авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Влияние точечной мутации d112r на рекомбинационную активность белка reca из escherichia coli

На правах рукописи

ДУДКИНА АЛЕКСАНДРА ВАЛЕНТИНОВНА ВЛИЯНИЕ ТОЧЕЧНОЙ МУТАЦИИ D112R НА РЕКОМБИНАЦИОННУЮ АКТИВНОСТЬ БЕЛКА RecA ИЗ Escherichia coli 03.01.03 молекулярная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

_ Санкт-Петербург 2011

Работа выполнена на Кафедре биофизики Физико-механического факультета федерального государственного бюджетного образовательного учреждения высшего профессионального образования «Санкт-Петербургский государственный политехнический университет».

Научные руководители: доктор биологических наук, профессор Ланцов Владислав Александрович ФГБОУ ВПО «Санкт-Петербургский государственный политехнический университет» кандидат биологических наук Байтин Дмитрий Михайлович ФГБОУ ВПО «Санкт-Петербургский государственный политехнический университет»

Официальные оппоненты: член-корреспондент РАМН, доктор биологических наук, профессор Смирнов Георгий Борисович НИИ эпидемиологии и микробиологии им. Н.Ф. Гамалеи РАМН, доктор физико-математических наук, Тимковский Андрей Леонидович Федеральное государственное бюджетное учреждение «Петербургский институт ядерной физики им. Б.П. Константинова»

Ведущая организация: Санкт-Петербургский государственный университет, Биолого-почвенный факультет

Защита диссертации состоится «28» октября 2011 года в 15 часов на заседании Диссертационного совета Д.002.230.01 при Институте цитологии РАН по адресу: 194064 Санкт-Петербург, Тихорецкий пр., д. 4.

Адрес электронной почты Института: cellbio@mail.cytspb.rssi.ru Сайт: http://www.cytspb.rssi.ru Факс: 8 (812) 297-35-

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН

Автореферат разослан « » сентября 2011 г.

Ученый секретарь Диссертационного совета, кандидат биологических наук Е.В. Каминская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Данная работа посвящена изучению механизмов, регулирующих процесс рекомбинации в клетке.

С тех пор, как Кларк и Маргулис в 1965 г. выявили абсолютную зависимость гомологичной рекомбинации от целостности гена recA (Clark and Margulies, 1965), его продукт – белок RecA – является наиболее интенсивно изучаемым ферментом гомологической рекомбинации у прокариот.

Белок RecA также участвует в процессах репарации, мутагенеза, клеточного деления, регуляции экспрессии ряда репарационных генов и в других процессах жизнеобеспечения клетки (Ланцов, 2007;

Galletto et al., 2007).

Несмотря на небольшой размер белка RecA (его молекулярная масса составляет ~40 кДа), он обладает поразительной многосторонней функциональностью: гидролизует АТФ, взаимодействует с однонитевой ДНК (онДНК) и двунитевой ДНК (днДНК), является копротеазой при авторасщеплении репрессора SOS регулона клетки (белка LexA) и катализирует ренатурацию двунитевой ДНК (Ланцов, 2007;

Cox, 2007).

Структурно-функциональный анализ белка RecA, проводимый во многих лабораториях мира, приобрел новые возможности после описания в 1992 г. его трехмерной кристаллической структуры в неактивном состоянии (Story et al., 1992) и после исследования кристаллов активных филаментов RecA (Chen et al., 2008). Эти структуры совместно с генетическими и биохимическими данными позволили авторам определить области белка, связывающиеся с ДНК и нуклеотидными кофакторами, участвующие в межпротомерном взаимодействии и связывании с репрессорами. Кроме того, полученные кристаллические структуры легли в основу интерпретации данных о биохимических свойствах мутантных белков RecA.

Несмотря на очевидные успехи в изучении механизмов функционирования белка RecA, до сих пор актуальным остается исследование его структурно-функциональной организации.

Бактериальный белок RecA несет в себе огромный рекомбинационный потенциал, который клетка вынуждена ограничивать по причине его возможного вреда для стабильности генома. Во многом эти ограничения определяются оптимизированным составом аминокислотных остатков самого белка.

Исследование аминокислотных замен в области протомер-протомерного взаимодействия белка RecA in vivo и in vitro выявило, что такие замены влияют на его рекомбинационные свойства (Bakhlanova et al., 2001;

Chervyakova et al., 2001). Чтобы определить значение ионных и полярных взаимодействий остатков 3-30 и 111-140 для олигомерной структуры RecA и его ферментативных функций, Найт (Knight) с сотрудниками ввели семь аминокислотных замен в положениях 6, 28, 112, 113 и 139 (Eldin et al., 2000). Ими было изучено влияния этих замен на стабильность олигомеров свободного белка RecA, однако влияние замен, нарушающих ионные или полярные взаимодействия в области контакта протомеров RecA, на рекомбинационные характеристики белка RecA исследовано не было.

Цель работы. Целью работы является изучение механизмов, регулирующих процесс рекомбинации в клетке, а также выявление тех биохимических особенностей белка RecA D112R, которые лежат в основе его повышенной рекомбиногенности.

Задачи исследования:

1) Проанализировать аминокислотные замены в области взаимодействия RecA-RecA, влияющие на частоту рекомбинационных обменов (ЧРО).

2) Исследовать пути нормализации или ограничения гиперрекомбинационной активности в клетках E. coli, несущих гиперактивный белок RecA D112R.

3) Выделить и очистить белок RecA D112R, сравнить его биохимические свойства с белком RecA дикого типа.

4) Исследовать особенности регуляции филамента RecA D112R вспомогательными белками – такими, как белки SSB, FSSB, PsiB, LexA, RecX. Провести сравнение с другими гиперактивными мутантными белками RecA.

5) Изучить связи между ДНК-синаптазной активностью белков RecAEc, RecA D112R, RecA E38K и RecA С17 in vitro и рекомбинационной активностью клеток, экспрессирующих эти белки.

Основные положения, выносимые на защиту:

1) Белок RecA D112R увеличивает частоту рекомбинационных обменов на единицу длины ДНК in vivo в 52 раза, являясь наиболее рекомбинационно активным из изученных на сегодняшний день мутантных белков RecA.

2) В популяции клеток E. coli с аномально высокой RecAD112R-зависимой рекомбинацией наблюдается постепенный отбор клеток со сниженной гиперрекомбинацией. Селекция приводит к снижению рекомбинационной активности до нормального уровня.

3) Мутантный белок RecA D112R по сравнению с белком RecAEc обладает:

а) повышенной способностью расплавлять вторичные структуры на онДНК;

б) повышенной способностью смещать белок SSB с онДНК, в том числе при снижении концентрации ионов магния в реакционной смеси;

в) повышенной способностью смещать белок FSSB c онДНК;

г) повышенной устойчивостью к ингибирующему воздействию белков PsiB и RecX;

д) повышенной скоростью проведения реакции обмена нитей ДНК при снижении концентрации ионов магния в реакционной смеси.

4) Устойчивость филамента RecA к ингибирующему действию белка RecX определяется не только силой межбелковых RecA-RecX взаимодействий, но и динамикой филаментации RecA на онДНК.

5) Высокая рекомбиногенность мутантного белка RecA D112R обеспечивается повышенной скоростью инициирования синаптазной реакции.

Научная новизна и практическая ценность работы. Выявлено влияние точечных аминокислотных замен в области мономер-мономерного взаимодействия белка RecA на его рекомбинационные свойства. Исследованы пути нормализации рекомбинационной активности белка RecA D112R в клетках E. coli. Впервые охарактеризованы биохимические свойства белка RecA D112R, как наиболее рекомбиногенного из всех белков RecA, изученных к настоящему времени. Обнаружена повышенная активность белка RecA D112R в процессе вытеснения белков SSB и FSSB с онДНК, а также в реакции расплетания вторичных структур на онДНК. Обнаружена устойчивость онДНК-зависимой АТФазной активности белка RecA D112R к действию таких негативных регуляторов рекомбинации, как белки PsiB и RecX. Предложена усовершенствованная модель регуляции филамента RecA белком RecX, в рамках которой элонгация филамента RecA вдоль онДНК блокируется белком RecX на участке онДНК, расположенном за пределами филамента. Обнаружен новый путь повышения рекомбиногенности белка RecA за счет увеличения его синаптазной активности.

Теоретическое и практическое значение работы. Проведенное исследование относится к числу фундаментальных, оно расширяет наши представления о молекулярном механизме гомологической рекомбинации. Вместе с тем, подобные исследования имеют и прикладное значение: белок RecA D112R может быть использован в роли гомологичной рекомбиназы, введение которой в клетки млекопитающих может существенно активировать рекомбинацию в клетках высших и обеспечить замену участка гена при мишенной рекомбинации.

Белок RecA из E. coli использовался в биотехнологии, однако широкое применение нашли только несколько технологий, использующих RecA, в то время как многочисленные попытки использования RecA в области генетической инженерии имели ограниченный успех.

Рекомбинационная активность RecA в клетках E. coli дикого типа может зависеть от функций множества регуляторных белков, присутствие которых, по-видимому, не слишком легко обеспечить в экспериментах, направленных на модификацию генома эукариот. Использование в биотехнологии мутантных белков RecA с точечными заменами, усиливающими одну или более функций RecA, может привести к продуктивному использованию рекомбинационного потенциала этого белка.

Апробация работы. Материалы диссертации докладывались на XI, XII и XIV Международных школах-конференциях молодых ученых “Биология наука XXI века” (Пущино, 2007, 2008 и 2010 гг.), на семинарах политехнического симпозиума «Молодые ученые – промышленности Северо-Западного региона» (Санкт-Петербург, 2005, 2006 и 2010 гг.), на II научной конференции «Молекулярная генетика, биофизика и медицина» (Бреслеровские чтения II) (Санкт-Петербург, 2006), на Всероссийском форуме студентов, аспирантов и молодых ученых «Наука и инновации в технических университетах» (Санкт-Петербург, 2008) и «Russian-Swiss Workshop on Regulation of genome stability by DNA replication and repair» (Санкт-Петербург, 2010).

Структура и объем работы. Диссертационная работа изложена на 118 страницах машинописного текста и состоит из введения, обзора литературы, описания материалов и методов исследования, экспериментальных результатов и их обсуждения, выводов, заключения и списка литературы, содержащего 228 источников. Иллюстративный материал содержит 28 рисунков и таблиц.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Объект исследования: мутантный белок RecA D112R. Экспрессию белка RecA D112R и контрольного белка RecAEc проводили в штамме BL21 (DE3) pLysS: F- ompT hsdSB (rB- mB+) dcm gal (DE3) recA306, несущем плазмиду pLysS. Штамм BL21 (DE3) входит в pET-экспрессионную систему (Novogene, США).

Определение частоты рекомбинационных обменов. Частота рекомбинационных обменов на единицу длины ДНК может быть выражена через среднестатистическое расстояние между двумя соседними рекомбинационными обменами - параметр, который вычисляется по модифицированной формуле Холдейна µ = 0.5[1 + exp(2l/)], где µ - сцепленность между селектируемым и неселектируемым маркерами, а l - физическое расстояние между маркерами, выраженное в минутах карты или числе нуклеотидов (Бреслер и Ланцов, 1978). Сцепленность между селектируемыми (thr+ или ara+) и неселектируемым (leu+) маркерами определяли методом перепечаток, анализируя число клонов, имеющих соответственно генотип Thr+Leu+ или Ara+Leu+ среди клонов Thr+ или Ara+, полученных в результате постконъюгационной рекомбинации.

SOS-хромотест проводили согласно методике, описанной ранее (Миллер, 1976).

Эффективность SOS-ответа, контролируемого геном recA, регистрировалась по синтезу галактозидазы, продуцируемой геном lacZ, находящимся под контролем SOS-индуцируемого гена sfiA в штамме GY7109. -Галактозидазную активность измеряли при помощи хромогенного субстрата o-нитрофенил--D-галактозида (ОНФГ). В присутствии -галактозидазы это бесцветное вещество превращается в галактозу и о-нитрофенол, который окрашен в желтый цвет, так что его количество можно измерить по поглощению при 420 нм. Количество образовавшегося о нитрофенола пропорционально количеству фермента и времени взаимодействия фермента с ОНФГ.

Выделение и очистку белков осуществляли по одной схеме, поскольку гены recAEc и recAD112R клонированы в вектор pET-21b. Белки RecA выделяли и очищали в три этапа.

Обработанные лизаты клеток, содержащие экспрессированные белки RecA, осаждали полимином P, проводили ионообменную хроматографию на предварительно подготовленном носителе – фосфоцеллюлозе P11 с последующей аффинной очисткой на колонке с онДНК-целлюлозой (Cox et al., 1981).

Измерение гидролиза АТФ, катализируемого белками RecA, проводили с помощью спектрофотометрического метода, связывающего гидролиз АТФ с окислением NADH. Появление одного эквивалента АДФ (гидролиз 1 молекулы АТФ) ферментативно сопряжено с окислением одного эквивалента молекулы NADH до NAD+, регистрируемого спектрофотометрически при нм. Коэффициент молярной экстинкции NADH 380 = 1.21 мM-1 см-1.

Реакции проводили при 37°C в 90 мкл буфера ТМД (25мM Трис-HCl, pH 7.5;

MgCl2 (от 2 до 10 мM, точная концентрация указана в конкретных экспериментах);

0.1 мM DTT), содержащего мM АТФ и АТФ-регенерирующую систему (3 мM фосфоенолпирувата, 30 единиц/мл пируват киназы, 4.5 мM NADH и 30 единиц/мл L-лактат дегидрогеназы), ДНК, определенный белок RecA и/или белки SSB, FSSB, RecX, PsiB в концентрации, указанной в конкретных экспериментах.

Скорость гидролиза АТФ регистрировали в кюветах с оптическим путем 1 см с помощью спектрофотометра Shimadzu UV-1800.

Синаптазная реакция обмена гомологичными нитями ДНК in vitro с использованием метода FRET (Fluorescence Resonance Energy Transfer). Линейный двунитевой олигонуклеотид длиной 34 п.н., для получения которого использовали олигонуклеотиды FAM TCACCAATGAAACCATCGATAGCAGCACCGTAAT и ATTACGGTGCTGCTATCGATGGTTTC ATTGGTGA-Dabsyl, был помечен по противоположным концам нитей флуоресцеином и дабсилом. Он реагировал с линейной немеченой онДНК длиной 102 нуклеотида с последовательностью, эквивалентной трем повторам на меченой дабсилом нити двунитевого олигонуклеотида. Реакцию проводили при 27°C в кювете объемом 0.3 мл. Реакционная смесь содержала 25 мM Tris HCl (pH 7.5), указанную концентрацию MgCl2, 3 мкМ однонитевого олигонуклеотида, 1.2 мкМ белка RecA, 0.3 мкМ SSB, 0.7 мМ АТФS и 1.5 мкМ меченого двунитевого олигонуклеотида. Филаменты белка RecA формировались на онДНК в течение минут в присутствии ATФS и белка SSB. Реакцию инициировали добавлением меченой днДНК.

В ходе RecA-зависимого переноса одной из нитей днДНК на онДНК, содержащуюся внутри филамента, происходило пространственное разделение флуоресцеина и дабсила и, как следствие, увеличение флуоресцентного сигнала. Интенсивность флуоресценции определяли с помощью флуориметра Hitachi F-4000.

Реакции переноса нити проводили и визуализировали в агарозном геле согласно методике, предложенной Коксом (Cox et al., 1981). Реакционная смесь содержала 25 мМ трис-HCl (pH 7.5), 10 или 4 мМ MgCl2, 1 мМ АТФ, АТФ-регенерирующую систему, а также указанные под рисунком количества белков RecA и SSB, кольцевой онДНК фага M13mp18 (плюс-нить) и линейной формы днДНК того же фага. Эксперимент проводили при температуре 37С. Белок RecAEc или RecA D112R предварительно прогревали с онДНК в течение 3 минут, затем в реакционную смесь добавляли белок SSB и инкубировали еще 2 минуты. В указанные промежутки времени из реакционной смеси отбирали аликвоты, и реакции останавливали добавлением 5 мМ EDTA, 0.5% SDS, 0.1 мг/мл протеиназы К с последующим инкубированием в течение 30 минут при 37°C. Затем проводили электрофорез в 0.8% агарозном геле, с последующим окрашиванием раствором 0. мкг/мл бромистого этидия. Положение ДНК в геле анализировали с помощью системы Kodak DC120 и программного обеспечения KDSID 2.0 (Amersham).

Статистическую обработку результатов проводили с помощью метода наименьших квадратов, используя коэффициент Стьюдента для заданной надежности = 0.90 (Кассандрова и Лебедев, 1970). Относительная погрешность результатов не превышала 10%.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ Исследование рекомбинационных характеристик мутантных белков RecA с заменами в области межпротомерного взаимодействия in vivo Таблица 1. Влияние аминокислотных замен в области межпротомерного взаимодействия на рекомбинационные свойства белков in vivo Ara+Leu+ Thr+Leu+ Сцеплен Сцеплен рекомби (µ) ara+ (µ) thr+ -нантов замена Выход -ность -ность ЧРО SOS ЧРО SOS leu+ leu+ или АК w.t. 4.9 ± 0.4 0.986 ± 0.924 ± 5.0 ± 0.1 1 30.3 ± 3.1 0.013 0. [K6A] 4.8 ± 0.5 - 0.721 ± 23.8 ± 2.1 4.8 65.0 ± 7.1 2. 0. [K6D] 5.2 ± 0.5 - 0.805 _ 14.5 ± 1.3 2.9 84.5 ± 9.2 2. 0. [R28A] 3.3 ± 0.3 0.734 ± - 135.1 ± 11.3 27.0 26.3 ± 2.8 0. 0. [R28D] 0.8 ± 0.1 0.673 ± - 188.7 ± 17.4 37.8 66.6 ± 6.8 2. 0. [R28N] 5.6 ± 0.5 - 0.892 ± 7.1 ± 0.6 1.4 34.8 ± 3.5 1. 0. [T89V] 2.0 ± 0.2 0.978 ± - 8.2 ± 0.3 1.6 35.0 ± 3.4 1. 0. [T89A] 1.8 ± 0.2 0.934 ± - 25.0 ± 2.3 5.0 34.6 ± 3.3 1. 0. [D112R] 2.4 ± 0.2 0.616 ± - 263.1 ± 27.3 52.6 71.0 ± 2. 0.054 11. [N113A] 2.3 ± 0.3 0.758 ± - 117.6 ± 12.4 23.5 164.8 ± 5. 0.076 20. [D139A] 5.3 ± 0.6 - 0.878 ± 8.3 ± 0.7 1.7 36.8 ± 3.7 1. 0. [D139K] 5.5 ± 0.6 - 0.868 ± 9.0 ± 0.8 1.8 45.3 ± 3.9 1. 0. [R28D 1.8 ± 0.1 0.661 ± - 204.1 ± 18.5 40.8 38.5 ± 3.6 1. /D112R] 0. Подавление гиперрекомбиназной активности популяции клеток в ходе их культивирования в жидкой ростовой среде Мутантный белок RecA D112R продемонстрировал наибольшую рекомбиногенную активность среди всех изученных мутантных белков RecA, охарактеризованных генетически (Bakhlanova et al., 2001), что не является естественным для клетки и подтверждается наблюдаемой нами гибелью части клеток. Нами была выдвинута гипотеза, что повышенный уровень рекомбиногенности может активировать механизмы, способные оказать влияние на ЧРО и привести к ее понижению. Для ее проверки был проведен эксперимент, в котором были использованы 16 независимых популяций клеток E. coli JC10289recA, несущих плазмиду с мутантным геном recAD112R. Эти популяции в течение 14 суток культивировали в жидкой ростовой среде, поддерживая их в состоянии экспоненциального роста и периодически измеряя ЧРО. Значение ЧРО при этом в каждом случае стремится к контрольному, но не достигает его.

Каждая из культур (исходно происходивших из одного клона) утрачивает гиперрекомбинационную активность по-своему, что свидетельствует о разнообразии путей снижения этой активности. Но в каждом случае клетка избавляется от гиперрекомбинации, и к 70 му поколению ЧРО для разных штаммов приобретает значение от 1 до 14. Следовательно, в самой аномалии, ее возможностях дестабилизировать геном, заложены перспективы отбора клеток, нормализовавших ГР.

Для определения локализации мутаций, приводящих к снижению ЧРО, плазмиды и хромосомы из модифицированных штаммов были разделены и подвергнуты генетическому анализу. Было показано, что снижение ЧРО может быть обусловлено изменениями, произошедшими как на плазмиде, так и на хромосоме.

Наибольший интерес вызвали модифицированные плазмиды, обеспечивающие максимальное снижение ЧРО (с ЧРО = 52 до ЧРО = 1.3). Секвенирование трех из них выявило делецию участка длиной 633 п.н., захватывающего промоторную область гена recAD112R. Она возникла в результате гомологической рекомбинации по прямым повторам длиной 37 п.н. и приводила к снижению уровня белка RecA D112R в клетке. На плазмиде был обнаружен альтернативный промотор, обеспечивавший присутствие в клетке белка RecA D112R в значительно меньших количествах, чем при транскрипции гена с немодифицированной плазмиды.

Микрочиповый анализ генома модифицированного штамма JC-12 (снижавшего ЧРО за счет изменений, произошедших на хромосоме;

ЧРО = 4), с последующим секвенированием предположительно модифицированных генов выявил точечную нуклеотидную замену в гене pcnB, кодирующем поли(А) полимеразу. Ген pcnB был идентифицирован по своей способности влиять на копийность плазмид с ColE1 репликоном (Grunberg-Manago, 1999). Точечная мутация приводит к образованию стоп-кодона и инактивирует ген, при этом образуется сайт рестрикции для рестриктазы AluI, что делает эту мутацию удобной для анализа. Амплификация и рестрикция гена pcnB из других модифицированных штаммов, характеризующихся снижением ЧРО за счет изменений на хромосоме, мутаций не выявила.

Можно утверждать, что если умеренная (8-кратная) гиперрекомбинация еще переносима клеткой (Bakhlanova et al., 2001), то неумеренная (52-кратная) вынуждает клетку включать механизмы, направленные против дестабилизации ее генома. В случаях нормализации рекомбиназной активности в клетке наблюдалось уменьшение количества мутантного белка RecA D112R, вызывающего аномально высокую рекомбинацию.

Изучение биохимических свойств белка RecA D112R Поскольку среди всех изученных на сегодняшний день белков RecA мутантный белок RecA D112R демонстрирует наиболее высокое значение ЧРО, его биохимические свойства представляют значительный интерес для дальнейшего исследования. В части приведенных ниже экспериментов белок RecA D112R сравнивается с белком RecA дикого типа (RecAEc), а также двумя ранее изученными мутантными белками: 1) RecA C17, у которого удалены 17 С-концевых остатков, выполняющих авторегуляторную функцию (Lusetti et al., 2003), его введение в клетку вызывает увеличение ЧРО в 4 раза;

2) RecA E38K (RecA730), обладающим повышенной способностью смещать SSB и связываться как с он-, так и с днДНК (Lavery and Kowalczykowski, 1992), его экспрессия в клетках E. coli приводит к увеличению ЧРО в 7 раз (Bakhlanova et al., 2001).

При сравнении белков RecAEc и RecA D112R оба белка характеризовались одинаковой скорость гидролиза АТФ в случае использования онДНК фага М13, когда реакцию запускали добавлением в реакционную смесь белка SSB, расплетающего вторичные структуры на онДНК.

При использовании поли(дТ) белки RecAEc и RecA D112R демонстрировали близкую по значению скорость гидролиза АТФ: для RecAEc kcat = 29.5 мкМ/мин, а для RecA D112R kcat = 25. мкМ/мин.

Расплавление вторичной структуры на онДНК фага М13 белком RecA D112R. В отсутствие SSB белок RecA D112R проявляет повышенную способность связывать участки вторичной структуры в онДНК по сравнению с белком дикого типа (Рисунок 1). На онДНК фага М13 уровень гидролиза АТФ белком RecAEc составляет порядка 40% от наблюдаемого в присутствии SSB. Дальнейшее добавление RecAEc почти не оказывает эффекта, в то время как увеличение концентраций белка RecA D112R приводит к уровню гидролиза АТФ, сравнимому с тем, что наблюдается в присутствие SSB. Т.о., мутантный белок способен связываться с регионами вторичной структуры и расплавлять их.

Относительная скорость гидролиза АТФ RecA D112R 1, 0, Рисунок 1. Гидролиз АТФ, катализируемый белками RecAEc и RecA D112R в присутствии онДНК М13 и в 0, отсутствие белка SSB.

Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 0, 2 мМ АТФ, АТФ-регенерирующая система, 5 мкМ онДНК RecAEc М13 и указанное на рисунке количество RecAEc или RecA D112R.

0, 0, 0,0 0,5 1,0 1,5 2,0 2, RecA, мкМ Вытеснение белком RecA D112R белка SSB с кольцевой онДНК. Помимо гена SSB, находящегося на хромосоме, в клетках E. coli может содержаться дополнительный ген SSB, находящийся на F-плазмиде (Jones et al., 1992) и регулирующий доступ RecA к онДНК во время конъюгации. Белок FSSB отличается повышенным сродством к онДНК. Белок RecA D112R продемонстрировал повышенную способность смещать EcSSB и FSSB c онДНК (Рисунок 2).

В обоих случаях RecA D112R способен связываться с онДНК быстрее, чем белок RecAEc и (когда это проверялось) RecA C17. В эксперименте с EcSSB, преимущество мутанта перед RecAEc увеличивалось при снижении концентрации ионов Mg2+ в реакционной смеси. Т.о., мутация D112R может стабилизировать структуру RecA, повышая способность белка связываться с онДНК. Белок RecA E38K связывается с онДНК и смещает FSSB быстрее, чем RecA D112R (Рисунок 2Б).

Рисунок 2. Кинетики вытеснения белка SSB с онДНК белками RecAEc и RecA D112R. А. Вытеснение белка SSB с онДНК белками RecAEc и RecA D112R при 10 или 4 мМ MgCl2. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 или 4 мМ MgCl2, 2 мМ АТФ, АТФ-регенерирующая система, 5 мкМ онДНК М13, 3 мкМ RecAEc или RecA D112R и 0.5 мкМ белка SSB. Кольцевую онДНК М13 преинкубировали в реакционной смеси с белком SSB в течение 10 минут, реакцию инициировали добавлением указанного белка RecA. Б. Кинетики вытеснения белка SSB, кодируемого F плазмидой, с онДНК белками RecA. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 1 мМ АТФ, АТФ-регенерирующая система, 5 мкМ онДНК М13, 3 мкМ RecAEc или RecA D112R и 0.5 мкМ белка FSSB.

Кольцевую онДНК М13 преинкубировали в реакционной смеси с белком FSSB в течение 10 минут, реакцию инициировали добавлением указанного белка RecA.

Влияние негативных регуляторов PsiB и RecX на АТФазную активность белка RecA D112R. F-плазмидный белок PsiB ингибирует все активности белка RecA, включая связывание с ДНК, реакцию обмена нити и расщепление белка LexA (Petrova et al., 2009). Он связывается со свободным RecA в растворе, и образовавшийся комплекс RecA-PsiB приводит к уменьшению количества нуклеопротеиновых филаментов RecA на онДНК.

АТФазная активность мутантного белка RecA D112R меньше подвергалась ингибированию белком PsiB, чем в случае RecAEc или RecA C17 (Рисунок 3А).

Другой ингибирующий RecA белок, RecX, связывается с растущим концом филамента, блокируя присоединение следующего мономера (Drees et al., 2004b), либо вызывает диссоциацию мономеров вдоль всего филамента в местах случайного связывания с RecA (Ragone et al., 2008).

Добавление RecX в реакционную смесь приводит к медленному снижению наблюдаемой АТФазной активности по мере диссоциации филамента. АТФазная активность белка RecA D112R вновь была менее подвержена ингибирующему действию RecX, чем в случае RecAEc или RecA C17 (Рисунок 3Б). В обоих описанных случаях способность белка RecA D112R противостоять влиянию регуляторов была существенной, но все же меньшей, чем наблюдалось в случае RecA E38K.

Рисунок 3. Влияние негативных регуляторов PsiB и RecX на АТФазную активность белков RecA. А.

ОнДНК-зависимый гидролиз АТФ белками RecA в присутствии белка PsiB. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ, АТФ-регенерирующая система, 3 мкМ онДНК М13, 2 мкМ RecAEc, RecA E38K, RecA C17 или RecA D112R, 0.5 мкМ белка SSB и 10 мкМ белка PsiB. Кольцевую онДНК М13 преинкубировали в реакционной смеси с белком SSB в течение 5 минут, затем добавляли 10 мкМ белка PsiB и инкубировали в течение еще 10 минут. Реакцию инициировали добавлением 2 мкМ указанного белка RecA (на графике это точка 0 по оси абсцисс). Б. Ингибирование онДНК-зависимого гидролиза АТФ белками RecA в присутствии белка RecX.

Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ, АТФ-регенерирующая система, 4 мкМ онДНК М13, 2.4 мкМ RecAEc, RecA E38K, RecA C17 или RecA D112R, 0.4 мкМ белка SSB и 0.1 мкМ белка RecX.

Кольцевую онДНК преинкубировали с указанным белком RecA в течение 10 минут, затем добавляли 0.4 мкМ белка SSB и АТФ и инкубировали в течение еще 15 минут, после чего в реакционную смесь добавляли 0.1 мкМ белка RecX.

Влияние мутации D112R на взаимодействие RecA с белками SSB и RecX. Белок RecX способен взаимодействовать как непосредственно с RecA, так и с онДНК, что усложняет интерпретацию результатов, полученных при изучении механизма регуляции филамента RecA.

Было показано, что белок SSB способствует устойчивости белка RecA к действию RecX (Baitin et al., 2008). Это наблюдение позволяет предложить модель, в которой повышенная устойчивость мутанта RecA D112R к RecX может определяться опосредованно, в ходе особых конкурентных отношений с белком SSB.

На рисунке 4 показана кинетика ингибирования ДНК-зависимой АТФазы белка RecA после добавления различных концентраций белка RecX. В реакционную смесь добавлялась онДНК фага М13, затем белок RecA и через 3 минуты - белок SSB, делающий вторичные структуры на онДНК доступными для RecA. Когда скорость гидролиза АТФ достигала своего максимального значения, в реакционную смесь добавляли белок RecX (в точке 0 по оси абсцисс). Скорость гидролиза АТФ белком RecA падает пропорционально используемой концентрации RecX, достигая стационарного уровня. При концентрациях RecX, равных 100 и 125 нМ, скорость гидролиза АТФ белком RecAEc падает до нуля, что свидетельствует о полной диссоциации RecA из комплекса с ДНК. Мутантный белок RecA D112R более устойчив к ингибирующему действию RecX, чем RecA дикого типа в тех же условиях.

Рисунок 4. Ингибирование ДНК-зависимой АТФазы белка RecA после добавления различных концентраций RecX. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ, АТФ регенерирующая система, 5 мкМ онДНК М13, 3 мкМ RecAEc или RecA D112R, 0.5 мкМ белка SSB и указанная на рисунке концентрация белка RecX (нМ).

Кольцевую онДНК преинкубировали с указанным белком RecA в течение 5 минут, после чего добавляли 0.5 мкМ белка SSB и АТФ и инкубировали в течение еще 5 минут. В момент времени t = 0 в реакционную смесь добавляли белок RecX.

Белок SSB, являясь естественным препятствием для инициации филамента RecA на онДНК, в то же время снижает ингибирующее действие белка RecX, то есть приобретает стимулирующую относительно RecA роль в присутствии RecX. Тенденция к усилению АТФазной активности белка RecA дикого типа в ответ на увеличение концентрации SSB в смеси сохраняется и для АТФазы RecA D112R (Рисунок 5А).

Рисунок 5. Вытеснение белка SSB белком RecA. А. Вытеснение белка SSB белком RecA в присутствии RecX. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ, АТФ-регенерирующая система, 5 мкМ онДНК М13, 3 мкМ RecAEc или RecA D112R, 75 нМ RecX и указанная на рисунке концентрация белка SSB (мкМ).

Кольцевую онДНК преинкубировали с белками SSB и RecX в течение 5 минут, после чего в момент времени t = 0 в реакционную смесь добавляли указанный белок RecA. Гидролиз АТФ белком RecAEc отмечен сплошной линией, RecA D112R - пунктирной линией. Б. Вытеснение белка SSB белком RecA в отсутствие RecX. Реакционная смесь: как в А, за исключением белка RecX. Кольцевую онДНК преинкубировали с указанным белком SSB в течение 5 минут, после чего в реакционную смесь добавляли указанный белок (начало реакции соответствует точке 0 по оси абсцисс).

Гидролиз АТФ белком RecAEc отмечен сплошной линией, RecA D112R - пунктирной линией.

Белок RecA D112R значительно быстрее преодолевает ингибирующий эффект белка RecX любых концентрациях SSB. Чтобы разделить влияние каждого из белков на кинетику реакции, при был проведен эксперимент по вытеснению белка SSB белком RecA в отсутствие RecX (Рисунок 5Б). RecA D112R вытесняет SSB значительно быстрее, чем RecAEc, т.е. более активно конкурирует за сайты связывания на онДНК в сравнении с RecAEc и, следовательно, имеет повышенное сродство к онДНК либо к молекуле RecA, уже находящейся в контакте с ДНК.

Белок RecA активно взаимодействует с онДНК, лишенной сложной вторичной структуры и шпилек (например, поли(дT)), без помощи SSB, при этом белок SSB вытесняет RecA с 5-конца любой линейной молекулы онДНК, замещая освободившиеся в ходе разборки филамента участки ДНК (Madiraju et al., 1992). Использование поли(дТ) позволило вовлечь в реакцию RecA и RecX в отсутствие SSB. Добавление RecX в реакционную смесь с поли(дT) приводит к одномоментному резкому снижению скорости гидролиза до некоторого конечного значения, чего не наблюдается в экспериментах с онДНК фага М13. Длина кольцевой онДНК фага М13 составляет ~ оснований, а средняя дина поли(дТ) – 226 оснований, т.е. белок RecA, предположительно, образует на поли(дТ) более короткие филаменты, характеризующиеся меньшим временем разборки. Отсутствие в реакции белка SSB делает процесс разборки филамента менее сложным.

Несмотря на то, что различие между RecAEc и RecA D112R оказалось не слишком большим, RecA D112R показал достоверно бльшую устойчивость к RecX (Рисунок 6А).

Рисунок 6. Влияние белка RecX на стабильность филамента RecA на поли(дТ). А. Влияние белка RecX на АТФазную активность RecA на поли(дТ). Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ, АТФ-регенерирующая система, 5 мкМ поли(дТ), 3 мкМ RecAEc или RecA D112R и указанная на рисунке концентрация белка RecX (нМ). Реакцию инициировали добавлением белка указанного RecA в реакционную смесь, содержащую поли(дТ). В момент времени t = 7 в реакционную смесь добавляли указанное количество белка RecX.

Гидролиз АТФ белком RecAEc отмечен сплошной линией, RecA D112R – пунктирной линией. Б. Влияние белка RecX на RecA-зависимый гидролиз дАТФ. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ или дАТФ, АТФ-регенерирующая система, 5 мкМ поли(дТ), 3 мкМ RecAEc и 100 нМ белка RecX. Реакцию инициировали добавлением белка RecA в реакционную смесь, содержащую поли(дТ). В момент времени t = 7 в реакционную смесь добавляли 100 нМ белка RecX.

Белок RecA может создавать филамент на онДНК в присутствии дАТФ вместо АТФ, при этом скорость гидролиза дАТФ превышает скорость гидролиза АТФ на 15-20%. Заряженный молекулой дАТФ вместо АТФ RecA активнее конкурирует с SSB за сайты связывания на онДНК, благодаря изменившемуся сродству к онДНК (Menetski and Kowalczykowski, 1989). В проведенной нами реакции вновь был задействован поли(дТ), благодаря чему белок SSB не использовался. На Рисунке 6Б видно, что при замене АТФ на дАТФ RecA значительно более устойчив к действию RecX. Это замещение приводит к усилению стабильности филамента как RecAEc, так и RecA D112R в реакции с RecX и, видимо, носит универсальный характер.

Сделанные наблюдения позволяют предложить модель, в которой повышенная устойчивость мутанта RecA D112R к RecX может определяться в ходе особых конкурентных отношений с белком SSB. Вместе с тем, в опыте с поли(дT) и при полном отсутствии SSB показано, что филамент RecA D112R обладает устойчивостью к RecX.

Можно сделать вывод, что в основе повышенной устойчивости RecA D112R к RecX вероятнее всего лежит изменение динамики взаимодействия филамента с онДНК. Мы предложили модель ингибирования, в которой мономеры мутантного белка в ходе элонгации филамента эффективно опережают связывание RecX с растущим концом филамента. Возможно построение комплекса RecA::онДНК::АТФ::RecX, в котором RecX одной частью связывается с филаментом, тогда как другая его часть вовлечена в непосредственное взаимодействие с ДНК перед филаментом. При этом доступ следующего мономера к растущему концу филамента заблокирован, так как RecX занимает пространство, необходимое для элонгации. Такая модель ингибирования объясняет преимущество RecA с повышенной динамикой филаментации, вызванной заменой D112R либо АТФ дАТФ и одновременно разъясняет природу антагонизма между белками SSB и RecX: занимая сайт онДНК перед филаментом, белок SSB, возможно, удерживает пространство на этом участке ДНК от взаимодействия с RecX, позволяя новым мономерам RecA достраивать филамент.

Реакция обмена нити, проводимая белком RecA D112R. Сравнение рекомбинационных свойств белков RecA D112R, RecAEc, RecA C17 и RecA E38K показало, что гиперрекомбинационная активность белка RecA может быть связана не только с особенностями его филаментации на онДНК и регуляцией вспомогательными белками. Возможно, ключевой вклад в наблюдаемую in vivo гиперрекомбинацию дают такие функции, как поиск гомологии и обмен гомологичных нитей.

Моделью рекомбинационного процесса in vitro является реакция переноса нити с линейной молекулы днДНК фага М13 на кольцевую онДНК того же фага, протекающая с активным участием белка SSB. На Рисунке 7А представлены данные по кинетике реакции переноса нити, катализируемой белками RecAEc или RecA D112R. По мере вытеснения белка SSB белками RecA с участков онДНК и образования пресинаптического комплекса, в реакцию вовлекается гомологичная линеаризованная днДНК. Образующиеся при этом промежуточные продукты реакции – объединенные молекулы ДНК (ОМ) – мигрируют в агарозном геле гораздо медленнее, чем исходные субстраты. Скорость реакции оценивали по образованию продуктов реакции: ОМ и конечных продуктов (КП), при этом количество ДНК в ОМ и КП делилось на все количество днДНК в реакции.

Реакция, проводимая белком RecA D112R, почти не отличается от проводимой RecAEc, за исключением более раннего образования ОМ. Перенос нити завершается образованием конечного продукта реакции – релаксированной кольцевой днДНК. Оба белка завершают образование КП приблизительно одновременно.

Повышенный уровень (8-10 мМ) свободных ионов Mg2+ необходим для успешного проведения реакции обмена нити in vitro, проводимой белком RecA дикого типа (Cox and Lehman, 1981;

Lusetti et al., 2003). Столь высокий уровень свободных ионов Mg2+ вряд ли можно встретить in vivo, поэтому предполагается, что активность RecA в клетках каким-то образом повышается при помощи регуляторных белков.

При снижении концентрации ионов Mg2+ до 4 мМ, скорость реакции, проводимой белком RecAЕс, значительно замедлялась. Образование КП белком RecAЕс завершалось через 90 минут после начала реакции, в то время как для белка RecA D112R снижение концентрации ионов Mg2+ не сказывалось на скорости проведения реакции (Рисунок 7Б).

Рисунок 7. Реакция переноса нити: разделение в агарозном геле исходных компонентов реакции (кольцевой онДНК М13 и линейной днДНК М13) и продуктов реакции (объединенных молекул (ОМ) и конечных продуктов (КП) – кольцевых никированных днДНК М13). А. Реакция переноса нити в присутствии мМ MgCl2. Реакционная смесь: 25 мМ трис-HCl (рН 7.5), 10 мМ MgCl2, 2 мМ АТФ, АТФ-регенерирующая система, мкМ онДНК М13, 6 мкМ RecAEc или RecA D112R, 1 мкМ SSB и 18 мкМ днДНК. Б. Реакция переноса нити в присутствии 4 мМ MgCl2. Реакционная смесь как в А, за исключением 4 мМ вместо 12 мМ MgCl2.

Полученные результаты подтверждают преимущество белка RecA D112R перед RecAEc на стадии поиска гомологии и комплементарного спаривания молекул ДНК.

Повышенная синаптазная активность белка RecA D112R. Мы сравнили способность белка дикого типа и белка RecA D112R проводить синаптазную реакцию обмена гомологичными нитями ДНК in vitro. Кинетику реакции регистрировали с помощью апробированного ранее метода FRET (Gupta et al., 1998). Филаменты RecA были собраны на однонитевой ДНК (10 мкМ) длиной 102 основания в присутствии различных концентраций ионов Mg2+ (2 мМ и 10 мМ) и негидролизуемого аналога АТФ – АТФS (1 мМ). Однонаправленный характер реакции обеспечивается исходным избытком онДНК, содержащейся в филаменте, относительно двунитевого олигонуклеотида, либо присутствием белка SSB.

Рисунок 8. Кинетика синаптазной реакции, проводимой белком RecA в присутствие 2 мМ Mg2+.

Реакцию проводили при 27С. Реакционная смесь: 25 мМ 40 RecA D112R трис-HCl (рН 7.5), 2 мМ MgCl2, 0.7 мМ АТФS, 3 мкМ однонитевого олигонуклеотида, 1.2 мкМ указанного RecA C17 белка RecA, 0.3 мкМ SSB и 1.5 мкМ меченого Флуоресценция, ОЕ двунитевого олигонуклеотида. Филаменты белка RecA были сформированы на онДНК в течение 5 минут преинкубации в присутствии АТФS и белка SSB.

RecA E38K Спаривание олигонуклеотидов инициировалось при добавлении меченой днДНК в момент времени, RecAEc соответствующий точке 0 на оси абсцисс.

2 мМ MgCl2 Скорость образования объединенных молекул белком RecA D112R значительно 0 10 20 30 Время, мин выше, чем в реакции, проводимой белком RecA дикого типа. Эффект становится еще более выраженным при снижении концентрации ионов Mg2+ в реакционной смеси: скорость образования объединенных молекул белками RecAEc и RecA E38K значительно замедляется, в то время как реакции, проводимые белками RecA D112R и RecA C17, не претерпевают заметных изменений (Рисунок 8).

ЗАКЛЮЧЕНИЕ Внесение точечных аминокислотных замен в белок RecA, особенно в область высоко консервативных аминокислотных остатков, может оказывать влияние на рекомбинационную активность бактериальной клетки и наблюдаемую in vivo ЧРО. Анализ ЧРО для 16 мутантных белков выявил белок RecA D112R – наиболее рекомбиногенный из известных на сегодняшний день белков RecA (его ЧРО в 52 раза выше, чем у белка RecA дикого типа). Повышенная рекомбиногенность RecA D112R проявляется на фоне почти полного отсутствия SOS-ответа, что обычно не характерно для белков RecA из E. coli.

Анализ его активностей выявил, что скорость гидролиза АТФ белком RecA D112R при 37С в присутствии онДНК фага М13 и белка SSB не отличается от скорости гидролиза АТФ белком RecAEc в тех же условиях. При этом белок RecA D112R характеризуется повышенной скоростью связывания с онДНК фага М13 в отсутствие SSB, а также способностью более эффективно смещать белки SSB и FSSB с онДНК, чем RecAEc, особенно при снижении концентрации ионов Mg2+ с 10 мМ до 4 мМ. Кроме того, белок RecA D112R более устойчив к действию таких ингибирующих онДНК-зависимую АТФазу белков, как RecX и PsiB.

Устойчивость RecA D112R к действию RecX и более эффективное конкурирование с SSB за сайты связывания на онДНК, чем у RecAEc, делают его полезным инструментом для изучения механизма регуляции филамента RecA белком RecX. Филамент RecA D112R обладает устойчивостью к RecX и в эксперименте с поли(дТ) при полном отсутствии SSB. Нами предложена модель, в которой мономеры мутантного белка RecA в ходе элонгации филамента эффективно опережают связывание RecX с его растущим концом. Это объясняет преимущество RecA с повышенной динамикой филаментации, вызванной заменой D112R либо использованием дАТФ вместо АТФ, и разъясняет природу антагонизма между белками SSB и RecX: SSB занимает сайт онДНК перед филаментом и удерживает пространство на этом участке ДНК от взаимодействия с RecX, позволяя новым мономерам RecA достраивать филамент.

RecA D112R, превосходя RecAEc и RecA C17, уступает белку RecA E38K в способности смещать белки SSB и FSSB с онДНК, а также сохранять онДНК-зависимую АТФазную активность в присутствии белков RecX или PsiB. При этом RecA E38K увеличивает ЧРО в клетке в 7 раз, а RecA D112R – в 52.

Мы измерили скорость синаптазной реакции отдельно от процесса миграции ветви.

Скорость образования объединенных молекул белком RecA D112R оказалась выше, чем белком RecA E38K. Это различие особенно заметно при снижении концентрации ионов Mg2+ в реакционной смеси с 12 до 2 мМ, что, возможно, больше соответствует условиям, наблюдаемым in vivo.

На сегодняшний день белок RecA D112R является единственным из исследованных мутантных белков RecA, характеризующихся повышенной рекомбиногенностью, чей путь усиления рекомбинационной активности связан с качественным изменением такой функции филамента, как поиск гомологичной нити ДНК для инициирования синаптазной реакции.

ВЫВОДЫ 1) Белок RecA D112R увеличивает частоту рекомбинационных обменов на единицу длины ДНК in vivo в 52 раза, являясь наиболее рекомбинационно активным из изученных на сегодняшний день мутантных белков RecA.

2) В популяции клеток E. coli с аномально высокой RecAD112R-зависимой рекомбинацией наблюдается постепенный отбор клеток со сниженной гиперрекомбинацией. Селекция приводит к снижению рекомбинационной активности до нормального уровня.

3) Мутантный белок RecA D112R по сравнению с белком RecAEc обладает:

а) повышенной способностью расплавлять вторичные структуры на онДНК;

б) повышенной способностью смещать белок SSB с онДНК, в том числе при снижении концентрации ионов магния в реакционной смеси;

в) повышенной способностью смещать белок FSSB c онДНК;

г) повышенной устойчивостью к ингибирующему воздействию белков PsiB и RecX;

д) повышенной скоростью проведения реакции обмена нитей ДНК при снижении концентрации ионов магния в реакционной смеси.

4) Устойчивость филамента RecA к ингибирующему действию белка RecX определяется не только силой межбелковых RecA-RecX взаимодействий, но и динамикой филаментации RecA на онДНК.

5) Высокая рекомбиногенность мутантного белка RecA D112R обеспечивается повышенной скоростью инициирования синаптазной реакции.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Дудкина А.В., Швецов А.В., Бахланова И.В., Байтин Д.М. Изменение динамики филаментации белка RecA, вызванное аминокислотной заменой D112R либо замещением ATP на dATP, приводит к устойчивости филамента к действию белка RecX // Мол. Биол. – 2011. – Т.45. – С. 1-8.

2. Дудкина А.В., Бахланова И.В., Байтин Д.М. Новый механизм увеличения частоты рекомбинационных обменов путем повышения синаптазной активности белка RecA из Escherichia coli // ДАН. - 2010. - Т.432. - С. 120-122.

3. Bakhlanova I.V., Dudkina A.V., Baitin D.M., Knight K.L., Cox M.M., Lanzov V.A., Modulating cellular recombination potential through alterations in RecA structure and regulation // Mol. Microbiol. 2010. - V. 78. - P. 1523-1538.

4. Ланцов В.А., Бахланова И.В., Дудкина А.В. и Киль Ю.В. Регулирование рекомбиназной активности у бактерий // Молекулярная генетика, биофизика и медицина сегодня. Бреслеровские чтения 2 (2006): – ред. Ланцов В. – Издательство ПИЯФ РАН – 2007. – С. 110-123.

5. Dudkina A.V., Bakhlanova I.V. and Lanzov V.A. Normalization of recombination activity of RecA protein in Escherichia coli cells // «Russian-Swiss Workshop on Regulation of genome stability by DNA replication and repair (July 7-9, 2010, St. Petersburg, Russia)». – 2010. – P. 41.

6. Дудкина А.В., Бахланова И.В., Ланцов В.А., Байтин Д.М., Кокс М.М. Влияние точечной мутации [D112R] на рекомбинационную активность белка RecA из Escherichia coli in vitro // «Молодые ученые – промышленности Северо-Западного региона: материалы конференций политехнического симпозиума (20 мая 2010 года)». – 2010. - С. 202-203.

7. Дудкина А.В., Байтин Д.М., Ланцов В.А. Влияние точечной мутации [D112R] на рекомбинационную активность белка RecA из Escherichia coli // «БИОЛОГИЯ – НАУКА ХХI ВЕКА: 14-я Пущинская международная школа-конференция молодых ученых», (Пущино, 19 - апреля 2010 года)», сборник тезисов. – 2010. - Т. 2. - С. 130-131.

8. Дудкина А.В., Бахланова И.В., Ланцов В.А. Нормализация рекомбиназной активности белка RecA в клетках Escherichia coli //«Наука и инновации в технических университетах», материалы всероссийского форума студентов, аспирантов и молодых ученых. – 2008. – С. 178-179.

9. Дудкина А.В., Бахланова И.В., Ланцов В.А. Рекомбиназная активность белка RecA в клетках Escherichia coli: ее регуляция и влияние на систему биологической подвижности // «БИОЛОГИЯ – НАУКА ХХI ВЕКА: 12-я Пущинская международная школа-конференция молодых ученых», (Пущино, 10 - 14 ноября 2008 года)», сборник тезисов. – 2008. – С. 21-22.

10. Дудкина А.В., Ланцов В.А. Регуляция гиперрекомбиназной активности белка RecA в клетках Escherichia coli // «Биология – наука XXI века: 11ая конференция молодых ученых в Пущино», сборник тезисов. – 2007. – С. 77.

11. Дудкина А.В., Ланцов В.А. Структурно-функциональные изменения в геноме Escherichia coli, связанные с гиперрекомбиназной активностью белка RecA // «Молодые ученые – промышленности Северо-Западного региона», материалы семинаров политехнического симпозиума. – 2006. – С. 186.

12. Дудкина А.В., Ланцов В.А. Гиперрекомбинация: роль интерфейса межсубъединичного взаимодействия в активном филаменте белка // «Молодые ученые – промышленности Северо Западного региона», материалы семинаров политехнического симпозиума. – 2005. – С. 37-38.

СПИСОК ЦИТИРОВАННОЙ ЛИТЕРАТУРЫ 1. Baitin D.M., Gruenig M.C. and Cox M.M. SSB antagonizes RecX-RecA interaction // J. Biol. Chem. – 2008. – V. 283. – P. 14198-14204.

2. Bakhlanova I.V., Ogawa T. and Lanzov V.A. Recombinogenic activity of chimeric recA genes (Pseudomonas aeruginosa/Escherichia coli): a search for RecA protein regions responsible for this activity // Genetics. - 2001. – V. 159. – P. 7–15.

3. Chen Z., Yang H. and Pavletich N.P. Mechanism of homologous recombination from the RecA ssDNA/dsDNA structures // Nature. - 2008. – V. 453. – P. 489-454.

4. Chervyakova D., Kagansky A., Petukhov M. and Lanzov V. [L29M] substitution in the interface of subunit-subunit interactions enhances Escherichia coli RecA protein properties important for its recombinogenic activity. // J. Mol. Biol. - 2001. - V. 314. - P. 923-935.

5. Clark A.J. and Margulies A.D. Isolation and characterisation of recombination-deficient mutants of Escherichia coli K12 // Proc. Natl. Acad. Sci. USA. - 1965. - V. 53. - P. 451-459.

6. Cox M.M. and Lehman I.R. Directionality and polarity in RecA protein-promoted branch migration // Proc. Natl. Acad. Sci. USA. - 1981. - V. 78. - P. 6018-6022.

7. Cox M.M. Regulation of Bacterial RecA Protein Function // Crit. Rev. Biochem. Mol. Biol. - 2007. V. 42. - P. 41–63.

8. Drees J.C., Lusetti S.L., Chitteni-Pattu S., Inman R.B., and Cox M.M. A RecA filament capping mechanism for RecX protein. // Mol. Cell. – 2004b. – V. 15. – P. 789-798.

9. Eldin S., Forget A.L., Lindenmuth D.M., Logan K.M. and Knight K.L. Mutations in the N-terminal region of RecA that disrupt the stability of free protein oligomers but not RecA-DNA complexes // J.

Mol. Biol. - 2000. – V. 299. – P. 91-101.

10. Galletto R. and Kowalczykowski S.C. RecA // Curr. Biol.-2007.-V. 17. - P. 395-397.

11. Grunberg-Manago M. Messenger RNA stability and its role in control of gene expression in bacteria and phages // Annu. Rev. Genet. - 1999. – V. 33. – P. 193–227.

12. Gupta R.C., Golub E.I., Wold M.S. and Radding C.M. Polarity of DNA strand exchange promoted by recombination proteins of the RecA family // Proc. Natl Acad. Sci. USA. – 1998. – V. 95. – P. 9848 9848.

13. Jones A.L., Barth P.T. and Wilkins B.M. Zygotic induction of plasmid ssb and psiB genes following conjugative transfer of Incl1 plasmid Collb-P9 // Mol. Microbiol. - 1992. – V. 6. – P. 605–613.

14. Lusetti S.L, Shaw J.J. and Cox M.M. Magnesium ion-dependent activation of the RecA protein involves the C terminus // J. Biol. Chem. – 2003. – V. 278. – P. 16381-16388.

15. Madiraju M.V., Lavery P.E., Kowalczykowski S.C. and Clark A.J. Enzymatic properties of the RecA803 protein, a partial suppressor of recF mutations // Biochemistry. - 1992. – V. 31. – P. 10529– 10535.

16. Menetski J.P. and Kowalczykowski S.C. Enhancement of Escherichia coli RecA protein enzymatic function by dATP // Biochemistry. – 1989. – V. 28. – P. 5871-5881.

17. Petrova V., Chitteni-Pattu S., Drees J.C., Inman R.B. and Cox M.M. An SOS Inhibitor that Binds to Free RecA Protein: The PsiB Protein // Mol. Cell. – 2009. – V. 36. – P. 121-130.

18. Ragone S., Maman J.D., Furnham N., Pellegrini L. Structural basis for inhibition of homologous recombination by the RecX protein // EMBO J. – 2008. – V. 27. – P. 2259-2269.

19. Story R.M., Weber I.T. and Steitz T.A. The structure of the Escherichia coli RecA protein monomer and polymer // Nature. - 1992. - V. 355. - P. 318-325.

20. Wigle T.J. and Singleton S.F. Directed molecular screening for RecA ATPase inhibitors // Bioorg.

Med. Chem. Lett. - 2007. - V. 17. - P. 3249-3253.

21. Бреслер С.Е. и Ланцов В.А. Индуцированная рекомбинация у Escherichia coli K-12:

рекомбиногенный эффект tif 1 // Докл. Акад. Наук. - 1978. - Т. 238. - С. 715-717.

22. Кассандрова О.Н., Лебедев В.В. Обработка результатов измерений. // Москва: Наука. - 1970.

23. Ланцов В.А. Гомологическая ДНК-трансфераза RecA: функциональные активности и поиск гомологии рекомбинирующими ДНК // Молекулярная биология. - 2007. - Т. 41. - C. 1-12.

24. Миллер Дж. Эксперименты в молекулярной генетике. // Москва: Мир. - 1976.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.