клетками E. coli O157:H7 исследовали косвенным методом, аналогичном ИФА, с использованием вместо антител биотинилированных аптамеров и конъюгата нейтравидин-пероксидаза хрена.

Для проведения анализа по оценке эффективности связывания 96-ти луночные планшеты сенсибилизировали серийными разведениями инактивированной культуры Е. coli О157:Н7 с пятикратным шагом (от 5107 м.к./мл до 1104 м.к./мл).

В результате анализа было установлено, что наибольшая чувствительность определения микробных клеток E. coli O157:H7 (1106 м.к./мл) обеспечивалась при использовании в качестве детектирующего лиганда аптамера № 14. Данный аптамер был отобран для дальнейшего исследования.

Специфичность отобранного аптамера исследовали со штаммами E. coli O157:H7/H-, штаммами E. coli других серогрупп и гетерологичных микроорганизмов в концентрации 1106 м.к./лунку (таблица 3).

Таблица 3 Оценка специфичности ДНК-аптамера, полученного в результате отбора на микробные клетки E. coli O157:H Значение оптической плотности Штамм микроорганизма при длине волны 492 нм E. coli O157:H7 5168 0, E. coli O157:H7 5999 0, E. coli O157:H7 6036 0, E. coli O157:H- 0, Препарат ЛПС E. coli O157:H7 1, E. coli O6 25922 АТСС 0, E. coli O55 3912/41 0, Sh. dysenteriae 1362 0, S. typhi 13311 ATCC 0, Y. enterocolitica var. 1 Красноярск-6 0, Y. pseudotuberculosis III 1 0, Отрицательный контроль 1 0, (без микробных клеток) Отрицательный контроль 2 0, (без аптамеров) Было установлено, что полученный аптамер специфичен в отношении штаммов E. coli O157:H7/H- и не проявляет перекрестной активности в отношении других исследованных микроорганизмов.

Взаимодействие аптамера с микробными клетками E. coli O157:H- с той же эффективностью, что и со штаммами E. coli O157:H7 позволило нам предположить, что мишенью ДНК-аптамера является общий для штаммов E. coli O157 серогруппы компонент клеточной стенки, а именно липополисахарид, что объясняется превалированием структур ЛПС над уникальными минорными компонентами белковой природы у грамотрицательных бактерий. Анализ специфичности аптамера с использованием препарата ЛПС E. coli O157:H7 (1 мкг/лунку) подтвердил данное предположение (таблица 3).

Отбор аптамеров к шига-токсину Основными факторами патогенности энтерогеморрагических эшерихий являются секретируемые ими шига-токсины 1 и 2 типа Stx1 и Stx2. Так как токсичность шига-токсина 2 типа в сотни раз превышает токсичность шига-токсина 1 типа, а штаммы E. coli O157 серогруппы, продуцирующие Stx2, чаще всего индуцируют развитие ГУС у человека (Louise et al, 1995), предпочтительнее было получить аптамеры, специфичные именно к этому типу токсина.

В связи с тем, что нативный Stx2 является высокотоксичным веществом, для отбора аптамеров мы использовали рекомбинантный белок, полученный генно инженерными методами, а именно рецепторную B-субъединицу шига-токсина, не обладающую токсичностью. В отличие от рецепторной B-субъединицы эффекторная А-субъединица обладает сильным токсическим действием, в том числе, в отношении микробных клеток штаммов-продуцентов, что затрудняет ее получение в достаточных для исследовательских целей количествах. Внесение же в ее последовательность инактивирующих мутаций может привести к отбору аптамерных последовательностей, не способных узнавать нативный токсин.

Одной из проблем, возникающих при получении аптамеров к мишеням, представляющих собой растворимые антигены белковой природы, является эффективное разделение специфических аптамеров и неспецифических последовательностей. Необходимость иммобилизовать мишень на твердой фазе для последующего удаления несвязавшихся или низкоаффинных молекул ДНК может привести к параллельному накоплению в пуле аптамеров последовательностей, специфичных в отношении носителя. Существующий метод капиллярного электрофореза, позволяющий проводить отбор аптамеров без использования твердой фазы за счет различий в подвижности комплекса мишень-аптамер, несвязанных аптамеров и мишеней (Mosing et al, 2009), не всегда позволяет эффективно производить разделение образовавшихся комплексов и свободных молекул, так как не все варианты комплексов аптамер-мишень обеспечивают значительное изменение электрофоретической подвижности. Кроме того, данный метод требует сложного контроля ряда важных параметров селекции, таких как ужесточение условий формирования комплекса. В связи с этим, разработка технологии, обеспечивающей эффективное разделение специфических аптамеров и неспецифических последовательностей, является актуальной проблемой.

Для решения данной проблемы был сконструирован химерный белок, состоящий из последовательности глютатион-S-трансферазы (GST), линкерной последовательности (RRKKVYPYPMЕ), являющейся специфическим субстратом металло-протеазы летального фактора B. anthracis, и последовательности целевого белка В-субъединицы Stx2 (рисунок 3).

сайт убит Последовательность глютатион-S BglII Xba I NdeI tct ttt ggt ggt tctaga cat atg tcc cct ata cta ggt tat tgg aaa -трансферазы BglII G G G S G R RK K V ggc gac cat cct ccg aaa tc a gat ct ggt ggc ggt agc ggt cgc cgt aag aaa gtt сайт убит пептид c-myc Y P Y P M E BglII/BamHI HindIII atc tcc gaa gag gac ctg ga tac ccg tat ccg atg gaa aag ctt g gat ct g gaa cag Последовательность StxB BamHI XhoI gct agc atg act ggt ggc cac g agc tc g gat cc gaa gtg cag ttt aat aat gac Hisх6 STOP cac cac cac cac cac cac tga Рисунок 3 Последовательность экспрессионной конструкции плазмиды, кодирующей химерный белок для отбора аптамеров Полученный рекомбинантный белок иммобилизовали на магнитных частицах, сенсибилизированных глютатионом (Thermo Scientific, США), за счет высокого сродства глютатион-S-трансферазы к восстановленному глютатиону. Иммобилизация белка на магнитных частицах позволяла при помощи постоянного магнита удалять не связавшиеся с мишенью последовательности.

После инкубации магнитных частиц с библиотекой олигонуклеотидов, целевой белок (B-субъединицу шига-токсина 2) со связавшимися специфическими аптамерами «отрезали» от остальной части конструкта при помощи металло-протеазы рекомбинантного летального фактора B. anthracis (Патент РФ № 2355769, 2009). С помощью магнита твердую фазу с неспецифическими последовательностями отделяли от раствора, содержащего целевой белок с аптамерами.

Амплификацию последовательностей ДНК на раундах отбора и получение одноцепочечных молекул ДНК осуществляли аналогично способу, используемому при отборе аптамеров, специфичных к микробным клеткам E. coli O157 серогруппы.

С использованием данной технологии, было проведено 6 раундов отбора и получено 23 клона аптамеров, специфичных в отношении B-субъединицы шига-токсина 2.

Эффективность связывания полученных аптамеров с B-субъединицей шига-токсина 2, как и для аптамеров, специфичных в отношении микробных клеток Е. coli О157 серогруппы, определяли косвенным методом в анализе, аналогичном ИФА. Для проведения анализа использовали серийные разведения химерного белка содержащего последовательность StxB2 (от 1 мкг до 0,16 нг с пятикратным шагом), иммобилизованные на планшетах с глютатионом (Thermo Scientific, США). Анализ показал, что наибольшая чувствительность определения мишени (8 нг/мл) достигается при использовании в качестве детектирующего лиганда биотинилированного аптамера № 2.

Изучение специфичности данного аптамера проводили при помощи панели рекомбинантных белков, полученных нами в ходе предыдущих работ (таблица 4).

Таблица 4 Оценка специфичности ДНК-аптамера, полученного в результате отбора на В-субъединицу шига-токсина Рекомбинантный Значение Рекомбинантный Значение белок оптической белок оптической (10 мкг/мл) плотности при (10 мкг/мл) плотности при длине волны длине волны 492 нм 492 нм дифтерийный В-субъединица Stx2 0, 0, токсин металло-бета- белок yahA 0,277 0, лактамаза IMP- летальный фактор белок BCL- 0,253 0, B. anthracis B.anthracis протективный белок EA 0,255 0, антиген B. anthracis B.anthracis листериолизин Отрицательный 0,275 0, контроль Было установлено, что полученный аптамер не проявляет неспецифической активности в отношении исследованных пептидов и, таким образом, является перспективным кандидатом для разработки на его основе диагностических тест систем для выявления шига-токсина 2 в клинических образцах (фекалиях, моче) и в пищевых продуктах. Кроме того, так как шига-токсины являются основными факторами патогенности энтерогеморрагических эшерихий и определяют принадлежность возбудителей к данной группе энтеропатогенных E. coli, наличие специфического аптамера к шига-токсину позволит проводить диагностику возбудителей энтерогеморрагического колита независимо от их серогруппы, а также проводить дифференциацию патогенных от непатогенных штаммов, не продуцирующих токсины.

Определение структуры аптамеров Определение первичной структуры полученных аптамеров методом капиллярного секвенирования осуществлялось компанией ЗАО «Евроген» по заказу ФБУН ГНЦ ПМБ (рисунки 4, 5). Цветом выделены фланкирующие константные последовательности.

5’CATACGTTCGACTGCTACACGGTGGTGATATGCTCCGCGCGGGTCACGCACGGT CACTCCTTCGTGAGATGTACAGACTAG Рисунок 4 Последовательность ДНК-аптамера, специфичного в отношении микробных клеток E. coli O157 серогруппы 5’CATACGTTCGACTGCTACACGTGCCATCGCGGGCCCGATTCCATGGAACT GTCGGTTGTAGTCGTGAGATGTACAGACTAG Рисунок 5 Последовательность ДНК-аптамера, специфичного в отношении шига-токсина Вторичные структуры аптамеров рассчитывали с помощью алгоритма – «GeneBee RNA secondary structure prediction» (рисунки 6, 7).

Рисунок 6 Вторичная структура ДНК-аптамера, специфичного в отношении микробных клеток E. coli O157 серогруппы Рисунок 7 Вторичная структура ДНК-аптамера, специфичного в отношении шига-токсина Оба полученных аптамера имеют форму «шпильки», что характерно в целом для ДНК-аптамеров (Кульбачинский, 2006). Дальнейшее изучение структуры аптамеров, в том числе определение консервативных структур, ответственных за связывание, на основе данных геномного секвенирования отобранного пула последовательностей и селекция оптимизированных вариантов последовательностей, позволит повысить аффинность отобранных аптамеров и специфичность связывания мишени.

Разработка иммуно-аптамерной ПЦР для идентификации микробных клеток E. coli O157 серогруппы Наличие двух специфически связывающихся с микробными клетками E. coli O157 серогруппы лигандов моноклонального антитела и ДНК-аптамера позволило нам реализовать один из современных подходов к детекции возбудителей инфекционных заболеваний, иммуно-аптамерную ПЦР в «сэндвич»-варианте. В качестве связывающего компонента использовали МКА 13Е8, обладающее наибольшей аффинностью в отношении микробных клеток возбудителя, в качестве детектирующего биотинилированный аптамер № 14.

Иммуно-аптамерная ПЦР включала в себя следующие стадии:

1) иммобилизацию специфического МКА на твердой фазе (магнитных частицах);

2) блокировку свободных сайтов связывания инертным белком;

3) связывание мишени с твердой фазой и со специфическим аптамером;

4) детекцию образовавшегося комплекса с помощью ПЦР в реальном времени (ПЦР-РВ).

Наиболее распространенными способами детекции сигнала в ПЦР-РВ являются регистрация накопления флуоресценции с применением интеркалирующего красителя SYBR Green I или с использованием флуоресцентного зонда по методу TaqMan. Однако в случае иммуно-аптамерной ПЦР применение метода TaqMan затруднено, так как необходимость введения в последовательность детектирующих аптамеров участка для отжига зонда TaqMan может существенно нарушить их структуру и повлиять на эффективность связывания с мишенью. Поэтому в нашей работе мы использовали краситель SYBR Green I.

В качестве мишени использовали серийные разведения инактивированных культур Е. coli О157:Н7/H- с десятикратным шагом от 1106 м.к./мл до 1101 м.к./мл.

Специфичность анализа оценивали при помощи штаммов E. coli других серогрупп, а также гетерологичных микроорганизмов. Результаты анализа представлены на рисунке 8 и в таблице 5.

Рисунок 8 Результаты детекции микробных клеток E. coli O157:H7/H методом иммуно-аптамерной ПЦР: 1-6 1106, 1105, 1104, 1103, 1102, м.к./мл, 7 отрицательный контроль (реакция ПЦР-РВ без добавления аптамера) Таблица 5 Циклы ПЦР-амплификации при анализе перекрестной активности тест-системы на основе иммуно-аптамерной ПЦР Штаммы микроорганизмов Концентрация исследуемых микроорганизмов, м.к./мл 110 1105 1104 1103 1102 Циклы ПЦР E. coli O157:H7 1282 ГИСК 13 17 22 24 27 (положительный контроль) E. coli О6 25922 ATCC 27 27 27,9 28,1 28,8 28, E. coli О55 3912/41 27,2 27,7 28,2 28,1 28,2 28, S. enteritidis var. Issat 2 27,2 27,9 28,6 28,4 28,0 28, Sh. dysenteriae 1362 27,7 27,5 28,3 28,3 28,5 28, Sh. flexneri 4888 28,3 28,1 28,0 28,3 28,6 29, Sh. sonnei 4385 27,3 28,0 27,3 27,5 28,2 28, V. cholerae non O1 9741-P 28,2 28,2 28,1 28,2 28,1 29, В результате проведенного анализа было установлено, что тест-система на основе иммуно-аптамерной ПЦР выявляет микробные клетки E. coli O157:H7/H- в концентрациях 1103 м.к./мл и выше и не проявляет неспецифической активности в отношении E. coli других серогрупп и гетерологичных микроорганизмов.

Заключение Таким образом, в рамках данной работы были реализованы все поставленные задачи и достигнута главная цель: получены высокоспецифичные моноклональные антитела к О-антигену E. coli O157 серогруппы, а также аптамеры, специфичные в отношении микробных клеток E. coli O157 серогруппы и шига-токсина 2.

На основе полученных МКА и аптамеров были разработаны и испытаны диагностические тест-системы для идентификации возбудителя энтерогеморрагического колита, в том числе и тест-система нового поколения – иммуно-аптамерная ПЦР, характеризующаяся высокой чувствительностью, специфичностью и экспрессностью.

Внедрение диагностических тест-систем на основе аптамеров в лабораторную и клиническую практику будет способствовать развитию системы мониторинга и оптимизации диагностических мероприятий, направленных на борьбу с инфекционными заболеваниями, обеспечивая эффективное определение возбудителей особо опасных инфекций в окружающей среде и продуктах питания.

ВЫВОДЫ 1. Получены высокопродуктивные стабильные гибридомы, продуцирующие моноклональные антитела к О-антигену E. coli O157 серогруппы. Изучены биохимические характеристики продуцируемых МКА (специфичность, аффинность, подклассовая принадлежность). Определены диагностически значимые пары антител, обеспечивающие наибольшую чувствительность определения целевого антигена.

2. С использованием полученных МКА разработаны иммунодиагностические тест-системы для идентификации микробных клеток E. coli O157 серогруппы на основе ИФА, дот-блот анализа, латекс-агглютинации и системы селективного концентрирования с использованием магноиммуносорбентов, обеспечивающей наибольшую чувствительность определения (до 1104 м.к./мл). Все тест-системы успешно прошли лабораторные испытания. Эффективность тест-системы в формате латекс-агглютинации также была подтверждена в ходе межлабораторных и комиссионных испытаний.

3. Получен ДНК-аптамер, характеризующийся высокой специфичностью в отношении микробных клеток E. coli O157 серогруппы. Изучены его индивидуальные свойства (специфичность, эффективность связывания с мишенью, первичная и вторичная структура).

4. С применением полученных МКА и ДНК-аптамера разработана высокочувствительная тест-система на основе иммуно-аптамерной ПЦР, выявляющая микробные клетки E. coli O157 серогруппы в концентрации до 1103 м.к./мл.

5. Разработана технология отбора аптамеров на рекомбинантные белки, позволяющая с высокой эффективностью без применения жестких условий удалять неспецифические последовательности, связывающиеся с твердой фазой, на которой иммобилизован белок-мишень.

6. Полученный с применением разработанной технологии отбора ДНК-аптамер характеризуются высокой специфичностью в отношении секретируемого фактора патогенности энтерогеморрагических эшерихий шига-токсина 2, и может использоваться в качестве специфического лиганда в составе диагностических тест систем.

По теме диссертации опубликованы следующие работы:

а) статьи в научных журналах, рекомендованных ВАК 1. Лунева, Н.М. Разработка латексного диагностикума на основе моноклональных антител для идентификации энтерогеморрагической E. coli О серогруппы / Н.М. Лунева, Р.З. Шайхутдинова, Е.В. Белова, И.Г. Шемякин // Биотехнология. № 5. С. 85-92.

б) патенты 2. Заявка 2012141216/10 (066419) Российская Федерация, МПК8 C07H 21/04.

Способ специфического отбора высокоаффинных молекул ДНК (ДНК-аптамеров) к рекомбинантным белкам / А.В. Козырь, А.В. Колесников, Н.M. Лунева, A.E. Хлынцева, И.Г. Шемякин;

заявитель ФБУН ГНЦ ПМБ. № 2012141216/ (066419);

заявл. 27.09.2012;

приоритет 27.09.2012. 21 с. : ил.

с) тезисы научных конференций 3. Лунева, Н.М. Моноклональные антитела к E. coli O157:H7 как основа для создания диагностического комплекса / Н.М. Лунева, Е.В. Белова, И.Г. Шемякин // Биологическая безопасность в современном мире: Материалы научно-практической школы-конференции научно-исследовательских учреждений Роспотребнадзора / Под ред. Г.Г. Онищенко, И.А. Дятлова. Оболенск, 2009. С. 134-135.

4. Лунева, Н.М. Моноклональные антитела к E. coli О157:Н7, перспективные для создания диагностических тест-систем / Н.М. Лунева, Ю.Г. Степаншин, Е.В. Белова // Актуальные вопросы клинической и экспериментальной медицины:

Материалы десятой юбилейной научно-практической конференции молодых ученых / Под. ред. А.В. Силина, И.Ю. Стюф. Санкт-Петербург, СПбМАПО, 2010. С. 75-76.

5. Лунева, Н.М. Разработка латекс-диагностикума на основе моноклональных антител для идентификации E. coli О157:Н7 / Н.М. Лунева, Е.В. Белова, И.Г. Шемякин // Современные технологии обеспечения биологической безопасности:

Материалы научно-практической школы-конференции молодых ученых и специалистов научно-исследовательских организаций Роспотребнадзора / Под ред.

Г.Г. Онищенко, И.А. Дятлова. Оболенск, 2010. С. 183-185.

6. Лунева, Н.М. Разработка латексных тестов на основе моноклональных антител, перспективных для диагностики энтерогеморрагических E. coli О серогруппы / Н.М. Лунева, Е.В. Галкина, Е.В. Белова, И.Г. Шемякин // Молекулярная диагностика – 2010: Сб. тр. VII Всероссийской научно-практической конференции с международным участием / Под ред. В.И. Покровского. Москва, 2010. – С. 362-364.

7. Kозырь, A.В. Получение ДНК-аптамеров к клеткам Escherichia coli штамма O157:H7 для создания диагностических тест-систем / A.В. Kозырь, Н.М. Лунева, А.В. Колесников, A.E. Хлынцева, И.Г. Шемякин // Современная медицина и фармацевтика: анализ и перспективы развития: Материалы III Международной научно-практической конференции. Москва, 2012. С. 4-6.

8. Kозырь, A.В. Технология отбора ДНК-аптамеров к бактериальным клеткам / A.В. Kозырь, Н.М. Лунева, А.В. Колесников, A.E. Хлынцева, И.Г. Шемякин // Научные достижения биологии, химии и медицины в сфере экологии, здоровья и качества жизни человека: Материалы IV Международной научной заочной конференции / Электронный научный журнал "Медицинский университет". Москва, 2012. – С. 28-30.

9. Лунева, Н.М. Разработка диагностической тест-системы к шига-токсину Stx2 для детекции энтерогеморрагических эшерихий / Н.М. Лунева, A.В. Kозырь, А.В. Колесников, A.E. Хлынцева, И.Г. Шемякин // Современная медицина и фармацевтика: анализ и перспективы развития: Материалы V Международной научно-практической конференции. Москва, 2012. С. 29-32.

10. Luneva, N.M. Identification of the Enterohemorragic E.coli O157 serogroup with monoclonal antibodies to the O-antigen / N.M. Luneva, R.Z. Shaikhutdinova, E.V. Belova, I.G. Shemyakin // 5th Baltic Meeting on Microbial Carbohydrates / N.D. Zelinsky Institute of Organic Chemistry Russian Academy of Sciences. Suzdal, 2012. P. 44.

11. Luneva, N. Selection of DNA aptamers specific to Escherichia coli O157:H7 for the development of diagnostic assays / N. Luneva, A. Kozyr, A. Kolesnikov, A. Khlyntseva, I. Shemyakin // 12th International Nutrition&Diagnostic Conference / Carolinum-Charles University. Prauge, 2012. P. 163.

БЛАГОДАРНОСТИ Приношу искреннюю благодарность научным руководителям моей диссертации д.б.н., проф. И.Г. Шемякину и к.б.н. А.В. Козырь (ГНЦ ПМБ), осуществлявшим научное руководство и оказывавшим методическую помощь на всех этапах работы, а также к.б.н. А.В. Колесникову за помощь и большой интерес к моей работе.

Выражаю искреннюю благодарность к.б.н. А.М. Баранову за ценные советы и критические замечания.

Выражаю благодарность за помощь в проведении испытаний разработанных тест-систем сотрудникам ФБУН ГНЦ ПМБ: зам. директора по качеству и развитию к.м.н. М.В. Храмову, зав. ОБТК Т.И. Василенко, зав. ООК Н.И. Ажермачевой, с.н.с. отдела зоонозных инфекций ФКУЗ ИркутскНИПЧИ Сибири и ДВ к.б.н.

С.А. Бельковой.

Выражаю благодарность за предоставленные штаммы микроорганизмов, используемые в работе, сотрудникам ФБУН ГНЦ ПМБ: д.в.н., проф.

Э.А. Светочу, к.б.н. Ю.Г. Степаншину, н.с. В.П. Левчуку, технологу Н.И. Луневой, н.с. Е.В. Галкиной.

Благодарю сотрудников лаборатории молекулярной биологии, оказывавших помощь в проведении экспериментов. Отдельная благодарность н.с. О.Н. Красавцевой за понимание, поддержку и участие.

Считаю своим долгом выразить искреннюю благодарность моим соавторам, принимавшим участие в планировании и проведении экспериментов и обсуждении их результатов.

Приношу искреннюю признательность ведущей организации, официальным оппонентам и рецензентам настоящей работы за сделанные поправки и высказанные замечания, которые, по возможности, были учтены.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.