авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Молекулярное типирование клинических штаммов neisseria gonorrhoeae

На правах рукописи

Верещагин Владимир Александрович Молекулярное типирование клинических штаммов Neisseria gonorrhoeae 03.00.04 – Биохимия 03.00.03-Молекулярная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва - 2006

Работа выполнена в Федеральном государственном учреждении Научно исследовательском институте физико-химической медицины Федерального агентства по здравоохранению и социальному развитию РФ Научные руководители: доктор биологических наук, профессор Говорун Вадим Маркович кандидат биологических наук, доцент Ильина Елена Николаевна

Официальные оппоненты: доктор биологических наук, профессор Колесанова Екатерина Федоровна кандидат биологических наук, Прилипов Алексей Геннадиевич

Ведущая организация: Федеральное государственное унитарное предприятие "Государственный научный центр по антибиотикам"

Защита диссертации состоится «19» октября 2006 года в 14:00 часов на заседа нии Диссертационного Совета Д 001.010.01 при ГУ НИИ биомедицинской хи мии им. В.Н. Ореховича РАМН по адресу: 119121, Москва, ул. Погодинская, 10.

С диссертацией можно ознакомиться в библиотеке ГУ НИИ БМХ РАМН.

Автореферат разослан «18» сентября 2006 года

Ученый секретарь Диссертационного Совета кандидат биологических наук В.С. Былинкина

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Гонорея - одна из распространенных на сегодняш ний день инфекций, передающихся половым путём, - остается актуальной про блемой в области практического здравоохранения. К особенностям гонореи от носят распространение вялотекущих и диссеминированных форм, увеличение частоты выявления мультирезистентных штаммов. Для гонококка характерны высокая пластичность, естественный морфофизиологический и генетический полиморфизм, и, как следствие, выраженная гетерогенность популяции.

Молекулярные методы исследования популяции N. gonorrhoeae способны не только дополнить традиционные микробиологические методики идентифи кации и характеристики микроба, но и преодолеть ограничения последних (дли тельность анализа, трудоемкость и сложностью стандартизации). В настоящий момент среди многообразия предложенных методов не определен приоритет ный подход, способный стать стандартным и общепринятым.

Разработка современных молекулярных подходов типирования и штаммо вой идентификации гонококка особенно актуальна для нашей страны, посколь ку в РФ нет стандартной системы типирования штаммов N. gonorrhoeae, а имеющаяся информация о региональных особенностях возбудителя крайне скудна, разрознена и зачастую неактуальна. Разработка соответствующего ар сенала методов и исследование гетерогенности популяции позволит иметь ее актуальную молекулярно-эпидемиологическую характеристику, сделает воз можным регулярный мониторинг и обоснованный прогноз эпидемиологической ситуации.

Цель работы. Цель работы – разработка и сравнение различных методов моле кулярного типирования N. gonorrhoeae и использование их для характеристики популяции возбудителя, распространённой на территории Российской Федера ции.

Задачи исследования:

1. Формирование коллекции образцов ДНК микробиологически охарактеризо ванных клинических штаммов N. gonorrhoeae, полученных от больных из раз личных регионов Российской Федерации.

2. Разработка системы комплексной оценки антибиотикоустойчивости N. gon orrhoeae на основе знаний о генетических механизмах формирования устойчи вости возбудителя, включающей определение известных нуклеотидных поли морфизмов в реакции минисеквенирования с последующим масс спектрометрическим анализом.

3. Оптимизация методики прямого масс-спектрометрического белкового про филирования и оценка возможности типирования клинических штаммов N.

gonorrhoeae с использованием данного подхода.

4. Реализация схемы por-типирования для характеристики коллекции россий ских клинических штаммов N. gonorrhoeae.

5. Анализ гетерогенности генов «домашнего хозяйства» N. gonorrhoeae и раз работка схемы типирования мультилокусным секвенированием клинических штаммов гонококка.

6. Молекулярно-эпидемиологическая характеристика группы клинических штаммов N. gonorrhoeae, выделенных на территории РФ.

Научная новизна и практическая значимость работы. В работе продемон стрированы возможности современных молекулярных подходов к характери стике и типированию клинических штаммов N. gonorrhoeae, условия отдельных методик отработаны впервые. На основе ПЦР-амплификации и масс спектрометрического анализа продуктов реакции минисеквенирования предло жена высокопроизводительная система одновременного исследования 15 гене тических локусов гонококка - маркеров устойчивости к пяти классам антибио тиков. Впервые для характеристики штаммов N. gonorrhoeae использованы возможности белкового профилирования с помощью прямого масс спектрометрического анализа. Также в ходе работы существенно дополнены представления о возможностях анализа изменчивости por гена и некоторых «генов домашнего хозяйства» для типирования штаммов гонококка.

Впервые для географически неоднородной группы клинических штаммов N. gonorrhoeae, распространенных на территории РФ, исследован полиморфизм por генов и 13 генов «домашнего хозяйства» (abcZ, adk, aroE, fumC, gdh, glnA, gnd, pdhC, pgm, pilA, pip, pyrD, serC), показана значительная гетерогенность ис следованной выборки и описаны механизмы, участвующие в формировании фенотипически регистрируемого уровня антибиотикоустойчивости.



Результаты работы имеют значение для решения ряда теоретических во просов молекулярной эпидемиологии N. gonorrhoeae, однако в большей степе ни представляют практическую ценность и направлены на прикладное исполь зование. Предложенные методические схемы и их технологические решения делают реальным их использование в практических лабораториях для решения двух из трех основных задач клинической микробиологии: 1) быстрая оценка антибиотикорезистентности гонококка, 2) характеристика локальной (геогра фической, временной) структуры популяции/субпопуляции возбудителя, иден тификация циркулирующих штаммов или групп штаммов.

Реализация и внедрение результатов работы в практику. Осуществляется внедрение результатов работы в клинико-лабораторную практику бактериоло гической лаборатории ФГУ ЦНИКВИ Росздрава.

Апробация работы. Основные положения диссертационной работы доложены и обсуждены на расширенном межлабораторном заседании Отдела молекуляр ной биологии и генетики ФГУ НИИ физико-химической медицины Росздрава (Москва, 20 июля 2006 года), а также в ходе следующих конференций: IX Все российский съезд дерматовенерологов (Москва, 2005), 15-я Международная конференция по патогенным нейссериям (Кэрнс, 2006).

Публикации. Материалы диссертационной работы отражены в 11 публикациях (5 в рецензируемых журналах, 6 - тезисы сообщений на конференциях).

Объем и структура диссертации. Диссертация изложена на 140 страницах машинописного текста, содержит 20 таблиц и 14 рисунков. Состоит из сле дующих глав: «Введение», «Обзор литературы», «Материалы и методы иссле дования», «Результаты», «Обсуждение», «Заключение и выводы», «Список ли тературы», который включает 175 источников.

МАТЕРИАЛЫ И МЕТОДЫ Бактериальные штаммы. Использовали контрольный (ATCC 49226) и 464 клинических штамма N. gonorrhoeae, выделенных от больных неосложнённой гонореей из 14 региональ ных центров РФ. Штаммы, охарактеризованные по чувствительности к 5 антибиотикам, представителям 4 классов (пенициллин, цефотаксим;

тетрациклин;

ципрофлоксацин;

спекти номицин) предоставлены бактериологической лабораторией ФГУ ЦНИКВИ Росздрава.

Прямое белковое профилирование штаммов N. gonorrhoeae. Использовали свежую 48-ми часовую культуру гонококка, находящуюся в стационарной фазе роста. В качестве рефе рентного микроорганизма использовали свежую 18-ти часовую культуру лабораторного штамма E.coli DH5. Материал бактериальной культуры (одиночная колония) ресуспендиро вали в растворе «AT» (50% ацетонитрил / 2,5% трифторуксусная кислота). Центрифугирова ли 1 мин Х 14000 об/мин. 1 мкл супернатанта наносили на ячейки стального планшета для масс-спектрометрии (MSP 96 target ground steel, Bruker Daltonics, Германия), смешивали с насыщенным в «AT» раствором одного из матричных соединений (a-циано-4 гидроксициннамовая кислота, a-CHCA;

синапиновая кислота, SA;

феруловая кислота, FA) и высушивали на воздухе в течение 5 минут.

Масс-спектрометрический анализ проводили с использованием MALDI-TOF масс спектрометра Microflex (Bruker Daltonics, Германия), используя следующие параметры изме рения: линейный режим, частота импульсов - 10 Гц, детекция положительно заряженных ио нов с ускоряющим напряжением – 20.0 кВ, напряжение на накапливающем электроде – 18. кВ, время задержки экстракции – 350 нсек. Образец наносили на три ячейки планшета, для каждой из которых записывали конечный спектр (500 импульсов лазера), полученный сум мированием 10 одиночных спектров (50 импульсов лазера). Внешнюю калибровку проводи ли с использованием точных значений масс известных белков Escherichia coli. Полученные спектры анализировали с использованием программы flexAnalysis 2.4 (Bruker Daltonics, Гер мания). Формирование пик-листа проводили в автоматическом режиме, используя единые стандартные условия отбора пиков: 1) центроидный алгоритм поиска (80% высоты пика), 2) отношение сигнал/шум – 15, 3) пороговое значение относительной интенсивности – 10%, 4) максимальное число пиков – 100, 5) максимальная ширина пика – 2 m/z. Идентификацию белков проводили путем поиска совпадения значений экспериментальных масс с массами белков, аннотированных в базах данных (SwissProt/TrEMBL) с использованием ресурсов Ex PASy-сервера (http://ca.expasy.org/srs5/). При этом учитывали инструментальную погреш ность измерения, которая составляла 3 Да, а также возможную посттрансляционную утрату N-концевого метионина.

Генетический анализ штаммов N. gonorrhoeae. Выделение ДНК проводили по методу Boom с соавторами [Boom R. Et al., 1990]. Для амплификации фрагментов генов N.

gonorrhoeae использовали праймеры, приведенные в таблицах 1 и 2.

Таблица 1. Праймеры, использованные для амплификации фрагментов генома N. gonorrhoeae, связанных с рассматриваемыми механизмами устойчивости.

Размер Мишень Праймер 5’-3’ последовательность продукта, п.н.

M13F-Por011 gtcacgacgttgtaaaacgacggccagtctgactttggcagccctt 500- por, A M13R-Por081 cacacaggaaacagctatgaccgtattgtgcgaagaagc M13F-Por111 gtcacgacgttgtaaaacgacggccagtctgtccgtacgctacg 500- por, B M13R-Por141 cacacaggaaacagctatgaccagattagaatttgtggcgc B1f tactcaatcggtaattggct D2r gcccaaaaaagggacgaaag (Asia, Africa) bla B3f cgtatatctagttgaggcac D4r gtgcctcaactagatatacg (Toronto) penA-f cgtgattgcgaaggcattgg penA penA-r gtgcgtcagtgcggtatagg PonA1-f gagaaaatgggggaggaccg ponA PonA1-r ggctgccgcattgcctgaac GyrAFEx gacggcctaaagccggtgca gyrA GyrAREx atgttggtcgccataccgac ParCFEx gtttcagacggccaaaagccc parC ParCREx ggaacaacagcaattccgcaat Nor1 tgggcagtacgtcggcg norM Nor2 gggcggtcagcaggcgg MtrAF gacgacagtgccaatgcaacg mtrR MtrAR ttaagattatttccggcgcaggcag Тet1 atcctttctgggcttccattg tet(M) Tet2 ccgagcagggatttctccac RPS-for gtgctgttgtaaaaggcccg rpsJ RPS-rev cggccggcaaatccagcttc Bfor agtaacggtacttaaattgtttac ermB Brev gaaaaggtactcaaccaaata Ffor cgggtcagcactttactattg ermF Frev ggacctacctcatagacaag Mf1 gataggaagaagataatgattgg mef Mf2 aagagctgtttgcacaccgc 16Sfor aaggccgttgccaatatcg rrs 16Srev tgtatgacgtgtgaagccc – последовательности праймеров M13F и M13R подчеркнуты.

– длины амплифицируемых фрагментов варьируют для разных генотипов.

Таблица 2. Праймеры, использованные для амплификации фрагментов 13-ти генов «домашнего хозяйства» Размер про 5’-3’ последовательность Мишень Праймер дукта, п.н.

abcZ gatctgtaaaacgacggccagtaaatcctcaccggcgtgca abcZ abcZ-r gatccaggaaacagctatgaccgtatccacgcctcttcctgcg adk gatctgtaaaacgacggccagtaggcaggcacgcccttgg adk adk-r gatccaggaaacagctatgaccctgcccgtgggtacgacct aroE gatctgtaaaacgacggccagtgcaaatcgccgcagattcatc aroE aroE-r gatccaggaaacagctatgaccagccatttgacgatgcggaac fumC gatctgtaaaacgacggccagtccggcctgccgtttgtcag fumC fumC-r gatccaggaaacagctatgaccggcagggacgaccagttcg gdh gatctgtaaaacgacggccagtatcaataccgatgtggcgcgt gdh gdh-r gatccaggaaacagctatgaccgtgatttcagacggcatatccc glnA gatctgtaaaacgacggccagtccgcatattttgccatttccc glnA glnA-r gatccaggaaacagctatgaccgttcaccatggcggagcg gnd gatctgtaaaacgacggccagttcctacgacgaaatgcaccgc gnd gnd-r gatccaggaaacagctatgacccaagaacgtaatcgccgaagcc pdhC gatctgtaaaacgacggccagtgtacaagacggtctgcgccg pdhC pdhC-r gatccaggaaacagctatgaccgcaaacaggccgtctgaaacatc pgm gatctgtaaaacgacggccagtcgatgccgaccgcttgg pgm pgm-r gatccaggaaacagctatgaccgtgatgatttcggttgcgcc pilA gatctgtaaaacgacggccagtaccgtgctgattaccggcg pilA pilA-r gatccaggaaacagctatgacctttgcagcacgcgcttcac pip gatctgtaaaacgacggccagtggattgtcagaagcaatatgggag pip pip-r gatccaggaaacagctatgaccaagctgcttttttgtgcggaac pyrD gatctgtaaaacgacggccagtgtatgtttggcgggatttcgg pyrD pyrD-r gatccaggaaacagctatgaccacgcgggcgatgtcttcg serC gatctgtaaaacgacggccagtcaggaaatgtcggactacaacgg serC serC-r gatccaggaaacagctatgacccgcgtaagttgacggcgtg – последовательности праймеров M13F и M13R подчеркнуты.

Амплификацию проводили в 10 мкл реакционной смеси, содержащей 66 мМ ТрисHCl, рН 9.0, 16.6 мМ (NH4)2SO4, 2 мМ MgCl2, по 100 мкМ каждого dNTP, 1 Ед Taq-полимеразы (Promega, USA) и по 10 пмолей каждого праймера в амплификаторе DNA Engine Tetrad 2 (MJ Research, США). Использовали единый температурный профиль: 94°С, 15 сек, 58°С, 15 сек, 72°С, 16 сек;

35 циклов. Продукты амплификации генов bla, tet(M), ermB, ermF, mefA анали зировали в 2% агарозном геле.

Дефосфорилирование dNTP и элиминацию оставшихся праймеров в пост амлификационной смеси проводили, инкубируя образцы с 1 Ед антарктической фосфатазы (New England BioLabs, Великобритания) и 5 Ед экзонуклеазы I (Fermentas, Евросоюз) при 37°С в течение 30 минут с последующей инактивацией ферментов при 85° С в течение минут.

Реакцию термоциклического минисеквенирования проводили в 10 мкл реакционной смеси: 66 мМ Tris-HCl pH 9.0;

16.6 мМ (NH4)2SO4;

2.5 мМ MgCl2;

по 0.2 мМ необходимых dNTP и/или ddNTP;

по 10 пмолей каждого праймера (табл. 3) и 2 Ед TermiPol DNA Poly merase (Solis Biodyne, Эстония), используя в качестве матрицы амплифицированные фраг менты ДНК. Наработку продуктов реакции осуществляли по универсальному профилю: 94° С – 20 сек, 58° С – 20 сек, 72° С – 15 сек, 70 циклов.





Таблица 3. Праймеры, использованные в реакции минисеквенирования.

Масса продуктов реак- Масса продуктов реак 5’-3’ последова- Смесь ddNTP;

ции минисеквенирова- ции минисеквенирова Ген Праймер тельность;

масса dNTP ния для дикого геноти- ния для мутантного ге па нотипа 6510 Dа ggggtaaacatgggtatcg;

6206 Dа penAz dTTP;

ddCTP (+dTTP+ddCTP) penA 5933 Да (+ddCTP) ins Asp345a 6133 Dа 5500 Dа ggttcaagagccgttgc;

dTTP;

dGTP;

ponAz (+dTTP+dGTP+ddCTP) (+ddCTP) ponA 5227 Да ddCTP Leu421 Leu421Pro 6597 Да (+dTTP+ddCTP) 6293 Да ataccacccccacggcgatt;

dTTP;

dATP;

Ser91Phe grA91 (+ddCTP) 6020 Да ddCTP 6606 Да Ser (+dATP+ddCTP) Ser91Tyr 6143 Да (+ddCTP) gyrA Asp95Gly 6447 Да 6183 Да cgccatacggacgatggtg;

dTTP;

ddCTP;

grA95 (+dTTP+ddCTP) (+ddGTP) 5870 Да ddGTP Asp95 Asp950Ala 6791 Да (+dTTP+dTTP+ddGTP) Asp95Asn 4738 Да 5386 Да ccccgtatccgccgt;

dATP;

dTTP;

CT-35 (+ddCTP) (+dTTP+dTTP+ddGTP) 4465 Да ddCTP;

ddGTP C-35 C-35T norM 7037 Да 6451 Да gacggcatttttattgactg;

dATP;

dTTP;

AG-RBS (+dATP+dATP+ddCTP) (+ddGTP) 6138 Да ddCTP;

ddGTP A-7 A-7G 7676 Да 7363 Да acatacacgattgcacggat;

dATP;

dCTP;

mtrR1 (+5dATP) (+4dATP) 6110 Да ddTTP;

ddGTP A-35 delA- 8101 Да attgcacggataaaaagtc;

dATP;

dCTP;

7474 Да mtrR mtrR4 (+8dATP) 5595 Да ddTTP;

ddGTP (+6dATP) insTT- 6770 Да 6463 Да tgaaatgccaatagagcgcg;

dATP;

dCTP;

mtrR6 (+dCTP + dCTP +ddGTP) (+ddTTP) 6175 Да ddTTP;

ddGTP Gly45 Gly45Asp 5853 Да 5533 Да ggccatgaggacttgac dGTP, ddATP, NgC1192 (+dGTP+ddTTP) (+ddATP) rrs 5236 Да ddTTP C1192 C1192U 7030 cgtcgtgagacagtttggtc (+dCTP, +ddTTP) (+ddTTP) C2611T-f dCTP, ddTTP rrl C2611 C2611T 6292 Да 6910 Да acattttccgttctccgcac dATP, dTTP, RPS_Z (+ddGTP) (+dATP, +dTTP, +ddGTP) rpsJ 5979 Да ddGTP Val57 Val57Met Очистку продуктов реакции минисеквенирования проводили следующими образом:

входящий в состав набора SpectroCLEAN Kit (Sequenom, США) сорбент в количестве 8 мг растворяли в 16 мкл ультрачистой воды (Merck, Германия), полученную суспензию в объеме 24 мкл вносили в пробирку с продуктами реакции минисеквенирования. Содержимое про бирки тщательно перемешивали и инкубировали при комнатной температуре 15 мин. Затем осаждали сорбент центрифугированием в течение 5 мин при 1000 об/мин.

Для проведения масс-спектрометрического анализа продуктов реакции аликвоту об разца (0.2-1 мкл) с концентрацией олигонуклеотидов 10-30 пмоль/мкл, наносили на предва рительно высушенную на планшете AnchorChip (600 мкм, Bruker Daltonics, Германия) мат рицу, приготовленную из насыщенного раствора 3-гидроксипиколиновой кислоты (Fluka, Германия) в 50% ацетонитриле (Merck, Германия) с добавлением 10 г/л цитрата аммония двухосновного (Fluka, Германия), и высушивали на воздухе.

Масс-спектрометрический анализ проводили с использованием MALDI-TOF масс спектрометра Microflex (Bruker Daltonics, Германия), оснащенного азотным лазером (l= нм) с частотой импульсов до 20 Гц. Все измерения проводили в линейной режиме, детекти руя положительно заряженные ионы с ускоряющим напряжением – 20.0 кВ, накапливающем электроде – 18.65 кВ, фокусирующей линзе – 9.2 кВ и временем задержки анализатора – нсек. Для получения каждого масс-спектра использовали 50 импульсов лазера с мощностью излучения, установленной на уровне минимального порогового значения, достаточного для десорбции-ионизации образца.

По наличию в масс-спектрах продуктов реакции пиков, соответствующих ионам оп ределенной ожидаемой молекулярной массы, судили о нуклеотидном контексте в данном положении (табл. 3).

Определение нуклеотидной последовательности por генов, фрагментов гена parC и генов «домашнего хозяйства» проводили модифицированным методом Сенгера [Sanger, et al., 1977] с использованием ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit и прибора ABI Prism 3100 Genetic Analyzer (“Applied Biosystems”, США;

“Hitachi” Япо ния) в соответствии с прилагаемыми инструкциями. В реакции секвенирования por генов и фрагментов 13 генов «домашнего хозяйства» использовали стандартные праймеры –21 M TGTAAAACGACGGCCAGT-3’, M13 reverse CAGGAAACAGCTATGACC-3’, в реакции сек венирования parC гена – те же праймеры, которые использовали в реакции амплификации (табл.1). Восстановление полноразмерных последовательностей por гена, выравнивание и сравнительный анализ нуклеотидных последовательностей проводили с использованием программного пакета «Vector NTI 9.0» (Informax Inc, США). Расчёт параметров гетероген ности анализируемых последовательностей и тест на селекцию проводились с использовани ем программы MEGA version 3.1 [Kumar et al., 2004]. Нуклеотидные последовательности por генов анализируемых штаммов сравнивали с последовательностями, представленными в базе данных GeneBank c помощью сервиса BLAST (http://www.ncbi.nlm.nih.gov/BLAST). По ре зультатам анализа тестируемому штамму ставился в соответствие серотип N. gonorrhoeae, последовательность por гена которого максимально гомологична анализируемой.

Статистический анализ. Для учёта результатов исследования, формирования про межуточных таблиц, осуществления элементарных расчётов, описательной статистики и по строения диаграмм использовали программные ресурсы пакета Microsoft Office Excel 2003.

Все статистические тесты проводили для уровня значимости p0,05. Так как в иссле довании мы имели дело с качественными номинальными признаками (значения которых не могут быть упорядочены по какому-либо семантическому принципу), для подтверждения наличия ассоциации генотипов и категорий чувствительности, оценки силы связи выбраны критерий c2 и коэффициент сопряженности Крамера соответственно. Основные статистиче ские расчёты производили с помощью пакета Statistica 6.0. Для численной оценки дискрими нирующей способности методов типирования использовали индекс разнообразия Симпсона D [Simpson, 1949]. Согласно общепринятой практике, приемлемыми считаются методы ти пирования (или их комбинации), имеющие значение индекса Симпсона 0.9 и выше [Hunter et al., 1988].

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ Коллекция образцов ДНК клинических штаммов N. gonorrhoeae В исследование включена группа из 464 клинических штаммов N.

gonorrhoeae, выделенных от пациентов из 14 региональных центров РФ. Гео графическая неоднородность исследуемой группы клинических штаммов дела ет эту выборку хорошей моделью для отработки молекулярных подходов к ха рактеристике и изучению внутривидовой изменчивости гонококка, рассмотрен ных далее. Представленность различных географических областей территории РФ в выборке, с одной стороны, даёт возможность оценить региональные осо бенности популяции возбудителя, с другой – обобщить получаемые данные и экстраполировать формулируемые выводы на территорию РФ в целом.

Проведено выделение ДНК клинических штаммов, сформирован лабора торный банк ДНК. Анализ генетических маркеров резистентности и por типирование осуществлены для 464 штаммов;

прямое белковое профилирова ние реализовано для 278 штаммов;

детальное сравнение методов por- и мульти локусного типирования проведено для группы из 84 штаммов.

Прямое белковое профилирование N. gonorrhoeae С целью получения воспроизводимых и максимально насыщенных масс спектров на лабораторном штамме E. coli DH5 отработана методика белковой экстракции и условия масс-спектрометрического анализа (см. «Методы иссле дования»). Выбрано оптимальное матричное соединение - a-CHCA, область анализа масс-спектра ограничена диапазоном m/z 4000 – 12000, в рамках кото рого отработаны критерии выбора пиков при формировании пик-листа (набор значений m/z и относительных интенсивностей пиков). В предшествующих ра ботах предлагается использовать различные матричные растворы и методики подготовки образца бактериальной культуры для масс-спектрометрического анализа [Edwards-Jones et al., 2000;

Hettick et al., 2004;

Meetani et al., 2005], по казаны результаты разной степени качества и информативности. Сравнение достигнутых нами характеристик масс-спектра (среднее разрешение в указан ном диапазоне, отношение сигнал/шум) с данными, полученными в указанных работах, свидетельствует об эффективности отработанной методики. Использо вание в качестве матрицы a-CHCA позволяет получить максимально гомоген ную структуру и форму кристаллов в сравнении с двумя другими исследован ными матрицами, что играет роль для сохранения от спектра к спектру необхо димой точности измерения масс, а также для успешной записи спектров в авто матическом режиме.

Поиск в базе данных SwissProt/TrEMBL позволил соотнести 16 регистри руемых значений m/z с молекулярными массами бактериальных белков, причём большинство из них представляли собой белки рибосом бактерии. Установлены точные значения m/z для этих пиков в спектре штамма E. coli DH5, который дополнительно анализировали в каждом из последующих экспериментов с N.

gonorrhoeae и использовали для внешней калибровки. Ранее было показано преобладание в составе регистрируемых масс-спектров бактериальных клеток рибосомальных белков, что, вероятно, связано с их локализацией в цитозоле (в отличие от мембранных), присутствием в достаточно большом количестве, от носительно небольшой массой, а также основностью большей части из них, что в условиях кислой экстракции повышает эффективность ионизации и десорб ции, а также масс-спектрометрического анализа в режиме положительных ио нов [Ryzhov and Fenselau, 2001].

Аналогичным образом получена серия масс-спектров для лабораторного штамма N. gonorrhoeae ATCC 49226 (рис. 1), проведен их качественный и ко личественный анализ. Воспроизводимость полученных спектров оценивали на основании дисперсии значений m/z, относительной интенсивности и частоты регистрации отдельных пиков: максимальное среднеквадратичное отклонение для m/z составило 2.8 Да, для относительной интенсивности – 0.24. Выделены 20 устойчиво воспроизводимых пиков, для которых частота регистрации f 0.7.

Усреднённые по 10 измерениям значения m/z этих пиков составляют: 4474, 4511, 4689, 4784, 5010, 5052, 5130, 5484, 5908, 5946, 6053, 6404, 7080, 7227, 8068, 8167, 8225, 9379, 9570, 10260. По базе данных SwissProt/TrEMBL 12 пи ков соотнесены с рибосомальными белками: 4473 - RL36, 5051 - RL34, 5907 RL33, 6402* - RL32, 6805* - RL30, 7078 - RL29, 7226* - RL35, 8165 - RL31, 8224* - RS21, 8687* - RL28, 9377* - RS20, 9568* - RL27, 10259* - RS19 (* - мас са с учётом утраты начального метионина).

Сравнительный анализ масс-спектров для 278 клинических штаммов N.

gonorrhoeae выявил три пика со значениями m/z 4473, 5051 и 8165 (согласно масс-спектру N. gonorrhoeae ATCC 49226), которые меняются у ряда штаммов на 4487, 5081 и 8146 соответственно. Соотнесение этих пиков с рибосомальны ми белками RL36, RL34 и RL31 подтвердили секвенированием полноразмер ных последовательностей генов N. gonorrhoeae – rpmJ, rpmH и rpmE. В каждом из них обнаружен единственный значимый нуклеотидный полиморфизм, при водящий к соответствующей аминокислотной замене. Теоретически рассчитан ные изменения массы белков при данных заменах совпадали с изменением, ре гистрируемым в ходе масс-спектрометрического анализа: 1) RL36: 4473 (wt) / 4487 (V7I);

2) RL34: 5051 (wt) / 5081 (A37T);

3) RL31: 8165 (wt) / 8146 (R10H).

x10 Intens. [a.u.] 1. 5051. 1. 5908. 4471. 1. 7080. 6404. 2157. 4687. 0. 2236. 2519. 4109. 3535. 8167. 9379. 7225. 3197. 2947. 0. 10258. 9570. 3399. 4341. 0. 8689. 0. 2000 4000 6000 8000 10000 m /z Рисунок 1. Масс-спектр белкового экстракта клеток штамма N. gonorrhoeae ATCC 49226, ограниченный диапа зоном m/z 2000 – 16000.

Из восьми теоретически возможных комбинаций, выявленных для значе ний m/z 3-х белков, среди исследованной группы штаммов обнаружены четыре варианта. Учитывая неизменность остальных значений m/z в спектре, выделено четыре типа белковых масс-профилей (протеотипов) гонококка и проведена оценка их распределения в исследованной группе штаммов (табл. 4). Проведено сравнение распространенности различных протеотипов в отдельных регионах и в целом в РФ (рис.2).

Таблица 4. Распределение протеотипов гонококка в исследованной группе штаммов Кластеры варьирующих пиков для:

Белок M типa 1 типa 2 типa 3 типa 4474 RL 4487 5052 5052 RL RL31 8167 8167 Число штаммов 236 26 15 Относительная частота, % 84,9 9,4 5,4 0, 100,0% 90,0% 80,0% 70,0% 60,0% 50,0% 40,0% 30,0% 20,0% 10,0% 0,0% Мурманск Архангельск С.-Петербург Самара Екатеринбург Иркутск РФ Рисунок 2. Встречаемость протеотипов гонококка в регионах РФ в сравнении с общей распространенностью (включены регионы, для которых исследовано более 10 штаммов).

Наблюдаемые незначительные отличия качественного состава масс спектров в группе клинических штаммов гонококка согласуются с представле нием о ключевой роли рибосомальных белков в жизнедеятельности клетки, консервативности их аминокислотных последовательностей и соответствую щих генов. Напомним, что 12 из 20 устойчиво регистрируемых пиков соотнесе ны с рибосомальными белками, другие 8 пиков также характеризовались по стоянством значений m/z.

Предложенная методика получения воспроизводимых масс спектрометрических профилей бактериальных клеток апробирована на геогра фически неоднородной группе штаммов. Обусловленная низкой вариабельно стью белковых профилей (4 протеотипа) низкая дискриминирующая способ ность (D – 0.27) делает невозможным применение этого подхода для типирова ния патогена. Обратная сторона этого результата – относительная стабильность качественного состава профилей – позволяет говорить о перспективности видо вой идентификации возбудителя с использованием данного подхода. Сформи рованный набор из 20 устойчиво воспроизводимых пиков масс-спектра может рассматриваться как кандидатный список для формирования видоспецифично го профиля возбудителя.

Использование MALDI-TOF масс-спектрометрического анализа для харак теристики микробной клетки предложено, например, для идентификации мико бактерий [Hettick et al., 2004], представителей семейства Enterobacteriaceae [Lynn et al., 1999], типирования штаммов бетагемолитических стрептококков [Kumar et al., 2004], однако в нашей работе впервые произведена оценка этого подхода для характеристики штаммов N. gonorrhoeae.

Анализ генетических маркеров лекарственной устойчивости N. gonorrhoeae Осуществлен дизайн праймеров для реакций амплификации, минисекве нирования и секвенирования 15 генетических локусов, изменения которых ас социированы c возникновением феномена лекарственной устойчивости N. gon orrhoeae к пяти классам АМП (пенициллины, тетрациклины, фторхинолоны, спектиномицин, макролиды). Используемая схема анализа включала регистра цию генетических маркеров, обусловленных как приобретением новых элемен тов, так и мутациями в специфических хромосомных локусах бактерии. С це лью уменьшения себестоимости и повышения общей производительности ана лиза, отработаны универсальные условия проведения реакций амплификации, минисеквенирования и секвенирования, в цепочке последовательных техноло гических этапов минимизировано количество операций по переносу и разведе нию образцов, все процедуры приведены к формату 96-ти луночного планшета.

Проведен комплексный анализ 464 клинических штаммов N. gonorrhoeae, для каждого из которых получен индивидуальный профиль из 15 генетических маркеров резистентности.

Осуществлено сравнение профиля чувствительности к АМП с частотами обнаружения соответствующих генетических маркеров устойчивости:

1) по данным тестов на чувствительность к пенициллину в исследованной группе 122 штамма (26,3 %) относились к категории чувствительных и (73,7 %) к категории резистентных. Частоты обнаружения генетических марке ров устойчивости составили: bla – 3,9 % (18 из 464 штаммов), мутации в генах ponA – 71,3 % (326), penA – 87,7 % (407), penB – 54,3 % (252), mtrR – 48,3 % (224). Отсутствие выбранных маркеров резистентности наблюдалось в 12,1 % случаев (55 штаммов). По данным тестов на чувствительность к цефотаксиму все штаммы относились к категории чувствительных.

2) согласно тестам на чувствительность к тетрациклину в исследованной группе штаммов 168 (36,2 %) относились к категории чувствительных и (63,8 %) – к категории резистентных. Частоты обнаружения маркеров устойчи вости составили: tetM – 0,9 % (4 из 464 штаммов), мутации в генах rpsJ – 79,1 % (367), penB – 54,3 % (252), mtrR – 48,3 % (224). Отсутствие выбранных маркеров резистентности наблюдалось в 19,8 % случаев (92 штамма).

3) по данным тестов на чувствительность к ципрофлоксацину в исследо ванной группе штаммов 249 (53,7 %) относились к категории чувствительных и 215 (46,3 %) к категории резистентных. Для анализа генетических механизмов формирования резистентности гонококка к фторхинолонам выбраны следую щие генетические маркеры: полиморфизмы генов гиразы и топоизомеразы IV (gyrA, parC), полиморфизм промотора и гена mtrR эффлюксного белка MtrR.

Частоты обнаружения специфических маркеров устойчивости составили: gyrA – 45,5 % (211 из 464 штаммов), parC – 44,4 % (206);

неспецифических марке ров: mtrR – 48,3 % (224). Отсутствие выбранных маркеров резистентности на блюдалось в 31,7 % случаев (147 штаммов).

4) по данным тестов на чувствительность к спектиномицину в исследо ванной группе подавляющее большинство штаммов - 453 (97,6 %) относились к категории чувствительных, остальные 11 (2,4%) – к категории умереннорези стентных. Для описания генетических механизмов формирования резистентно сти гонококка к спектиномицину в панель генетических маркеров был включен ген 16S рРНК (rrs). В исследованной группе штаммов описанный в литературе полиморфизм не обнаружен.

5) с целью анализа распространенности известных генетических меха низмов устойчивости гонококка к макролидам выбраны следующие генетиче ские маркеры: mef (кодирует белок специфического эффлюкса), ermB, ermF (гены рибосомальных метилаз), мутации в гене rrl (ген 23S рРНК). В исследо ванной группе у 5 штаммов выявлен ген ermB, у одного штамма – ermF и у штаммов mef ген;

описанного ранее полиморфизма в гене rrl не обнаружено.

При анализе данных профиля антибиотикочувствительности обращает на себя внимание высокий процент штаммов, устойчивых к пенициллину (73,7 %), тетрациклину (63,8 %) и ципрофлоксацину (46,3 %). При этом штаммы, харак теризующиеся устойчивостью одновременно к двум или трём антибиотикам (мультирезистентные), также составляют большинство (64 %). Вместе с тем практически все анализируемые штаммы чувствительны к цефотаксиму и спек тиномицину. При отсутствии значимых региональных отличий в уровне лекар ственной устойчивости гонококка, можно говорить о повсеместной распро страненности резистентных и мультирезистентных штаммов, что подтверждает и продолжает описанную ранее тенденцию, характерную как для отдельных ис следованных территорий РФ [Никулин и соавт., 1999;

Страчунский и соавт., 1999;

Кобенко и соавт., 1999;

Верещагин и соавт., 2005], так и для микробной популяции гонококка в целом [Tapsall, 2002].

В настоящем исследовании впервые реализован одновременный анализ 15 генетических маркеров резистентности и использована методика анализа из вестных нуклеотидных полиморфизмов в реакции минисеквенирования с по следующим MALDI-TOF масс-спектрометрическим анализом. Техническое решение данной задачи представляет отдельный интерес. Этот подход уже применяется с успехом на практике, например, для анализа полиморфизма ге нов человека. При этом в последние годы масс-спектрометрия как высокоточ ный метод молекулярного анализа получает все большее распространение в биологии и медицине. MALDI-ТOF масс-спектрометрический анализ все чаще рассматривается как рутинный инструмент экспериментальной, а в отдельных его реализациях, и клинической микробиологии с достаточно широким полем возможных приложений [Fenselau and Demirev, 2001;

Ben L.M. van Baar, 2000;

Jackson O. Lay Jr., 2001]. Результаты нашей работы подтверждают возможность использования описанной технологии для анализа SNPs бактериального генома и, в частности, для мутаций – маркеров лекарственной устойчивости бактерии.

Разработанная система (дизайн праймеров, состав реакционных смесей, прото колы детекции), а также полученные экспериментальные данные могут слу жить одним из компонентов комплексного анализа микроба, объединенного единой инструментальной базой (MALDI-ТOF масс-спектрометр) и потому удобного для использования в практике клинико-диагностических лабораторий.

Полученные результаты позволили проанализировать частоты встречае мости различных генетических детерминант устойчивости. Ген b-лактамазы обнаружен у 3,9 % штаммов (18 из 464) со следующей географической принад лежностью: Санкт-Петербург (5), Самара (5), Москва (4), Чебоксары (1), Мур манск (1), Нижний Новгород (1), Екатеринбург (1). Все штаммы с наличием tetM-детерминанты (0,9 %) относились к Московскому региону. Приведенные данные свидетельствуют о большей распространенности плазмидных маркеров резистентности в субпопуляциях крупных промышленных и торговых центров с числом жителей, превышающим 1 миллион, при этом уровень распростра ненности плазмидных факторов резистентности в целом достаточно низкий.

Последний факт на фоне общего высокого процента резистентных к пеницил лину и тетрациклину штаммов указывает на то, что формирование регистри руемой резистентности, главным образом, обуславливается другими механиз мами, что подтверждено высоким процентом встречаемости генетических де терминант резистентности, локализованных на хромосоме.

Для установления ассоциации генотипа (совокупности определяемых ге нетических признаков) и фенотипа (категорий антибиотикочувствительности) проведена статистическая оценка полученных данных с помощью построения соответствующих таблиц сопряженности. Показана статистически значимая связь анализируемых признаков по критерию 2 Пирсона, p0,001 и коэффици енту сопряженности Крамера, который составил 0.64 / 0.53 / 0.89 при анализе данных по устойчивости к пенициллину, тетрациклину и ципрофлоксацину со ответственно. Анализ распределения отдельных маркеров и их сочетаний в группах чувствительных и резистентных штаммов позволил оценить информа тивность анализируемых генетических признаков для прогнозирования лекар ственной устойчивости. Учитывались уровень значимости выявленных отличий в группах чувствительных и резистентных, а также абсолютная частота встре чаемости маркера. Так, для каждого из трёх препаратов можно выделить гене тические маркеры (и их сочетания), обнаружение которых позволяет отнести тестируемый штамм к резистентной категории с вероятностью более 81 % (табл. 5).

Таблица 5. Маркеры и их сочетания, для которых показана прогностическая ценность при оценке анти биотикорезистентности N. gonorrhoeae к пенициллину, тетрациклину и ципрофлоксацину.

Антибиотик Генетический маркер P blapres 94 % Пенициллин ponAmut 81 % tetMpres 100 % Тетрациклин rspJmut, penBmut 81 % gyrAmut 83 % Ципрофлоксацин parCmut 83 % gyrAmut, parCmut 93 % P - Вероятность отнесения штамма к резистентной категории.

Такой выбор маркеров согласуется с современными (на момент оформле ния работы) теоретическими представлениями о соответствующих механизмах резистентности и является ожидаемым. В частности, исключение penAmut из числа отобранных маркеров согласуется с данными о доминирующей роли мо заичности структуры гена penA в механизме устойчивости не только к пени циллинам, но и цефалоспоринам [Ameyama et al., 2002]. При этом описанная ранее и включенная в список анализируемых нами маркеров мутация в гене penA (Asp-345a) обеспечивает низкий уровень устойчивости (0.125 мкг/мл) и, вероятно, является лишь первым этапом в серии изменений структуры гена penA и соответствующего ПСБ2, обуславливающих резистентность к беталак тамным антибиотикам.

Стоит отметить, что большинство выделенных маркеров соответствуют достаточно полно изученным механизмам, определяющим высокий, клиниче ски значимый уровень резистентности. В то же время другие рассмотренные нами маркеры ассоциированы с ещё плохо исследованными механизмами рези стентности, каждый из которых в отдельности даёт незначительный вклад в общий уровень устойчивости, и, лишь действуя синергично в различных ком бинациях, они способны формировать клинически значимый уровень рези стентности. Например, роль маркеров penBmut и mtrRmut в формировании клини чески значимого уровня резистентности к пенициллину остается неясной. По следние публикации на эту тему подтверждают сложность механизмов хромо сомно-детерминированной устойчивости гонококка к пенициллину, в частно сти, указывают на существование взаимосвязи между этими двумя механизма ми, которая необходима для реализации значимого уровня устойчивости [Ole sky et al., 2006;

Shafer et al., 2006], кроме того, описан на молекулярном уровне механизм действия обнаруженной ранее детерминанты penC [Ropp et al., 2002;

Zhao et al., 2005].

Не показано значимого вклада двух эффлюксных механизмов, соответст вующих маркерам mtrmut и norMmut. Примечательно, что все штаммы исследо ванной группы по значениям МПК ципрофлоксацина отнесены либо к чувстви тельным, либо к резистентным, тогда как умереннорезистентные не обнаруже ны. При этом сами по себе обе указанные мутации лишь незначительно повы шают значения МПК фторхинолонов, не обеспечивая даже уровня порогового значения (0.06 мкг/мл), однако, действуя одновременно с модификациями ми шеней действия (гиразы, топоизомеразы IV), умножают эффект последних. Та ким образом, полученные результаты дают дополнительные подтверждения от носительности вклада эффлюксных систем NorM и MtrRCDE в формирование устойчивости к фторхинолонам. Однако в ближайшей перспективе значимость эффлюксных механизмов может быть пересмотрена в связи с недавним описа нием у ряда грамположительных и грамотрицательных видов бактерий мобиль ных детерминант фторхинолоновой устойчивости (плазмидные гены qnr), обеспечивающих низкий уровень устойчивости [Jacoby et al., 2006].

Типирование штаммов N. gonorrhoeae и оценка гетерогенности популяции.

por-типирование. Определены нуклеотидные последовательности por генов 464 клинических штаммов, по результатам сравнения с ранее описанны ми аллельными вариантами установлены соответствующие серотипы. Проведен анализ распространенности сероваров PIA/PIB и отдельных серотипов в группе исследованных штаммов (табл. 6, рис.3).

100,0% 90,0% 80,0% 70,0% 60,0% 100,0% 100,0% 96,0% 94,1% 92,5% 92,3% 92,3% 91,9% 50,0% 88,6% 88,3% 72,5% 40,0% 30,0% 20,0% 27,5% 10,0% PIB 11,7% 11,4% 8,1% 7,5% 7,7% 7,7% 5,9% 4,0% PIA 0,0% 0,0% 0,0% к од рг г ск к ов ы РФ а а ур тс ьс кв ар ар бу ан р ск у нб ел ос ам го с рк ер м П ок и ов г М ур С И ан ет ер еб.Н М. -П рх ат Ч Н Ек А С Рисунок 3. Распространенность серотипов PIA и PIB в отдельных регионах РФ в сравнении с суммарной рас пространенностью по всем анализируемым регионам (p0,001).

Впервые получены значимые данные, подтверждающие гетерогенность популяции гонококка, распространенной на территории РФ. Данные, представ ленные в рамках системы серотипирования, могут быть сопоставлены с уже на копленной в разных странах мира информацией о распространенности и мно гообразии циркулирующих в популяции гонококка сероваров и серотипов и, следовательно, аллельных вариантов por гена.

Таблица 6. Por-типирование клинических штаммов N. gonorrhoeae, выделенных в регионах РФ Региональный Количество PIA серотипы PIB серотипы центр штаммов IA2 IA3 IA6 IA8 IA10 IA18 IB1 IB2 IB3 IB4 IB5 IB3/6 IB8 IB9 IB22 IB26 IB Архангельск 109 0 0 25 3 2 0 0 29 30 0 5 0 1 4 2 8 Екатеринбург 25 1 0 0 0 0 0 0 18 2 0 1 0 0 1 1 1 Иркутск 74 0 0 3 1 1 1 2 12 24 0 6 1 0 2 20 1 Калуга 5 0 0 0 0 0 0 0 4 0 0 0 0 0 0 1 0 Киров 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 Москва 26 0 0 1 1 0 0 0 13 7 0 1 1 0 0 1 1 Мурманск 85 0 0 5 0 0 0 0 52 17 0 1 2 0 0 4 4 Н. Новгород 26 0 0 0 0 0 0 0 10 9 0 2 0 0 0 4 0 Псков 11 0 0 0 0 0 0 0 2 5 1 0 2 1 0 0 0 Рязань 6 0 0 0 0 0 0 0 4 2 0 0 0 0 0 0 0 Санкт-Петербург 40 0 0 2 0 1 0 0 8 14 1 3 4 2 2 3 0 Самара 35 0 2 1 0 1 0 3 9 5 8 0 1 0 0 3 2 Ставрополь 8 0 0 0 0 0 0 0 5 1 0 1 0 0 0 1 0 Чебоксары 13 0 0 0 0 1 0 1 3 6 0 0 0 0 0 1 1 464 1 2 37 5 6 1 6 170 122 10 20 11 4 9 41 18 ВСЕ РЕГИОНЫ % 0,22 0,43 1,08 1,29 0,22 1,29 2,16 4,31 2,37 0,86 1,94 3,88 0, 7,97 36,64 26,29 8, 52 (11,2%) 412 (88,6 %) 444 1 2 37 5 6 1 6 156 119 10 19 11 4 9 39 18 ОТДЕЛЬНЫЕ % 0,23 0,45 1,13 1,35 0,23 1,35 2,25 4,28 2,48 0,9 2,03 4,05 0, 8,33 35,14 26,80 8, РЕГИОНЫ 52 (11,7%) 392 (88,3%) Примечания: 1 - включены регионы, для которых исследовано более 10 штаммов, жирным шрифтом отмечены частоты встречаемости доминирующих серотипов.

Всего в исследованной группе штаммов выявлено 11 PIB и 6 PIA серова ров, отмечено преобладание в выборке PIB серовара (88,6%) с высоким процен том встречаемости серотипов IB2 (41,3%), IB3 (29,6%) и IB22 (9,9%). В группе штаммов, относящихся к PIA серовару (11,2%), доминирует серотип IA (71,2%). Результаты согласуются с данными, полученными нами ранее для не большой группы клинических изолятов, выделенных в Москве, Московской области и Смоленске [Ильина и соавт., 2003]. Следует отметить, что убеди тельные данные о низкой встречаемости PIA серовара и представленности ос новных серотипов также получены для российской популяции впервые.

Для проверки гипотезы о связи PIB серовара с феноменом мультирези стентности гонококка [Bygdem et al., 1984, Backman et al., 1985], определенной как устойчивость к двум классам АМП и более, проведен соответствующий статистический анализ. Построены таблицы сопряженности, вычислены крите рий 2 Пирсона и коэффициент сопряженности Крамера: 1) для оценки наличия ассоциации между сероваром и признаком мультирезистености (табл. 7), 2) а также для проверки гипотезы о роли в этой ассоциации мутаций penB локуса (табл. 8).

Таблица 7. Наличие ассоциации между сероваром и фенотипом резистентности.

Фенотип Серовар S R Multi-R Всего 7 19 PIA 50 % 50 % 78 63 PIB 66 % 34 % Критерий 2 Пирсона, p0,001;

Коэффициент сопряженности Крамера - 0, Таблица 8. Вклад мутаций penB локуса в ассоциацию между PIB сероваром и мультирезистентностью.

Фенотип Серовар / генотип S R Multi-R Всего 7 19 26 PIA 50 % 50 % 68 28 63 PIB 60 % 40 % 10 35 208 PIB / penBmut 18 % 82 % Критерий 2 Пирсона, p0,001;

Коэффициент сопряженности Крамера - 0, Статистический анализ полученных данных показал достоверно слабую ассоциацию между ними (коэффициент сопряженности Крамера составил 0,17).

Отчасти это может быть объяснено резким количественным отличием сравни ваемых групп – относящихся к PIA серовару (52 штамма) и относящихся к PIB серовару (412 штамма), что снижает точность статистической оценки. Возмож но, в будущих работах при значительном увеличении выборки штаммов и, как следствие, увеличения абсолютного числа штаммов PIA серовара можно будет выявить более выраженную ассоциацию или опровергнуть наблюдаемый фе номен. С другой стороны, полученные результаты показывают, что частота встречаемости мультирезистентных штаммов в группе серовара PIB достоверно выше частоты «немультирезистентных» (чувствительные + резистентные к од ному препарату) штаммов: 66 % и 34 % соответственно (p0,001). Высказано предположение, что наблюдаемая нами слабая ассоциация обусловлена извест ными изменения penB локуса, которые, как было показано [Gill et al., 1998;

Ole sky et al., 2002, Olesky et al., 2006], вносят определенный вклад в формирование неспецифической резистентности гонококка путём снижения проницаемости поринового канала для ксенобиотиков. Проведенный статистический анализ распределения относительных частот указывает на справедливость высказанно го предположения.

Для ограниченной группы, включающей 87 штаммов, проведен деталь ный сравнительный анализ нуклеотидных последовательностей por генов с оценкой их гетерогенности. При сравнении двух основных вариантов por гена для аллели porB показана сравнительно большая гетерогенность, выражающая ся в большем числе аллельных вариантов, полиморфных сайтов, наличии 3-, 6-, 12-нуклеотидных инсерций и 6-нуклеотидных делеций. Вычисление нуклео тидного разнообразия (p) подтвердило эту предварительную оценку: величина p составила 0,004 и 0,03 для аллельных вариантов porA и porB, соответственно.

Тест на селекцию также выявил отличия в эволюции этих аллельных вариантов:

porB аллель достоверно вероятнее подвержена положительной селекции;

в слу чае porA варианта получены противоположные результаты, свидетельствующие о действии стабилизирующего отбора в эволюции этого локуса. Полученные данные согласуются с имеющимися в литературе указаниями на отличия в осо бенностях изменчивости и эволюции этих вариантов гена [Posada et al., 2000].

В ходе исследования описаны 55 нуклеотидных вариантов por гена. Для por-типирования индекс разнообразия Симпсона составил 0.97, что говорит о высокой дискриминирующей способности. Дендрограмма, построенная с ис пользованием матрицы попарных нуклеотидных отличий между анализируе мыми por-последовательностями, позволила разделить исследованную выборку на две крупные группы, соответствующие аллелям porA и porB, а также не сколько групп внутри porB аллели, однако это разделение не выявило какой либо ассоциации с географией выделения этих штаммов. В целом, полученные данные свидетельствуют о достаточно высоком уровне гетерогенности иссле дованной выборки.

Типирование мультилокусным секвенированием. Определены нуклео тидные последовательности фрагментов 13 генов «домашнего хозяйства» для 84 штаммов N. gonorrhoeae. Для каждого из 13 локусов проведено сравнение полученных последовательностей между собой, а также с последовательностя ми, представленными в базе данных GenBank. В соответствии с ранее принятой практикой каждый уникальный вариант последовательности (отличающийся от другого как минимум на один нуклеотид) рассматривался как отдельный ал лельный вариант, которому присваивался соответствующий номер (согласно данным, полученным Vischidi c соавт. и представленным в базе данных Gen Bank) или новый номер для аллелей, обнаруженных впервые. Таким образом, для каждого штамма получен аллельный профиль, представленный набором аллельных вариантов по всем 13 локусам.

Анализ гетерогенности фрагментов 13 генов «домашнего хозяйства» вы явил значительные отличия в уровне их изменчивости. При выборе генетиче ских локусов, которые могут быть в дальнейшем использованы для схемы мультилокусного типирования гонококка, ориентировались на максимально выявленное количество аллельных вариантов. Полученные характеристики ге нов были сравнимы с результатами, полученными ранее Viscidi et al. на группе из 25 штаммов [Viscidi et al., 2003]. В 2005 году этой же группой авторов (па раллельно с ходом нашей работой) были опубликованы результаты аналогич ного исследования, проведенного уже на группе около 200 штаммов, но пред ставляющих территориально ограниченную популяцию гонококка (штаммы выделены в двух клиниках Балтимора).

Сравнение результатов нескольких исследований, проведенных с исполь зованием качественно разных выборок клинических штаммов, позволяет с ещё большей уверенностью считать обоснованным выбор 7 локусов (fumC, gdh, glnA, gnd, pilA, pyrD, serC) для использования в схеме мультилокусного типи рования гонококка.

Выбранные локусы были использованы для оценки дискриминирующей способности метода, анализа гетерогенности и структуры исследованной вы борки. В сравнении с другими рассмотренными методами типирования показа на максимальная дискриминирующая способность этого подхода: индекс раз нообразия Симпсона составил 0.98. Дендрограмма, построенная с использова нием матрицы попарных отличий между аллельными профилями штаммов, подтвердила высокий уровень гетерогенности, разделила исследованную вы борку на несколько групп, отличных от групп, полученных по результатам сравнительного анализа аллелей por гена.

Полученные данные вносят вклад в создание наиболее информативной, стандартизированной системы мультилокусного типирования N. gonorrhoeae.

ЗАКЛЮЧЕНИЕ Высокий уровень изменчивости N. gonorrhoeae обуславливает продол жающийся рост лекарственной устойчивости возбудителя и увеличение числа бессимптомных, хронических и диссеминированных форм инфекции. В РФ от сутствует какая-либо система эпидемиологического мониторинга популяции N.

gonorrhoeae. Разработка методов молекулярного типирования штаммов N. gon orrhoeae для российской популяции возбудителя актуальна и имеет важное практическое и эпидемиологическое значение.

В настоящей работе предложен комплексный подход оценки клинически и эпидемиологически значимых свойств возбудителя, апробированный на гео графически неоднородной группе российских штаммов N. gonorrhoeae. Для всех исследованных регионов подтверждена высокая распространенность рези стентных и мультирезистентных штаммов, охарактеризованных с позиций из вестных генетических механизмов формирования лекарственной устойчивости.

Впервые исследованы возможности прямого белкового профилирования для характеристики штаммов гонококка. Полученные результаты указывают на возможность использования этого подхода для видовой идентификации возбу дителя. Данные о гететерогенности исследованной выборки штаммов получены с использованием двух подходов (por-типирование, мультилокусное секвени рование), основанных на прямом анализе нуклеотидных последовательностей фрагментов генома, отличающихся по уровню изменчивости и подверженности селекции в эволюционном процессе. Описана дискриминирующая способность и специфика молекулярно-эпидемиологической информации, получаемой каж дым из методов.

Результаты представленной работы способствуют осуществлению на тер ритории РФ мониторинга гонококковой инфекции на современном методоло гическом и технологическом уровне.

ВЫВОДЫ 1. Cформирована коллекция из 464 образцов ДНК клинических штаммов N.

gonorrhoeae, выделенных от пациентов из 14 региональных центров РФ.

2. Разработан и реализован подход к оценке антибиотикорезистентности N.

gonorrhoeae, основанный на одновременном анализе 15 генетических локу сов, позволивший выделить маркеры (и их сочетания), обнаружение кото рых с точностью более 81 % прогнозирует фенотипическую устойчивость гонококка к пенициллинам, тетрациклину, фторхинолонам.

3. Предложена методика прямого белкового профилирования с использовани ем MALDI-TOF масс-спектрометрии. Показана низкая дискриминирующая способность этого подхода (D = 0.27), что не позволяет использовать его для типирования N. gonorrhoeae, но указывает на возможность видовой идентификации.

4. Показана высокая дискриминирующая способность por-типирования (D = 0.97) и возможность анализа получаемых данных в рамках системы сероти пирования (D = 0.78). Установлен вклад мутаций penB локуса por гена в формирование мультирезистентности.

5. Анализ нуклеотидных вариаций 13 генов «домашнего хозяйства» N. gonor rhoeae позволил установить 7 наиболее информативных локусов: fumC, gdh, glnA, gnd, pilA, pyrD, serC, позволяющих осуществлять молекулярного ти пирования с высокой степенью дискриминации (D = 0.98).

6. Впервые на основании молекулярно-эпидемиологической характеристики географически неоднородной группы штаммов N. gonorrhoeae, выделенных на территории РФ, а) показан преимущественно хромосомный механизм формирования лекарственной устойчивости к пенициллину и тетрацикли ну;

б) определены частоты встречаемости различных серотипов с преобла дание PIB серовара (88.6 %);

в) выявлено значительное генетическое разно образие циркулирующих в популяции штаммов.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Малахова М.В., Верещагин В.А., Ильина Е.Н., Говорун В.М., Зубков М.М., Припутневич Т.В., Кисина В.И., Кубанова А.А. Анализ генетических маркеров ре зистентности N. gonorrhoeae к b-лактамным антибиотикам // Бюлл. экспер. биол.

мед. – 2006. – Т. 141, № 5. – С. 549-554.

2. Верещагин В. А., Ильина Е. Н., Зубков М. М., Припутневич Т.В., Кубанова А. А., Говорун В. М. Использование MALDI-TOF масс-спектрометрии для выяв ления в генах gyrA и parC Neisseria gonorrhoeae однонуклеотидных замен, опреде ляющих формирование устойчивости к фторхинолонам // Мол. биол. – 2005. – Т.

39, № 6. – С. 923-932.

3. Верещагин В.А., Ильина Е.Н., Малахова М.В., Зубков М.М., Сидоренко С.В., Кубанова А.А., Говорун В.М. Устойчивость к фторхинолонам среди Россий ских изолятов Neisseria gonorrhoeae // Мол. ген. микробиол. вир. – 2005 – № 1. – С.

23-27.

4. Vereshchagin V.A., Ilina E.N., Malakhova M.V., Zubkov M.M., Sidorenko S.V., Kubanova A.A., Govorun V.M. Fluoroquinolone-resistant Neisseria gonorrhoeae iso lates from Russia: molecular mechanisms implicated // J. Antimicrob. Chem. – 2004. – Vol. 53. – P. 653–656.

5. Ильина Е.Н., Малахова М.В., Верещагин В.А., Говорун В.М., Сергиенко В.И., Зубков М.М., Васильев М.М., Кубанова А.А. Молекулярное типирование штаммов N. gonorrhoeae, распространенных на территории РФ // Бюлл. экспер.

биол. мед. – 2003. – Т.136, № 8. – С. 205-208.

6. Vereshchagin V., Ilina E., Al-khafaji N., Priputnevich T., Kubanova A., Sidorenko S. and Govorun V. Intact-cell MALDI-TOF Mass-spectrometry for Identification and Subtyping of Pathogenic Neisseria. // In 15th International Pathogenic Neisseria Confer ence (IPNC 2006 Australia). Program and

Abstract

Book. – 2006. – P. 77.

7. Ilina E. N., Vereshchagin V. A., Malakhova M. V., Priputnevich T. V., Al khafaji N. C., Kubanova A. A., Govorun V. M. Molecular Characterization of Clinical Neisseria Gonorrhoeae (NG) Strains in Russia. Poster # ICAAC06-A-2308-ASM in “46th ICAAC (USA, San Francisco) Abstracts book”. – 2006.

8. Верещагин В.А., Ильина Е.Н., Припутневич Т.В., Кострюкова Е.С. Челыше ва В.В., Момыналиев К.Т., Говорун В.М. Прямое белковое профилирование для идентификации и типирования бактерий // В Тезисах научных работ IX всеросий ского съезда дерматовенерологов. – 2005, Москва. – Т. 2. - С. 40.

9. Ильина Е.Н., Малахова М.В., Верещагин В.А., Припутневич Т.В., Говорун В.М. Масс-эррей как инструмент анализа резистентности бактериальной флоры // В Тезисах научных работ IX всеросийского съезда дерматовенерологов. – 2005, Москва. - Т.2 - С.41.

10. Ilina E.N., Malahova M.V., Vereschagin V.A., Kubanova A.A., Zubcov M.M. and V.M. Govorun. Typing N. gonorrhoeae Strains In Russia // GENOMES 2004: Interna tional Conference on the Analysis of Microbial and Other Genomes, Abstract Book. – 2004. - P. 50.

11. Sidorenko S.V., Vereschagin V.A., Malahova M.V., Ilina E.N., Govorun V.M., Zubkov M.M., Kubanova A.A. Emergence of Fluoroquinolone Resistance among Neis seria gonorrhoeae in Russia // 42th ICAAC Abstracts book. – 2003, Chicago, Illinois.

СПИСОК ИСПОЛЬЗОВАННЫХ СОКРАЩЕНИЙ АМП – антимикробные препараты ДНК – дезоксирибонуклеиновая кислота МПК – минимальная подавляющая концентрация п.н. – пар нуклеотидов ПЦР – полимеразная цепная реакция РФ – Российская Федерация ФГУ ЦНИКВИ – Федеральное государственное учреждение Центральный на учно-исследовательский кожно-венерологический институт MALDI-TOF масс-спектрометрия - времяпролётная масс-спектрометрия с мат ричной лазерной десорбционной ионизацией (Matrix-Assisted Laser Desorp tion/Ionization Time of Flight Mass-Spectrometry)

 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.