авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Медицинский университет удк 616-002.5:616.982.2:576.852.211(476)+(55) сетарэ мохаммад молекулярно-генетическая характеристика лекарственно-резистентных штаммов m. tuberculosis, выделенных от больных т

УЧРЕЖДЕНИЕ ОБРАЗОВАНИЯ «БЕЛОРУССКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ» УДК 616-002.5:616.982.2:576.852.211(476)+(55) Сетарэ Мохаммад МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА ЛЕКАРСТВЕННО-РЕЗИСТЕНТНЫХ ШТАММОВ M. TUBERCULOSIS, ВЫДЕЛЕННЫХ ОТ БОЛЬНЫХ ТУБЕРКУЛЕЗОМ Автореферат диссертации на соискание ученой степени кандидата биологических наук по специальности 03.00.07 – микробиология Минск 2009 1 Работа выполнена в УО «Белорусский государственный медицинский университет» и в ГУ «Республиканский научно-практический центр пульмонологии и фтизиатрии» Научные руководители: Титов Леонид Петрович, доктор медицинских наук, профессор, член-корреспондент НАН Беларуси, заведующий лабораторией клинической и экспериментальной микробиологии ГУ «Республиканский научно практический центр эпидемиологии и микробиологии Суркова Лариса Константиновна, доктор медицинских наук, главный научный сотрудник ГУ «Республиканский научно-практический центр пульмонологии и фтизиатрии» Официальные оппоненты: Барковский Евгений Викторович, доктор биологических наук, профессор, заведующий кафедрой общей химии УО «Белорусский государственный медицинский университет» Зинченко Анатолий Иванович, доктор биологических наук, профессор, член корреспондент НАН Беларуси, заведующий лабораторией биотехнологии соединений нуклеиновой природы ГУ «Институт микробиологии НАН Беларуси» Оппонирующая организация: УО «Международный государственный экологический университет им.

А.Д. Сахарова» Защита состоится 23 декабря 2009 г. в 12.00 часов на заседании совета по защите диссертаций Д 03.18.04 при УО «Белорусский государственный медицинский университет» (220116, г. Минск, пр-т Дзержинского, 83, тел. 272-55-98).

С диссертацией можно ознакомиться в библиотеке УО «Белорусский государственный медицинский университет».

Автореферат разослан «» 2009 года.

Ученый секретарь совета по защите диссертаций, кандидат медицинских наук, доцент А. М. Близнюк ВВЕДЕНИЕ Туберкулез (ТБ) – хроническое инфекционное заболевание, которое по прежнему остается одной из актуальных проблем практического здравоохранения во всем мире. Так, известно, что микобактерия туберкулеза (МБТ) вызывает большее число смертей, чем любой другой отдельно взятый патогенный микроорганизм. Ежегодно более 8 млн человек заболевают ТБ и около 2 млн умирают от него. В Республике Беларусь летальность от ТБ составляет более 70% от всех инфекционных и паразитарных болезней.

В Иране данная проблема также актуальна. В связи с этим необходимо проводить динамический контроль частоты встречаемости резистентных к противотуберкулезным препаратам (ПТП) микобактерий, что позволит прогнозировать эпидемическое распространение множественно резистентных микобактерий и стратегические меры к противодействию распространения множественно лекарственно устойчивых (MDR) и широко лекарственно устойчивых (XDR) форм ТБ, а также разработать тактику адекватного лечения [C. Arnold, 2007;

R. Brosch 2002;

I. Filliol, 2006;

C. Dye, 2006].

Геномические аспекты резистентности МБТ к ПТП изучены недостаточно, особенно ответ генома бактерий на их селективное давление вследствие интенсивного применения [J. Palomino, 2007;

S. Sreevatsan, 1997].

С целью изучения молекулярно-генетической характеристики множественно резистентных штаммов МБТ, выделенных от больных ТБ, было выполнено данное исследование.

Значимость рассматриваемых проблем и важность их дальнейшего изучения свидетельствуют об актуальности работы.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ Связь работы с крупными научными программами, темами.

Исследование выполнено в рамках ГНТП «Инфекции и микробиологические биотехнологии», научный руководитель член-корреспондент НАН Беларуси, профессор, доктор медицинских наук Л.П. Титов (научный проект 02. «Разработать тест-систему для молекулярно-генетической диагностики туберкулеза и изучить молекулярные механизмы формирования резистентности возбудителя туберкулеза в Республике Беларусь», научный руководитель доктор медицинских наук Л.К. Суркова).

Цель и задачи исследования: разработать новые методы молекулярно генетической идентификации резистентных штаммов МТБ, изучить особенности (доминирующие генотипы, характер мутаций) множественно резистентных штаммов МБТ, выделенных от больных ТБ.

В соответствии с поставленной целью исследований решались следующие задачи:

1. Определить частоту и спектр мутаций, их локализацию, связь с резистентностью к ПТП по результатам амплификации и секвенирования регуляторных генов whiB7, katG и gyrA изолятов M. tuberculosis.

2. Провести генотипирование множественно-резистентных к противотуберкулезным препаратам МБТ, выделенных от пациентов.

3. Разработать новые методы молекулярно-генетической индикации и идентификации возбудителей ТБ.

4. Установить особенности обнаружения MDR- и XDR-штаммов M. tuberculosis у больных ТБ разных возрастов и пола.

Объект исследования: 152 штамма множественно резистентных МБТ (из которых 109 изолятов являлись MDR, 31 – XDR и 9 – чувствительными к ПТП). Два стандартных штамма (H37Rv, академический), а также изолят M. bovis были использованы в качестве контроля. Информация о больных ТБ включала пол, возраст, уровни резистентности к ПТП.

Предмет исследования: фрагменты генов katG, gyrA и whiB множественно резистентных штаммов МБТ, обусловливающих резистентность к ПТП (как минимум – к рифампицину и изониазиду).

Положения, выносимые на защиту 1. Частота и характер компенсаторных мутаций гена KatG в популяции M. tuberculosis, выделенных от больных активным туберкулезом, ассоциируется с селективным давлением широко применяемого в клинической практике противотуберкулезного препарата изониазида.





Определение мутаций KatG методом ПЦР-ПДФР потенциально применимо для экспресс-диагностики множественной резистентности M. tuberculosis к изониазиду.

2. Популяция M. tuberculosis, выделенных от больных активным ТБ, характеризуется генотипической гетерогенностью. Генетическая структура представлена тремя группами. Впервые установлено, что 73 (48,0±4,0%) штаммов МБТ, выделенных от больных ТБ, принадлежали к генетической группе 1 (Bejing), 51 (33,5±3,8%) – к группе 2 и 28 (18,4±3,14%) – к группе 3.

Данная тенденция прослеживается в популяции M. tuberculosis, выделенных от больных ТБ в пенитенциарных учреждениях. Частота выделения МБТ 1-й генетической группы составляет 45,5% всех изолятов.

3. Определение присутствия в геноме M. tuberculosis регуляторного гена whiB7, не содержащего мутаций, является надежным генетическим маркером для MDR-, XDR- и чувствительных штаммов, что позволяет дифференцировать их от непатогенных изолятов и нетуберкулезных референс-штаммов.

4. Больные туберкулезом, у которых были выделены изоляты M. tuberculosis с разным уровнем резистентности к противотуберкулезным препаратам, различались по полу и возрасту. Множественнорезистентные варианты возбудителя выделялись преимущественно среди мужчин трудоспособного возраста (25–44 года), на долю которых приходится 660 случаев (70,66±1,5%), в то время как они были выделены у 274 женщин (29,33±1,5%). Детей с XDR-ТБ в анализируемой группе не было выявлено.

Личный вклад соискателя. Соискателем лично выполнены все молекулярно-генетические исследования по выявлению мутаций в генах whiB7, gyrA и katG (ПЦР, ПЦР-ПДФР, секвенирование), проведен эволюционный биоинформатический анализ, написание всех глав диссертации и оформление диссертационной работы. Предоставление темы исследования, курирование и методическое консультирование по выполнению работы были осуществлены научными руководителями:

членом-корреспондентом НАН Беларуси, доктором медицинских наук, профессором Л.П. Титовым и доктором медицинских наук Л.К. Сурковой.

Диссертантом лично осуществлена разработка подходов к решению поставленных задач, получен, обобщен, проанализирован и опубликован экспериментальный материал работы. В соответствии с международными правилами, соавторами научных работ диссертанта являются сотрудники РНПЦ пульмонологии и фтизиатрии и РНПЦ эпидемиологии и микробиологии, выполнявшие бактериологические исследования по выделению МБТ и осуществлявшие методические консультации при проведении молекулярно-биологических исследований. Во всех представленных публикациях диссертанту принадлежит анализ данных литературы и итогов собственных экспериментальных наблюдений, статистическая обработка данных.

Апробация результатов диссертации. Основные результаты исследований доложены и обсуждены на 1-й Конференции иранских студентов (г. Минск, 4 апреля 2008 г.), X Международном конгрессе МАКМАХ/ESCMID по антимикробной терапии (г. Москва, Россия, 21–23 мая 2008 г.), 3rd EFS Functional Genomics Conference 2008 (г. Инсбрук, Австрия, 1–4 октября 2008 г.), Международной научно-практической конференции «Современные проблемы инфекционной патологии человека» (г. Минск, 16–17 октября 2008 г.), І Международной научной конференции студентов, аспирантов и молодых ученых «Фундаментальные и прикладные исследования в биологии» (г. Донецк, Украина, 23–26 февраля 2009 г.), 2-й Конференции иранских студентов (г. Минск, 10 апреля 2009 г.), Международной научной конференции по туберкулезу в Иране (г. Тегеран, 13–16 октябрь, 2009 г.).

Опубликованность результатов диссертации. Основные положения диссертации опубликованы в 10 научных работах, 4 из которых – статьи в рецензируемых журналах и 6 – тезисы в материалах международных конференций. Общий объем публикаций составил 4 авторских листа.

Структура и объем диссертации. Диссертационная работа состоит из введения, общей характеристики работы, обзора литературы, объектов и методов исследования, изложения и обсуждения результатов собственных исследований (3 главы), заключения, библиографического списка, включающего 190 использованный источник (22 на русском и 168 – на иностранных языках) и 10 публикаций соискателя. Работа содержит 19 таблиц и 23 рисунка, изложена на 107 страницах, из которых основной текст – 87 страниц, таблицы и рисунки – 3 страницы, библиографический список – 19 страниц.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ Материалы и методы исследования Материалом для проведения микробиологических и молекулярно биологических исследований являлась мокрота, полученная от 144 пациентов с ТБ легких из различных регионов Беларуси, а также 5 образцов ДНК МБТ из Ирана, полученных за период с мая 2007 г. по декабрь 2008 г.

Два стандартных штамма – H37Rv и академический, а также изолят M. bovis были использованы в качестве контроля.

Для определения лекарственной чувствительности к ПТП применяли метод пропорциональных разведений в питательной среде с использованием автоматического анализатора BACTEC.

Молекулярно-генетическое исследование M. tuberculosis Выделение ДНК для проведения ПЦР. Выделение ДНК из изолятов проводилось модифицированным методом с использованием Chelex-100.

Концентрацию выделенной ДНК измеряли с помощью анализатора нуклеиновых кислот (DU 730, Life Science UV/Vis спектрофотометр).

ПЦР-амплификация фрагментов генома. Амплификацию фрагментов генома клинических изолятов МБТ (генов whiB7, katG, gyrA) выполняли описанным ниже способом с целью последующего проведения методов ПДФР или секвенирования.

Определение гена whiB7. Для проведения ПЦР амплификации гена whiB7 использовали следующие праймеры (таблица 1).

Определение гена katG. Амплификацию сегмента katG размером 975 п.о.

для определения мутаций в KatG315 и KatG463 проводили с использованием следующих праймеров: прямой 5-TTCGGCCGGGTCGACCAGT-3, обратный 5-CGGAATTCCAGGGTGCGAATGACCT-3;

и для секвенирования:

5-TGCGGTCGAAACTAGCTGTGA-3.

Таблица 1 – Праймеры, использованные для ПЦР амплификации гена whiB ДНК- Направ- Размер Праймеры (5'-3') мишени ление продукта, п.о.

F CAGACAAAGATTGCCGGTTT whiB R TCGAGCCTTGGTCGAATATC F AAGCTTATCGATGGTGTGAGACGTGTGCAGC w R TCCGCGCAAGGATGCTGTTGCATAGTCTAGATC F AAGCTTATCGATGGTGTGAGACGTGTGCAGC w R CCGCGCAAGGATGCTGTTGCATAGTCTAGATC F AGCTGCTGCCACCGGTTAAC w R CCGCGCAAGGATGCTGTTGCATAGTCTAGATC F TTAACCTCCAGGTCGCATTCTGCT wt R GAAAGTTTGGCCACGGATCCTGT F AGGTCAGAAAATCGGTTGTGGTCAGC wt R TGGTGGCGGTTCTTCGAAAGTGAT Определение гена gyrA. Полиморфизм в кодоне 95 гена gyrA определяли путем ПЦР-амплификации фрагмента ДНК размером 194 п.о.

с праймерами gyrA: прямой 5-CGATTCCGGCTTCCGCCCGG-3, обратный 5-CCGGTGGGTCATTGCCTGGCG-3;

и для секвенирования:

5-CCGGTGGGTCATTGCCTGGCG-3.

Амплификацию осуществляли с использованием термоциклера «Rotor Gene» (RG-3000, Corbett Research Inc.). Для подтверждения точечных мутаций, секвенирование фрагментов проводили с использованием автоматического ДНК-секвенатора (Amersham auto sequencer).

ПЦР-ПДФР. Для обнаружения мутаций в katG, обусловливающих резистентность к изониазиду, использовался метод ПДФР с применением HpaII-расщепления (сайт рестрикции ЦЦГГ) по методу Leung E.T.Y. (2003).

Для амплификации фрагмента гена katG длинной 620 п.о. использовали прямой праймер katG904 (5’-AGCTCGTATGGCACCGGAAC-3’, 904–923) и обратный праймер katG1523 (5’-TTGACCTCCCACCCGACTTG- 3’, 1523–1502).

Статистическая обработка данных осуществлялась с использованием компьютерных программ «Statistica 6.0» и «Microsoft Excel XP», достоверными считались различия при уровне значимости p0,05.

Результаты и их обсуждение Характеристика устойчивости изолятов M. tuberculosis, выделенных от больных туберкулезом За период с января 2007 г. до января 2008 г. была обследована мокрота, полученная от 934 граждан Беларуси с диагностированным ТБ. Анализ информации о больных ТБ показал, что среди заболевших преобладали мужчины – 660 человек или 70,66±1,5%, в то время как женщин было 274 человека (29,33±1,5%) (P0,001), В возрастных группах 25–65 лет среди заболевших доля мужчин была в 2,7–9,0 раз больше, чем женщин.

В возрасте до 15 лет, а также в возрастной группе старше 65 лет среди больных преобладали лица женского пола;

в возрастной группе 25–44 года и 55–65 лет доля мужчин и женщин была одинаковой;

в возрасте 45–54 года преобладали мужчины (P0,05).

Наибольшее соотношение больных ТБ мужчин к женщинам отмечено в группе 45–55 лет. Общее соотношение числа больных ТБ мужчин к числу больных женщин для всех групп обследованных нами в 2007 г. пациентов составило 2,4, что согласуется с данными ВОЗ по Европейскому региону.

В возрастных группах 25–44 года и 45–54 года соотношение мужчин и женщин было максимальным среди пациентов с TMDR-ТБ.

Всего было обследовано и проанализировано 756 пациентов трудоспособного возраста, причем 570 (75,4±1,56%) из них – мужчины (трудоспособный возраст 18–60 лет), а 186 (24,6±1,56%) – женщины (трудоспособный возраст 18–55 лет). В группе больных трудоспособного возраста чувствительные, монорезистентные, а также TMDR и XDR варианты возбудителя чаще выявлялись у мужчин (P0,05). Следует отметить, что 560 (59,95±1,6%) всех пациентов страдали MDR- и FLR-ТБ (TMDR), то есть выделяли возбудителя, резистентного, как минимум, к изониазиду и рифампицину. 51,78±2,1% всех пациентов с TMDR-ТБ относились к FLR-группе.

Случаев вторичного ТБ было 414 (52,02±1,77%), а первичного – (47,98±1,77%) (P0,05). В группе больных вторичным ТБ было 378 человек с лекарственно-устойчивыми МБТ (частота встречаемости 47,48±1,77%), что значительно больше, чем в группе страдающих первичным ТБ – (24,8±1,52%) (P0,05).

Молекулярно-генетическое исследование клинических изолятов методами секвенирования и ПДФР позволило определить основные генетические группы для 152 изолятов возбудителя, полученных от больных ТБ. Среди них было 140 штаммов резистентных к изониазиду, 109 из которых обладали характеристиками MDR и 31 – характеристиками XDR.

Было также исследовано девять отобранных случайным образом чувствительных к изониазиду изолятов и три стандартных штамма в качестве контрольных Полученные данные указывают, что среди чувствительных к ПТП микобактерий представители I, II и III генетических групп выявлялись примерно с одинаковой частотой: 1-я – 33,3%, 2-я – 44,4% и 3-я – 22,2% (P0,05). Среди 109 изолятов, характеризующихся как MDR, преобладали варианты 1-й генетической группы – 78 (51,31±4,05%). Ко второй генетической группе относилось 48 изолятов (31,6±3,76%) и 26 изолятов (17,8±3,09%) принадлежали к группе 3. В этом случае представители 1-й генетической группы преобладали достоверно (P0,05). Среди 31 XDR изолята 15 (50,0±9,1%) также относились к 1-й группе, 12 (40,0±8,9%) и (12,90±6,0%) ко 2-й и 3-й группам, соответственно. Из 22 штаммов МБТ, выделенных от пациентов, пребывающих в пенитенциарных заведениях, 10 изолятов (45,5±10,9%) также принадлежали к генетической группе 1, 8 изолятов (36,4±10,5%) – к группе 2 и 4 изолята (18,2±8,4%) – к группе 3.

В связи с тем, что интенсивно распространяющийся высокорезистентный генетический вариант Beijing, принадлежащий к 1-й генетической группе, в настоящее время представляет угрозу здоровью населения многих стран мира можно предположить его распространение и на территории Беларуси.

Подтверждающими данное положение материалами является частота выявления бактерий 1-й генетической группы, которая доминирует среди анализируемых MDR и XDR изолятов (p0,05). Среди изолятов, выделенных от больных, проживающих в г. Минске и г. Могилеве, они составляют большинство (75% и 88% соответственно). Вместе с тем, структура основных генетических групп изолятов от больных ТБ из пенитенциарных учреждений не отличается от таковой изолятов, выделенных на всей территории страны.

Молекулярно-биологический анализ регуляторного гена whib в клинических изолятах M. tuberculosis Ген whiB7 состоит из промотора размером 429 п.о. и структурной области размером 279 п.о. Ген whiB7 МБТ является центральным регулятором, координирующим экспрессию семейства генов резистентности, которые способны приводить к инактивации проникающих через цитоплазму антибиотиков.

Чтобы избежать возможного искажения результатов, секвенирование 33 клинических изолятов МБТ из различных регионов Беларуси (г. Минск, Витебская, Гомельская, Гродненская, Могилевская и Минская области), среди которых было 6 чувствительных, 12 MDR и 15 XDR, проводилось многократно. Результаты секвенирования регуляторного гена whiB7 не выявили ни одной мутации в промоторной области данного гена ни в одном из исследованных изолятов. Все последовательности обрывались стоп кодоном «ТГА». Мутаций в структурном гене whiB7 клинических изолятов выявлено не было.

Сравнительное исследование белка WhiB7 изолятов во всех случаях выявило типичную структуру. Упомянутый протеин состоит из 93 аминокислот (279 нуклеотидов). На рисунке 1 видны четыре консервативных цистеина – Cys-X22-Cys-X2-Cys-X5-Cys – с отсутствием каких-либо мутаций в упомянутых положениях, а также консервативный НТН-фрагмент, характеризующийся остаточной сигнатурой G-(V)-W-G-G и С-терминальный «AT-Hook».

Рисунок 1 – Структура протеина WhiB7 клинических изолятов Исследование, посвященное скринингу гена whiB7 в клинических изолятах, выявило, что ни в структурном гене, ни в промоторе у клинических изолятов каких-либо мутаций не обнаруживается.

Полученные данные могут помочь в разработке ингибитора для уникальной последовательности нуклеотидов у всех клинических форм (чувствительных, MDR, XDR) изолятов микобактерий.

Новый метод экспресс-идентификации микроорганизмов группы M. tuberculosis путем ПЦР-анализа регуляторного гена whiB Для контроля за распространением ТБ огромный интерес представляет ранняя диагностика. Применяемые методы культуральной диагностики отнимают много времени, поскольку занимают приблизительно 3–6 недель.

Возможным индикатором присутствия МБТ в клиническом образце является образование фрагмента ДНК whiB7. Предпочтительным является определение ДНК в образцах мокроты человека. Преимуществом метода является минимальная предварительная обработка образца мокроты для его последующего проведения.

В случае применения обычных тестов реакция ПЦР запускается беспроблемно, особенно с использованием феномена мультипраймера или слабых связей. В этой связи были использованы некоторые программы для разработки нескольких идеальных праймеров. Лучшие их пары отбирались для амплификации фрагмента ДНК размером 667 п.о., состоящего из части промотора и структурного гена whiB7 (прямой 5-AGCTGCTGCCACCGGTTAAC-3, обратный 5-CCGCGCAAGGATGCTGTTGCATAGTCTAGATC-3).

Результаты исследования клинических изолятов. ПЦР идентификация чистых культур клинических изолятов МБТ была проведена в отношении 6 чувствительных, 12 MDR- и 15 XDR-изолятов из различных регионов Беларуси (таблица 2) и одного штамма M. bovis. ПЦР для ампликона whiB7 размером 667 п.о. была успешной для всех выделенных изолятов МБТ, включая стандартные, чувствительные, MDR- и XDR-изоляты, а также – M. bovis, т. е. специфичность составила 100%. Ни одного ПЦР негативного образца обнаружено не было.

Таблица 2 – Сравнение результатов ПЦР для некоторых генетических маркеров (katG, rpoB, whiB7), используемых в целях выявления в культурах бактерий группы M. tuberculosis Изоляты whiB7 rpoB Клинические изоляты (n=33) Чувствительные (n=6) + + MDR (n=12) + + XDR (n=15) + + Стандартные нетуберкулезные штаммы + M. avium ATCC 1603 + M. intracellulare + M. fortuitum ATCC 342 + M. terrae ATCC 15755 + M. phlei + M. kansasii Непатогенные изоляты K Ch – IV группа + BZ/NC – IV группа + 4 med – III группа + SIV –III группа + B-ZO – III группа + VZK – IV группа + SPK – III группа + Контрольные группы ZoP – Candida rubrum – as Control Mk – Candida rubrum – as Control + + M. bovis Результаты исследования непатогенных микобактерий. ПЦР гена whiB7 проводилась в целях дифференцировки 13 видов микобактерий, 6 из которых являлись стандартными нетуберкулезными штаммами, а 7 были непатогенными изолятами III и IV групп от животных и птиц, выделенными в лаборатории обычным путем (таблица 2). В качестве контроля использовались два изолята Candida rubrum. Результаты позволили выявить наличие соединений размером 667 п.о. только среди клинических изолятов M. tuberculosis и M. bovis. При исследовании всех других штаммов (непатогенных и нетуберкулезных) положительных результатов гена whiB получено не было.

Выявление M. tuberculosis в мокроте. От пациентов с клиническими симптомами ТБ были взяты 15 образцов мокроты, причем у 10 пациентов наличие МБТ было подтверждено, а у 5 – опровергнуто стандартным и коммерческим методами. Установлено, что продукты ПЦР размером 667 п.о. обнаружены во всех 10 заведомо положительных образцах мокроты, но не в остальных 5 негативных образцах (таблица 3).

Таблица 3 – Сравнение результатов ПЦР двух генетических маркеров (whiB7, rpoB), используемых для обнаружения бактерий группы M. tuberculosis в позитивных и негативных образцах мокроты Образец мокроты Результат культурального исследования whiB7 rpoB Результаты ПЦР позитивных образцов мокроты, проведенной коммерческим методом 1 + + + 2 + + + 3 + + + 4 + + + 5 + + + 6 + + + 7 + + + 8 + + + 9 + + + 10 + + + Результаты ПЦР негативных образцов мокроты, проведенной коммерческим методом 1N 2N 3N 4N 5N Таким образом, этот метод идентификации бактерий группы МБТ оказался достаточно информативным. Можно заключить, что ПЦР метод, основанный на определении гена whiB7, обладает рядом преимуществ, поскольку не было обнаружено мутаций в промоторе и в структурном гене whiB7 чувствительных и резистентных (MDR и XDR) клинических изолятов.

Это значит, что специфические праймеры (разработанные в рамках данного исследования) можно использовать повсеместно, несмотря на мутации, которые могли бы стать помехой при проведении ПЦР-отжига.

Характеристика генов резистентности к изониазиду и фторхинолонам у M. tuberculosis полученных от пациентов В работе было исследовано 152 клинических изолята, идентифицированных как МБТ. Соотношение мужчин и женщин составляло 2,08.

Тест на лекарственную чувствительность МБТ выявил, что 109 изолятов обладали MDR, 31 – XDR и 9 – являлись чувствительными к ПТП. Два стандартных штамма - H37Rv и академический, а также изолят M. bovis были использованы в качестве контроля.

С помощью метода секвенирования и ПЦР-ПДФР у 97,8% всех изониазид-резистентных изолятов (97,2% MDR- и всех XDR-изолятов) были обнаружены мутации в KatG315. Из 140 изолятов, устойчивых к изониазиду (включая 109 MDR и 31 XDR), 137 изолятов (97,8±1,2%) имели мутацию в KatG315. Из девяти отобранных случайным образом чувствительных к изониазиду изолятов и трех стандартных штаммов, включенных в исследование, ни в одном случае не было обнаружено мутаций в KatG315.

Ампликоны katG были исследованы методом рестриктивно-эндонуклеазного анализа ПДФР с использованием HpaII-расщепления. На основе полученных результатов были выделены 4 отдельных варианта ПДФР. Вариант А соответствовал отсутствию мутаций в обоих кодонах (KatG315 и KatG463).

Примененный метод ПДФР по Leung E.T.Y. выявил потерю сайта рестрикции для HpaII, возникающую в присутствии R463L и S315T.

Фермент рестрикции HpaII (ЦЦГГ) разрезает дикий тип ампликона в трех местах, в то время как ампликон с мутацией Арг463Лей (ЦГГ ЦТГ) – в двух (рисунок 2).

Распространенность мутаций в KatG315. По результатам нашего исследования, мутации в KatG315 обнаружены у 100% высокорезистентных изолятов с XDR и у 97,2% MDR-изолятов, что в целом соответствует данным Piatek A.S. et al. (2000) и Soolingen V.D. et al. (2000).

Здесь следует отметить, что к развитию MDR может привести неправильное применение изониазида (прием его пациентами в дозах ниже терапевтической), вызывающее активацию регуляторного гена whiB7.

Транскриптивный регулятор whiB7 контролирует гены в пределах крупного блока генов антибиотикорезистентности – резистомов и посредством их активации приводит к уменьшению проницаемости клеточной стенки в отношении изониазида (и некоторых других антибиотиков), вследствие чего возникает необходимость применения более высоких доз препарата для достижения клинического эффекта.

Mаркер Mаркер ПДФР ПЦР H37Rv 5X 117X 3366 7115 1511 1522 1193 1499 1550 1452 5M H37Rv H238 BCD A A DDDD CD C 620 п.о.

Рисунoк 2 – Электрофорез результатов ПЦР Примечание – Стандартный штамм H37Rv и два резистентных изолята, формирующих соединения размером 620 п.о., и продукты ПДФР штамма H37Rv, одного чувствительного (Н238) и 10 резистентных изолятов. Варианты А и В представляют собой немутантный KatG315, а С и D – мутантный KatG315.

В заключение следует отметить, что частота изолятов с мутантными KatG315, может быть ассоциирована с географическими условиями региона, распространенностью туберкулеза в популяции человека, уровнем резистентности (МИК изониазида), а также режимом назначения противотуберкулезных препаратов и особенностями их приема пациентами.

Полученные результаты исследования демонстрируют высокую распространенность мутаций в KatG315-гене изолятов МБТ, выделенных от пациентов из пенитенциарных учреждений Беларуси. У штаммов, обладающих лекарственной устойчивостью, данная мутация наблюдалась в 97,8–100% случаев. Результаты работы позволяют предложить метод ПЦР ПДФР к применению с целью быстрого и высокоспецифичного выявления резистентных форм МБТ.

Распространенность мутаций в кодоне 463 katG-гена. Мутации в кодоне KatG463 были обнаружены у 3 (3,5±2,0%), 63 (75,5±4,7%) и (21,4±4,47%) включенных в исследование клинически восприимчивых, MDR и XDR изолятов, соответственно.

Стандартные штаммы H37Rv и академический не имели мутаций в кодоне KatG463, в то время как изоляты M. bovis соответствовали варианту реакции В, то есть имели мутации в этом кодоне. В целом, из 149 изолятов (кроме стандартных штаммов и M. bovis) в 84 случаях (56,37±4,0 %) отмечались мутации в KatG463 (P0,05). С другой стороны, 6 (9,23±3,58%) из чувствительных изолятов не имели мутаций в данном кодоне, а (3,5±2,0%) (P0,05) – содержали мутантный кодон. Нет никакой разницы между чувствительными и устойчивыми.

Изучение полиморфизма KatG315 и KatG463 в клинических изолятах M. tuberculosis, полученных от больных туберкулезом легких в пенитенциарных заведениях. Включенные в исследование 22 образца мокроты принадлежали заключенным-мужчинам в возрасте 24–51 год, страдающим активным ТБ легких.

Исследование выделенных из мокроты МБТ на чувствительность к ПТП выявило, что 19 (86,4%) изолятов характеризовались как MDR, а (13,6%) – как XDR. Также исследовались 8 чувствительных к ПТП изолятов, выделенных от случайно подобранных пациентов, не являющихся заключенными. В качестве позитивного контроля с мутацией в KatG использовался штамм M. bovis.

Для всех изолятов, как резистентных, так и чувствительных, была проведена ПЦР с использованием праймеров для амплификации фрагмента длиной 620 п.о. Последующий ПДФР-анализ обнаружил мутации в KatG у 21 (95,4%) из всех резистентных изолятов и в KatG463 – у 10 (45,5%) из них. В изолятах с XDR мутации в KatG315 были выявлены во всех случаях (100%), в то время как в KatG463 – в 1 (33,3%). В группе чувствительных к изониазиду изолятов мутации в KatG315 выявлены не были, но в 3 случаях (37,5%) обнаруживались мутации в КatG463. Стандартные штаммы M. tuberculosis H37Rv и Академический не содержали мутаций ни в одном из этих кодонов.

Результаты проведения секвенирования ДНК для идентификации генов устойчивости к изониазиду. Автоматическое ДНК-секвенирование ампликона KatG в отобранных случайным образом изолятах, как резистентных, так и чувствительных к изониазиду, выявило 100% соответствие точечных мутаций таковым, обнаруженным методом ПЦР-ПДФР.

Секвенирование гена резистентности к фторхинолонам в изолятах M. tuberculosis. На 21 клиническом изоляте было проведено изучение молекулярных основ лекарственной резистентности МБТ к фторхинолоновым препаратам. Исследование базировалось на обнаружении областей, детерминирующих резистентность к хинолонам (QRDRs) гена ДНК-гиразы (gyrA) Результаты секвенирования нуклеотидов gyrA QRDRs у 2 чувствительных, 6 MDR- и 13 XDR-клинических изолятов обнаружили наличие скрытой мутации в QRDR области гена gyrA у одного из чувствительных и MDR изолятов.

Изучение молекулярных основ резистентности лекарственно-устойчивых клинических изолятов M. tuberculosis к фторхинолоновым препаратам выявило мутации в области QRDR гена gyrA клинических изолятов M. tuberculosis. У XDR-изолятов была определена частота аминокислотных и нуклеотидных замен в кодонах 90 и 94 гена gyrA. Было выявлено, что максимально часто, у восьми (61,5%) из XDR-изолятов, наблюдалась мутация в кодоне 94 (ГАЦ ААЦ или ГГЦ, ЦАЦ, ГТГ). Остальные 6 (46%) изолятов имели мутацию в кодоне 90 (ГЦГ ГТГ) и один изолят (1241 Х) имел две мутации одновременно в кодонах 90 (ГЦГ ГТГ) и (ГАЦ ЦАЦ).

Мутация в кодоне 95 была идентифицирована у всех 6 MDR и 12 (92%) XDR-изолятов, но не обнаруживалась, ни у одного из чувствительных изолятов. Учитывая, что MDR-изоляты не являются устойчивыми к фторхинолонам, было доказано что мутация в данном кодоне не имеет отношения к резистентности.

Исходя из вышесказанного, можно заключить, что определение аминокислотной последовательности областей, детерминирующих резистентность к хинолонам (QRDRs) в субъединице А ДНК-гиразы может быть использовано в качестве молекулярного теста для определения устойчивости микобактерий к фторхинолонам.

ЗАКЛЮЧЕНИЕ Основные научные результаты диссертации 1. Установлено, что из 140 изолятов, устойчивых к изониазиду (включая 109 MDR и 31 XDR), 137 изолятов (97,8±1,2%) имели мутацию в KatG315. Из девяти отобранных случайным образом чувствительных к изониазиду изолятов и трех стандартных штаммов, включенных в исследование, ни в одном случае не было обнаружено мутаций в KatG315.

Это подтверждалось высоким уровнем корреляции мутаций в KatG с MDR- и XDR-клиническими изолятами Mycobacterium tuberculosis в Беларуси. Таким образом, данный метод потенциально применим для экспресс-диагностики резистентности к изониазиду на основании обнаружения мутаций в KatG315 [2, 9, 10].

2. В целом, из 149 изолятов (кроме стандартных штаммов и M. bovis) в 84 случаях (56,37±4,0%) отмечались мутации в KatG463. С другой стороны, 6 (9,23±3,58%) из чувствительных изолятов не имели мутаций в данном кодоне, 3 (3,5±2,0%) (P0,05) – содержали мутантный кодон.

Мутации в кодоне KatG463 были обнаружены у 57,8% и 59,2% включенных в исследование MDR и XDR изолятов, соответственно. Нет никакой разницы между чувствительными и устойчивыми. Все вышесказанное позволило заключить, что кодон 463 является полиморфным сайтом, не связанным с резистентностью к изониазиду. Впервые в Республике Беларусь проведено молекулярно-генетическое исследование XDR-клинических изолятов M. tuberculosis методами секвенирования, ПЦР и ПЦР-ПДФР. В результате установлено, что все XDR-изоляты имеют мутацию в гене katG315, а 58,0±8,8% – мутацию в katG463 [1, 2, 9, 10].

3. Изучение молекулярных основ резистентности лекарственно устойчивых клинических изолятов M. tuberculosis к фторхинолоновым препаратам выявило мутации в области QRDR гена gyrA клинических изолятов M. tuberculosis. У XDR-изолятов была определена частота аминокислотных и нуклеотидных замен в кодонах 90 и 94 гена gyrA. Было выявлено, что максимально часто, у восьми (61,5%) из 21 XDR-изолята, наблюдалась мутация в кодоне 94 (ГАЦ ААЦ или ГГЦ, ЦАЦ, ГТГ).

Остальные 6 (46%) изолятов имели мутацию в кодоне 90 (ГЦГ ГТГ) и один изолят (1241 Х) имел две мутации одновременно в кодонах 90 (ГЦГ ГТГ) и 94 (ГАЦ ЦАЦ). Мутация в кодоне 95 была идентифицирована у всех 6 MDR и 12 (92%) XDR-изолятов, но не обнаруживалась ни у одного из чувствительных изолятов. Учитывая, что MDR-изоляты не являются устойчивыми к фторхинолонам, было доказано что мутация в данном кодоне не имеет отношения к резистентности [4].

4. Молекулярно-генетическое исследование 152 клинических изолятов M. tuberculosis методами секвенирования и ПДФР позволило определить основные генетические группы возбудителя туберкулеза. Среди них было 140 (92%) штаммов резистентных к изониазиду, 109(71,7%) из которых обладали характеристиками MDR и 31(20,3%) – характеристиками XDR.

Впервые установлено, что 78 изолятов (51,31 ±4,05%) принадлежали к генетической группе 1, 48(31.6±3,76%) – к группе 2 и 26 (17,1±3,05%) – к группе 3. По результатам молекулярно-генетического анализа 22 штаммов M. tuberculosis, выделенных от пациентов, пребывающих в пенитенциарных заведениях 10 (45,5±10,9%) принадлежали к генетической группе 1, 8 (36,4±10,5%) – к группе 2 и 4 (18,1±8,4%) – к группе 3. Микобактерии 1-й генетической группы доминируют среди MDR и XDR изолятов (p0,05) [2, 4, 10].

5. Исследование лекарственной устойчивости M. tuberculosis, выделенных из мокроты от 934 больных туберкулезом легких в период с января 2007 по январь 2008 года, позволило выделить 5 групп по резистентности: изоляты, относящиеся к MDR-ТБ, XDR-ТБ, изоляты, характеризующиеся монорезистентностью к изониазиду или рифампицину, изоляты, обладающие резистентностью ко всем препаратам первого выбора и чувствительные изоляты. Анализ информации о больных туберкулезом показал, что среди пораженных возбудителем преобладали мужчины – 660 человек или (70,67±1,5%), в то время как женщин было 274 (29,33±1,5%) (P0,001). В возрастных группах 25–65 лет среди заболевших доля мужчин было в 2,7–9,0 раз больше, чем женщин. Случаев вторичного ТБ было (52,02±1,77%), а первичного – 382 (47,98±1,77%) (P0,05). Среди больных было 756 (%) пациентов трудоспособного возраста, причем 570 (75,4±1,56%) из них – мужчины (трудоспособный возраст 18–60 лет), а 186 (24,6±1,56%) – женщины (трудоспособный возраст 18–55 лет) [4].

6. Впервые проведенный молекулярно-генетический анализ регуляторного гена whiB7, обусловливающего мультирезистентность M. tuberculosis показал его наличие у устойчивых MDR- и XDR клинических изолятов. Секвенирование регуляторного гена whiB мультирезистентных возбудителей туберкулеза не выявило ни одной мутации в промоторной области гена. Мутаций в структурном гене также не было выявлено, стоп-кодон представлен триплетом «ТГА». Детекция гена whiB7 позволяет дифференцировать патогенные микобактерии от непатогенных изолятов и нетуберкулезных референс-штаммов: продукты ПЦР, соответствующие данному гену обнаруживались только в заведомо положительных клинических образцах, но не в негативных и только среди изолятов M. tuberculosis и M. bovis, но не у непатогенных и нетуберкулезных штаммов. Таким образом, этот метод идентификации бактерий группы M. tuberculosis оказался простым в проведении и с хорошим соотношением цена-качество [3, 5, 6, 7, 8].

Рекомендации по практическому использованию результатов 1. Рекомендуется проводить группировку клинических изолятов по основным генетическим группам, для выявления штаммов группы 1, к которым относится штамм Beijing, в основном вызывающий заболевания во время эпидемических подъемов заболеваемости туберкулезом.

2. Для лабораторной диагностики устойчивости микобактерий к изониазиду, фторхинолонам и выявления их мультирезистентных форм в качестве маркеров рекомендуется определение мутаций в генах katG, gyrA и регуляторном гене whiB7, соответственно, с помощью методов ПЦР, ПЦР ПДРФ и секвенирования.

3. Для экспресс-диагностики резистентности к изониазиду рекомендуется применять обнаружение мутаций в KatG315.

4. В качестве нового метода экспресс-идентификации микроорганизмов группы M. tuberculosis рекомендуется использование ПЦР-анализа гена whiB7.

5. Определение аминокислотной последовательности областей, детерминирующих резистентность к хинолонам (QRDRs) в субъединице А ДНК-гиразы может быть использовано в качестве молекулярного теста для определения устойчивости микобактерий к фторхинолонам.

СПИСОК ПУБЛИКАЦИЙ СОИСКАТЕЛЯ Статьи в журналах 1. Сетаре, М. Распространенность мутаций в кодоне 463 katG-гена в клинических изолятах лекарственно-устойчивых Mycobacterium tuberculosis в Республике Беларусь и возможности применения метода ПЦР-ПДФР в экспресс-диагностике туберкулеза / М. Сетаре, Л.П. Титов, Л.К. Суркова // Медицинский журнал. – 2009. – №. 1. – С. 81–86.

2. Сетаре, М. Изучение полиморфизма отдельных нуклеотидов KatG315 и KatG463 в клинических изолятах Mycobacterium tuberculosis, полученных от больных туберкулезом легких в пенитенциарных заведениях / М. Сетаре, Л.П. Титов, Л.К. Суркова // Медицинский журнал. – 2009. – №. 1. – С. 86–92.

3. Титов, Л.П. Изучение мутации и разработка метода экспресс идентификация микроорганизмов группы Mycobacterium tuberculosis путем регуляторного гена whiB7 / Л.П. Титов, М. Сетаре, О.А. Будник, Л.К. Суркова // Медицинский журнал. – 2009. – №. 2. – С. 119–124.

4. Титов, Л.П. Характеристика лекарственной устойчивости М. tuberculosis, выделенных от больных туберкулезом и молекулярные характеристики мутаций в гене gyrA / Л.П. Титов, М. Сетаре, Л.К. Суркова // Медицинские Новости – 2009. – №. 12. – С. 64–66.

Тезисы докладов 5. Сетарэ, М. Идентификация мутаций в регулирующем гене whiB некоторых клинических изолятов XDR-туберкулеза в Беларуси / М. Сетарэ, Л.П. Титов, Л.К. Суркова // Материалы X Международного конгресса МАКМАХ/ESCMID по антимикробной терапии, Москва, Россия, 21–23 мая 2008 г. / ASM по антимикробной терапии. – М., 2008. – С. 22.

6. Setareh, M. Identification of mutations in gene whiB7 responsible for multiresistance in XDR Mycobacterium tuberculosis / M. Setareh, L.P. Titov, L.K. Surkova // Abstracts of 1st conference of Iranian Students, Minsk, Belarus, 4th April 2008 / Embassy of IR Iran. – Minsk, 2008. – P. 15.

7. Сетарэ, М. Идентификация мутаций в гене whiB7 некоторых клинических изолятов MDR-туберкулеза в Беларуси // «Современные проблемы инфекционной патологии человека»: материалы Международной научно-практической конференции, Минск 16–17 октября 2008 г. / НИИЭМ.

– Минск, 2008. – С. 238–240.

8. Setareh, M. Identification of mutations in gene whiB7 in Mycobacterium tuberculosis / M. Setareh, L.P. Titov, L.K. Surkova // Abstracts of 3rd EFS Functional Genomics Conference, Innsbruck, 1th–4th October 2008 / European Science Foundation. – Innsbruck, Austria, 2008. – P. 67.

9. Setareh, M. Detection of single nucleotide polymorphism in katG gene of Mycobacterium tuberculosis using PCR-RFLP in comparison by Sequence methods / M. Setareh, L.P. Titov, L.K. Surkova // «Фундаментальные и прикладные исследования в биологии»: материалы І Международной научной конференции студентов, аспирантов и молодых ученых, Донецк, Украина 23–26 февраля 2009 г. / Министерство образования и науки Украины, Донецкий национальный университет. – Донецк, 2008. – С. 19.

10. Setareh, M. Relationship between mutation in katG315 and resistance to isoniazid in clinical isolates of Mycobacterium tuberculosis / M. Setareh, L.P. Titov, L.K. Surkova // 2nd conference of Iranian Students/ Abstracts of 2nd conference of Iranian Students, Minsk, Belarus, 10th April 2009 / Embassy of IR Iran. – Minsk, 2009. – P. 103.

РЭЗЮМЭ Сетарэ Мохамад Малекулярна-генетычная характарыстыка лекава-рэзiстэнтных штамаў M. tuberculosis, якiя выдзелены ад хворых на туберкулез Ключавыя словы: туберкулез, клiнiчныя iзаляты M. tuberculosis, мутацыя, ген whiB7, ген katG, ген gyrA, MDR, XDR Мэта работы: распрацаваць асновы малекулярна-генетычнай характарыстыкi (дамiнуючыя генатыпы, характар мутацый) множна рэзiстэнтных штамаў M. tuberculosis, якiя выдзелены ад хворых на туберкулез.

Метады даследавання: мiкрабiялагiчныя, малекулярна-бiялагiчныя, статыстычныя.

Атрыманыя вынiкi i iх навiзна. Упершыню ў Рэспублiцы Беларусь была здзейснена дэмаграфiчная характарыстыка 934 пацыентаў з туберкулезам на аснове лекавай устойлiвасцi хваробы – выяўлена, што сярод хворых пераважалi мужчыны – 660 чалавек (70,66±1,5%). Выпадкаў другаснага туберкулезу было 414 (52,02±1,77%), а першаснага – (47,98±1,77%) (P0,05). Малекулярна-генетычнае структураванне iзалятаў упершыню вызначыла, што 78 (51,31±4,05%) са 152 штамаў належалi да генетычнай групы 1 (у пацыентаў з пенiтэнцыярных устаноў – 45,5%±10,9%), 48 (31,6±3,76%) – да групы 2 i 26 (17,8±3,09%) – да групы 3.

Са 140 iзалятаў, устойлiвых да iзанiязiда (109 MDR i 31 XDR), (97,8±1,2%) мелi мутацыi ў KatG315, што падразумявае патэнцыяльную прыдатнасць iх выяўлення для экспрэс-дыягностыкi рэзicтэнтнасцi да iзанiязiда. Мутацыю ў гене katG315 мелi ўсе XDR-iзаляты. У 84 выпадках (56,37±4,0%) адзначалiсь мутацыi ў KatG463 (P0,05). Назiралась мутацыя ў вобласцi QRDR гена gyrA (якая дэтэрмiнуе рэзiстэнтнасць да фторхiналонаў) клiнiчных iзалятаў у кадонах 90 i 94. Секвенiраванне рэгуляторнага гена whiB7 не выявiла мутацый, што дазваляе выкарыстоўваць яго ў якасцi надзейнага генетычнага маркера для выяўлення MDR-, XDR- i чуллiвых штамаў i iх дыферэнцыроўкi ад непатагенных iзалятаў i нетуберкулезных рэферэнс-штамаў у макроце i чыстых культурах.

Рэкамендацыi па выкарыстанні: для экспрэс-дыягностыкi рэзicтэнтнасцi да iзанiязiда, экспрэс-iдэнтыфiкацыi i групоўкi клiнiчных iзалятаў M. tuberculosis.

Галiна выкарыстання: мiкрабiялогiя, фтызiятрыя, пульманалогiя.

РЕЗЮМЕ Сетарэ Мохаммад Молекулярно-генетическая характеристика лекарственно-резистентных штаммов M. tuberculosis выделенных от больных туберкулезом Ключевые слова: туберкулез, клинические изоляты M. tuberculosis, мутация, ген whiB7, ген katG, ген gyrA, MDR, XDR Цель работы: разработать основы молекулярно-генетической характеристики (доминирующие генотипы, характер мутаций) множественно резистентных штаммов M. tuberculosis, выделенных от больных туберкулезом.

Методы исследования: микробиологические, молекулярно биологические, статистические.

Полученные результаты и их новизна. Впервые в Республике Беларусь осуществлена демографическая характеристика 934 пациентов с туберкулезом на основании лекарственной устойчивости заболевания – выявлено, что среди заболевших преобладали мужчины – 660 человек (70,66±1,5%). Случаев вторичного туберкулеза было 414 (52,02±1,77%), первичного – 382 (47,98±1,77%) (P0,05). Молекулярно-генетическое структурирование изолятов впервые установило, что 78 (51,31±4,05%) из штаммов принадлежали к генетической группе 1 (у пациентов из пенитенциарных учреждений – 45,5±10,9%), 48 (31,6±3,76%) – к группе и 26 (17,8±3,09%) – к группе 3. Из 140 изолятов, устойчивых к изониазиду (109 MDR и 31 XDR), 137 (97,8±1,2%) имели мутации в KatG315, что подразумевает потенциальную применимость их выявления для экспресс диагностики резистентности к изониазиду. Мутацию в KatG315 имели все XDR-изоляты. В 84 случаях (56,37±4,0%) отмечались мутации в KatG (P0,05). Наблюдалась мутация в области QRDR гена gyrA (детерминирующей резистентность к фторхинолонам) в кодонах и 94 клинических изолятов. Секвенирование регуляторного гена whiB не выявило мутаций, что позволяет использовать его в качестве надежного генетического маркера для обнаружения MDR-, XDR- и чувствительных штаммов и их дифференцировки от непатогенных изолятов и нетуберкулезных референс-штаммов в мокроте и в чистых культурах.

Рекомендации по использованию: для экспресс-диагностики резистентности к изониазиду, экспресс-идентификации и группировки клинических изолятов M. tuberculosis.

Область применения: микробиология, фтизиатрия, пульмонология.

SUMMARY Setareh Mohammad Molecular-genetic characteristic of drug-resistant M. tuberculosis strains isolated from patients with tuberculosis Key words: tuberculosis, clinical isolates of M. tuberculosis, mutation, gene whiB7, gene katG, gene gyrA, MDR, XDR.

Purpose of work: to work out the basics of molecular-genetic characteristic (dominated genotypes, character of mutations) of multidrug-resistant M. tuberculosis strains isolated from tuberculosis patients.

Methods of research: microbiological, molecular-biological, statistical.

Received results and their novelty. For the first time in the Republic of Belarus was realized the demographic characteristic of 934 tuberculosis patients based on drug resistance. There was revealed considerable prevalence of men among patients – there were 660 of them (70.66±1.5%). There were 414 cases (52.02±1.77%) of secondary tuberculosis and 382 (47.98±1.77%) of primary one (P0.05). Molecular-genetic grouping of isolates for the first time revealed that (51.31±4.05%) of 152 strains related to Genetic Group 1 (45.5±10.9% of patients from penitentiary establishments), 48 (31.6±3.76%) – to group 2 and (17.8±3.09%) – to group 3. 137 (97.8±1.2%) of 140 isoniazid-resistant isolates (109 MDR and 31 XDR) had mutations in KatG315. This fact implicates the potential applicability of its identification for rapid determination of isoniazid resistance. KatG315 mutation were established in all the XDR-isolates. KatG mutations were noted in 84 cases (56.37±4.0%) (P0.05). Was revealed a mutation in QRDR region of gyrA gene (that determines the fluoroquinolones resistance) in codons 90 and 94 of clinical isolates. The sequencing of whiB regulatory gene doesn’t reveal any mutations. That allows its using as reliable genetic marker for detection of MDR-, XDR- and susceptible strains and for their differentiation from nonpathogenic isolates and non-tuberculosis reference strains both in sputum and in culture.

Recommendations for use: to conduct the express-diagnostics of isoniazid resistance, rapid identification and molecular grouping of M. tuberculosis clinical isolates.

Field of application: microbiology, phthisiology, pulmonology.

Подписано в печать 16.11.09. Формат 6084/16. Бумага писчая «КюмЛюкс».

Печать офсетная. Гарнитура «Times».

Усл. печ. л. 1,16. Уч.-изд. л. 1,2. Тираж 60 экз. Заказ 662.

Издатель и полиграфическое исполнение:

учреждение образования «Белорусский государственный медицинский университет».

ЛИ № 02330/0494330 от 16.03.2009.

ЛП № 02330/0150484 от 25.02.2009.

Ул. Ленинградская, 6, 220006, Минск.



 


Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.