авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Гибридизация белой (motacilla alba linnaeus,

На правах рукописи

СЕМЕНОВ Георгий Александрович ГИБРИДИЗАЦИЯ БЕЛОЙ (MOTACILLA ALBA LINNAEUS, 1758) И МАСКИРОВАННОЙ (M. (A.) PERSONATA GOULD, 1861) ТРЯСОГУЗОК НА ЮГЕ СИБИРИ Специальность: 03.02.04 – зоология

АВТОРЕФЕРАТ

диссертации на соискание учной степени кандидата биологических наук

Новосибирск – 2011

Работа выполнена в лаборатории тематической группы Экология птиц Института систематики и экологии животных СО РАН

Научный консультант: кандидат биологических наук, Юрлов Александр Константинович

Официальные оппоненты: доктор биологических наук, профессор Доржиев Цыдыпжап Заятуевич (Бурятский государственный университет, г. Улан-Удэ) кандидат биологических наук Редькин Ярослав Андреевич (Зоологический музей МГУ, г. Москва) Ведущее учреждение: Биолого-почвенный институт ДВО РАН, г. Владивосток

Защита диссертации состоится 25 января 2011 г. на заседании Диссертаци онного совета Д 003.033.01 при Институте систематики и экологии животных СО РАН по адресу: 630091, г. Новосибирск, ул. Фрунзе, д. 11.

Тел./факс (8 383) 217 09 73;

e-mail: dis@eco.nsc.ru

С диссертацией можно ознакомиться в библиотеке Института систематики и экологии животных СО РАН

Автореферат разослан « » декабря 2010 г.

Учный секретарь Диссертационного совета, кандидат биологических наук Л.В. Петрожицкая

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследований. Феномен гибридизации дивергировавших форм у позвоночных привлекает внимание по двум основным причинам. С одной стороны, адекватное определение таксономического статуса гибридизирующих популяций возможно только после всестороннего исследования характера их отношений. С другой стороны, естественная гибридизация предоставляет уникальный материал для изучения механизмов микроэволюции, связанных с функционированием ре продуктивной изоляции.

Представители подрода длиннохвостых трясогузок Motacilla (Motacillidae, Passeriformes, Aves) демонстрируют широкий спектр пространственных и репро дуктивных взаимоотношений. Недостаточно изученной остается группа белых тря согузок Motacilla alba sensu lato. У двух форм комплекса, маскированной M. (a.) personata и белой M. alba sensu stricto трясогузок, имеющих неоднозначный таксономический статус, существует область перекрытия ареалов и гибридизации на юге Сибири. Взаимоотношения этих полувидов не служили предметом специ альных исследований [Степанян, 1983], что определяет актуальность изучения данной пары форм.

Целью нашей работы было изучение гибридизации белой и маскированной трясогузок на юге Сибири.

Задачи:

1.Выявление характеристик особей гибридного происхождения.

2.Определение границ ареалов и характера пространственных отношений на юге Сибири.

3. Оценка уровня гибридизации на юге Сибири на основании данных по фе нотипическому составу и морфометрии.

4. Выяснение характера варьирования молекулярно-генетических маркров в условиях аллопатрии и симпатрии.

5. Рассмотрение возможных факторов изоляции в данной паре форм.

Научная новизна. В работе впервые обобщены данные по распространению отдельных форм для региона, определены границы гибридных зон. Впервые прове ден анализ признаков фенотипических гибридов, на его основании описан ряд пе реходных фенотипов;

оценен фенотипический состав и уровень гибридизации на юге Сибири на основании собственных данных. Изучена морфометрическая из менчивость в условиях аллопатрии и симпатрии, приводятся данные по наследова нию промежуточных признаков у гибридов. Выявлены свидетельства интрогрессии в ареалы родительских форм. Проведен критический анализ изолирующих факто ров в данной паре форм на основании авторского материала по биотопическим предпочтениям, демонстрационному поведению и экологическим особенностям.

Теоретическая и практическая значимость. Полученные в ходе исследо вания результаты вносят вклад в познание механизмов репродуктивной изоляции сестринских видов на ранних этапах дивергенции. Результаты работы позволяют пролить свет на таксономическое положение отдельных форм и группы белых тря согузок в целом. Материалы диссертации могут быть использованы как базовые для проведения дальнейших исследований экологических изолирующих механиз мов в данной паре форм.

Апробация работы. Основные положения работы были доложены на засе дании Московского общества испытателей природы (Москва, 2010) и семинарах ИСиЭЖ СО РАН. Некоторые положения диссертации были представлены на IV международной орнитологической конференции «Современные проблемы орнито логии Сибири и Центральной Азии» (17-20 сентября 2009 г., г. Улан-Удэ).

Публикации. По материалам диссертации опубликовано четыре работы, в том числе две – в рецензируемых изданиях, рекомендованных ВАК для публика ции основных материалов диссертации.

Объм и структура диссертации. Диссертация изложена на 106 страницах и состоит из введения, 5 глав, заключения, выводов, списка литературы (109 ис точников из которых 49 на иностранных языках) и 1 приложения. Работа содержит 19 рисунков и 6 таблиц.

Благодарности. Работа выполнена под руководством к.б.н. А.К. Юрлова, которому автор выражает искреннюю признательность за всестороннюю поддерж ку на всех этапах работы. Автор признателен Е.В. Екимову, вдохновившему на изучение трясогузок и оказавшему значительную помощь на начальных этапах ис следований. Автор благодарит заведующего отделением орнитологии Зоологиче ского Института РАН В.М. Лоскота, заведующего сектором орнитологии Зоологи ческого Музея МГУ П.С. Томковича, заведующего Зоомузеем ТГУ С.С. Москвити на, сотрудника Института зоологии МОН Республики Казахстан А.Ф. Ковшаря за любезно предоставленную возможность работы с коллекциями. За ценные советы, конструктивную критику и помощь в подготовке рукописи глубочайшая призна тельность выражается А.А. Лисовскому, Д.Р. Хайдарову, Е.А. Коблику, А.С. Руб цову и В.С. Жукову. Автор признателен соратникам по экспедициям, коллегам и знакомым, оказавшим помощь в сборе материала: Е. Хоботову, А. Сафонову, С. Андрееву, М. Амзараковой, И. Савченко, А.П. Савченко, Е. Давидюку, Н.Н. Балацкому, М. Бакаеву, Ю. Данилову. Автор глубоко благодарен А.В. Катохину, оказавшему неоценимую помощь в освоении молекулярно генетических методов исследований. Отдельно хотелось бы поблагодарить супругу автора Юлию Шеину за участие в подготовке иллюстраций, понимание и терпение.

Работа выполнена при частичной поддержке интеграционного проекта СО РАН № 112 «Экспериментальный и биоинформационный анализ видообразования у мле копитающих и птиц» и программы президиума РАН «Биологическое разнообра зие» проект № 23.6.

СОДЕРЖАНИЕ РАБОТЫ

ГЛАВА 1. ГРУППА БЕЛЫХ ТРЯСОГУЗОК КАК ОБЪЕКТ МИКРОЭВОЛЮЦИОННЫХ ИССЛЕДОВАНИЙ 1.1. Современные взгляды на видообразование у птиц Объем и границы таксонов зависят от точек зрения на видообразование раз личных научных школ. Среди орнитологов наибольшее число сторонников имеют две концепции вида: биологическая (БКВ) и филогенетическая (ФКВ), в первой внимание фокусируется на степени репродуктивной изолированности, во второй (в ее современном варианте) – на степени различий по молекулярным маркрам. Од нако, есть веские основания утверждать, что ни критерий репродуктивной изоля ции, ни степень сходства по молекулярным маркрам сами по себе не могут быть решающими при принятии таксономического решения. Для определения таксоно мического статуса гибридизирующих форм необходимы исследования, учитываю щие характер взаимоотношений на основе данных морфологии, генетики, этологии и экологии. Лишь при комплексном подходе можно ожидать, что термин «вид» бу дет иметь не только таксономический, но и биологический смысл. Противоречия между различными концепциями вида не столь велики, как кажется и по видимому, проблема вида заключается в том, что концепции фокусируются на раз ных аспектах и этапах процесса видообразования [Панов 1993;

Крюков, 2003;

Price, 2008;

Абрамсон, 2009]. Следует отдельно подчеркнуть, что феномен гибридизации представляет собой «камень преткновения» как для БКВ, так и ФКВ в ее современ ном варианте. Несмотря на очевидную важность изучения гибридизации популя ций высоких рангов, комплексные работы такого рода на настоящий момент оста ются немногочисленными [Панов, 1993;

2008].

1.2. Представители комплекса белых трясогузок Motacilla alba sensu lato как объект микроэволюционных исследований Белые трясогузки окрашены в сочетание белых, чрных и серых цветов. Гео графическая изменчивость затрагивает, главным образом, рисунок оперения по бо кам головы и шеи, степень развития белой окраски на крыле, цвет спины и размер ные признаки. В подроде Motacilla есть формы, демонстрирующие как широкую симпатрию без гибридизации в настоящее время (M. grandis Sharpe, 1885, M.

maderaspatensis J. F. Gmelin, 1789), так и ограниченную гибридизацию в узкой зоне контакта (представители комплекса белых трясогузок Motacilla alba sensu lato). По следние представляют наибольший интерес для изучения вопросов видообразова ния. В нашем исследовании мы сфокусировали внимание на паре M. alba sensu stricto – M. (a.) personata. Анализ литературных данных наводит на мысль, что при чиной наличия нескольких точек зрения на таксономический статус маскированной трясогузки служит, в первую очередь, недостаточная изученностью ее взаимоот ношений с другими формами в областях их контакта. Между тем, данная природ ная ситуация предоставляет превосходную возможность для исследования процес сов становления и функционирования механизмов репродуктивной изоляции на ранних этапах обособления сестринских форм.

ГЛАВА II. МАТЕРИАЛЫ И МЕТОДЫ 2.1. Районы полевых работ Полевые работы проведены в период с начала апреля по первую декаду июля 2005-2010 гг. в Ачинской лесостепи, Канской лесостепи, долине Енисея от села Новоселово на север до устья р. Подкаменная Тунгуска, в Западном Саяне (река Ус в местах пересечения с трассой М 54, пос. Танзыбей, Арадан), в северных, цен тральных и южных районах республики Тыва (Тува), в Южной Барабе (Здвинский район Новосибирской области), в окрестностях Новосибирска, в северных и севе ро-западных Предгорьях Кузнецкого Алатау (Кемерово, Новокузнецк), вдоль трас сы М 53 по маршруту Красноярск – Зима (реки Бирюса, Уда, Ия, Ока).

2.2. Морфометрический анализ и данные по экологии Характеристики фенотипически чистых M. alba s. s. (формы baicalensis и dukhunensis) и M. (a.) personata, были определены по рисункам и описаниям типо вых экземпляров [Sharpe, 1885;

Warren et al., 1971] с учетом данных об уровне ва риаций рисунка оперения в аллопатрических частях ареала. Для снятия морфомет рических показателей и регистрации фенотипа птиц отлавливали с помощью пау тинных сетей и лучков или добывали [Савченко и др., 2006], с последующим изго товлением коллекционных шкурок, часть из которых была передана в Зоологиче ский музей МГУ, Зоологический институт РАН и ИСиЭЖ СО РАН. Объем автор ской выборки составляет 347 экз. В анализе окрасочных и размерных характери стик, фенотипического состава использованы только самцы. У добытых и отлов ленных птиц измеряли длину крыла, хвоста и клюва от границы оперения лба до кончика по стандартным методикам [Виноградова и др., 1976].

Для сравнения с музейными шкурками, нами были созданы пересчетные ко эффициенты (частное от промера у свежедобытой птицы, к значению, снятому по сле хранения шкурки этого экземпляра от 1 до 3 лет), которые получили в резуль тате повторной обработки 87 экземпляров (1.022 для длины крыла и 1.051 для дли ны хвоста). Помимо собственных сборов были использованы коллекционные мате риалы Зоологического института РАН (ЗИН) (n=193), Зоологического музея МГУ (ЗММГУ) (n=188), Томского Государственного Университета (ТГУ) (n=31), Инсти тута систематики и экологии животных СО РАН (ИСиЭЖ) (n=6), Института зооло гии Республики Казахстан (ИЗРК) (n=6). Общий объм проанализированной вы борки составил 771 экз.

Статистическая обработка данных выполнена в программе Statistica 6.0.

Сравнение выборок по морфометрическим показателям осуществлено с помощью однофакторного дисперсионного анализа, расчет корреляции выполнен по методу Спирмана. Различия между выборками по фенотипическому составу оценены с помощью критерия Колмогорова-Смирнова. Для оценки статистических гипотез был принят уровень значимости 5 %.

Данные по фенотипическому составу размножающихся пар были собраны в области среднего течения Енисея (n=45) и на юге Тувы (n=39). Успешность вылуп ления (n=10) и сроки размножения (n=18) были оценены на основании наблюдений на юге Тувы. Материалы по демонстрационному поведению получены в Краснояр ской лесостепи, Туве, предгорьях Западного Саяна.

Рисунок 3 выполнила Ю.И. Шеина.

2.3. Выделение ДНК и ПЦР У добытых птиц брали часть грудной мышцы (300-500 мг), которую фикси ровали в 96 % спирте (n=33), и по приезду в лабораторию хранили при –20C. Об разцы (n=8) из аллопатрических частей ареала маскированной трясогузки (Кирги зия, Казахстан, Туркменистан) были получены нами от музейных шкурок, хранив шихся в коллекции ЗММГУ не более 60 лет (№№ R-121218, R-74633, R-77263, R 121217, R-121221, R-74635, R-74634, R-93433). В последнем случае, от основания пальца отрезался кусочек примерно в 1 мм3, который сохранялся в сухом виде до экстракции. Из заспиртованных тканей, предварительно измельченных и обрабо танных протеиназой K, ДНК выделяли по стандартному фенол-хлороформному методу [Маниатис, 1998] и растворяли в буфере TE, либо с помощью 5-10 % вод ной суспензии Chelex 100 (Sigma) в соответствии с рекомендациями производите ля. Из музейных образцов ДНК выделяли с помощью 5 % водной суспензии Chelex 100 (Sigma), увеличивая время инкубации до 12-16 часов в термостате при 56C.

Для амплификации фрагмента D-петли контрольного района (Control region) митохондриальной ДНК (мтДНК) длиной 610 п.о. мы использовали разработанные совместно с А.В. Катохиным СО РАН) праймеры (ИЦиГ CRFW 5' CGGCATACCGACCTCTTA-3' и CRRV 5'-GTCCTTGGGTGTGTATGGCA-3' (тем пература отжига 55 C). Для ДНК от музейных экземпляров на тот же участок кон трольного района были разработаны 5 пар праймеров, с помощью которых ампли фицировали фрагменты длиной 105-241 п.о., перекрывавшиеся примерно на 1/ Подбор праймеров выполнен в программе (табл. 1). Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome), доступной онлайн на сайте NCBI.

ПЦР проводилась в 40 µl, в состав реакционной смеси входили праймеры (0.2 µM), смесь трифосфатов «Медиген» (0.5 µM), буфер для taq-полимеразы «Ме диген», taq-полимераза «Медиген» и 1 µl экстракта ДНК (при выделении фенол хлороформным методом), либо 5 µl экстракта ДНК (при выделении с помощью Chelex 100 (Sigma)). Реакция включала 2 шага: (94 2') один цикл;

(94 15'', 54 30'', 72 1') 35 циклов. Реакция для секвенированию по Сэнгеру проводилась в 25 µl с использованием Bigdye terminator v. 3.1 (Applied Biosystems) в соответствии с ре комендациями производителя.

Таблица 1. Праймеры, использованные для амплификации фрагмента гена контрольного района мтДНК от музейных образцов Название длина продукта, п.о.

5'-3' t, C CRA FW ACTCCTCCCTACTCTCACCGA 55 CRA RV TAGCGCGCCCTCCATGAAT CRC FW CGTTTTCTAGGGACTTTGCCT 53 CRC RV GGGGAGGATGGGGTAGTTGT CRD FW TAAAACAAACCACCGCCCCC 54 CRD RV ACCTAGCAAAAACTACCAGTAAGGT CRE FW GCAAACTTGACACTGATGCACT 53 CRE RW AACACGCGTAAAATGGGCTT CRF FW CCATACTTCCCTACATTTTCCAAATCA 54 CRF RW ACGCTGGTTGAAGGGTTGGA Термопрофиль реакции Сэнгера: (94 1') 1 цикл, (94 10'', 58 10'', 60 3') циклов. Реактив Bigdye terminator v.3.1 предоставлен Центром коллективного поль зования автоматического секвенирования ДНК СО РАН, этим же учреждением проведено секвенирование, т.е. анализ продуктов реакции по Сэнгеру.

Сиквенсы были выровнены и обработаны с помощью BIOEDIT [Hall, 1999].

Дендрограмма построена методом присоединения соседей (NJ) в программе MEGA 4.1 с применением модели Кимура 2 и оценена с помощью бутстреп-анализа ( репликаций) [Ней и др., 2004;

Лукашов, 2009]. Для разработки праймеров и срав нения с собственными материалами были использованы сиквенсы Motacilla alba sensu lato, хранящиеся в GenBank: AY681730 – AY681963, и близких видов M. aguimp AF445526, M. capensis AF445518, M. clara AF445522, M. maderaspatensis AY682721.

ГЛАВА III. ВЗАИМООТНОШЕНИЯ В ОБЛАСТИ КОНТАКТА 3.1. Признаки фенотипических гибридов При работе с собственными сборами и музейными коллекциями мы оцени вали у каждой особи рисунок оперения на 12 партиях на голове, шее, спине, а так же степень развития белого цвета на маховых перьях и верхних кроющих крыла.

Мы выяснили [Семенов и др. 2010а], что наиболее значимым для анализа феноти пическим маркром гибридизации следует признать рисунок оперения по бокам головы и шеи. На основе данных по изменчивости этого участка мы разделили фе нотипы на 6 классов (вкладка рис. 3).

То, что особи с сильным развитием промежуточных признаков III и IV фено типических классов (ф.к.) являются гибридами, не вызывает сомнений, поскольку их происхождение в результате гибридизации подтверждено наблюдениями мно гих независимых исследователей, а распространение таких фенотипов ограничено зонами симпатрии родительских форм [Сушкин, 1938;

Paludan, 1938, Степанян, 1983;

Нейфельдт, 1985;

Панов, 1989;

Редькин, 2003;

Pavlova et al., 2005]. По ряду соображений, которые подробно обсуждаются в диссертации, мы считаем особей II и V фенотипических классов гибридами (вероятно, беккроссами) со слабым прояв лением промежуточных признаков. В пользу этой точки зрения служат данные по географической изменчивости рисунка оперения, размерных признаков и молеку лярных маркеров. Однако, оснований для однозначного ответа на вопрос об их происхождении на настоящий момент все же нет. Одним из путей его решения мо жет быть сравнение фенотипических классов на основании AFLP анализа, что было успешно осуществлено в сходном примере с гибридизирующими обыкновенной Emberiza citrinella и белошапочной E. leucocephala овсянками [Irwin et al., 2009].

3.2. Уровень гибридизации на основании данных по фенотипической измен чивости Маскированная M. (a.) personata и белая M. alba s. s. трясогузки имеют две пространственно разобщнные области перекрытия ареалов. Одна (далее сибир ская) область перекрытия ареалов находится на юге Сибири, другая (далее иран ская) располагается в южном Прикаспии в пределах западных частей хребта Ко петдаг, южного макросклона хребта Эльбурс и в горах Загрос (вкладка рис. 1). В Средней Сибири два подвида M. alba s. s. – dukhunensis и baicalensis интергради руют [Степанян, 1990;

2003;

Семенов и др., 2010а], в силу этого, в облике многих экземпляров сочетаются признаки обеих форм. Поскольку основной упор в нашем исследовании сделан на взаимоотношениях полувидов и M. (a.) personata M. alba s. s., в большинстве случаев, мы не рассматриваем подвиды белой трясо гузки baicalensis и dukhunensis по отдельности, кроме специально оговорнных случаев.

В сибирской зоне контакта представлены все варианты фенотипов (n=231), переходных от белой к маскированной трясогузке. Родительские фенотипы состав ляют 8.7 % для M. (a.) personata (I фенотипический класс) и 17.7 % для M. alba s. s.

(VI ф.к.), в наибольшем числе (38.5 %) представлены экземпляры с общим обликом personata, но имеющие слабо выраженные промежуточные признаки (II ф.к.). Доля птиц с общим фенотипом alba со слабыми промежуточными признаками (V ф.к.) составляет 16.9 %, доля особей с сильным развитием промежуточных признаков составляет 10.4 % для III ф.к. и 7.8 % для IV ф.к. Ситуация в иранской гибридной зоне не совсем ясна в силу недостатка материалов. По литературным данным, в пределах этой области M. (a.) personata интерградируют с M. alba s. s. (подвид duk hunensis) [Vaurie, 1959;

Степанян, 1983], с другой стороны, имеются указания, что в северных частях Ирана M. alba s. s. и M. (a.) personata обитают симпатрично, в от сутствие гибридизации [Зарудный, 1903]. По всей видимости, обсуждаемые формы гибридизируют в этом регионе, однако оценить размах на основании имеющихся коллекционных данных (ЗММГУ, ЗИН, n=9) не представляется возможным.

По-видимому, поток генов из гибридных зон находит отражение в феноти пическом составе популяций родительских форм. Доля особей со слабым проявле нием промежуточных признаков клинально уменьшается по мере удаления от гиб ридных зон, однако в наиболее удаленных от зон контакта (до 1000-1500 км) алло патрических частях ареала маскированной трясогузки экземпляры с признаками гибридизации (II ф.к.) составляют 12.8 % (n=45). В аллопатрическом ареале белой трясогузки, птицы со следовыми признаками гибридизации составляют 5.9 % (n=51) для dukhunensis и 9.5 % (n=21) для baicalensis (вкладка рис. 1, А, Г). Следует подчеркнуть, что экземпляры с сильным развитием промежуточных признаков (III IV ф.к.) полностью отсутствуют за пределами зоны симпатрии.

3.3. Форма persica В сибирской области перекрытия ареалов, нами были обнаружены особи со ответствующие фенотипу Motacilla personata var, persica Blanford, 1876 [Семенов и др. 2010а], описанной из иранской гибридной зоны [Blanford, 1876;

Sharpe, 1885;

Sarudny, 1911 Glutz von Blotzheim, 1985]. Форму persica во многих сводках, в том числе и самых последних, рассматривают в качестве самостоятельной географиче ской расы [Vaurie, 1959;

Glutz von Blotzheim, 1985;

Tyler, 2004], несмотря на то, что е происхождение в результате гибридизации считается доказанным [Paludan, 1938]. Сопоставление описаний и рисунков особей из Ирана [Blanford, 1876;

Sharpe, 1885;

Glutz von Blotzheim, 1985], экземпляра из западного Копет-Дага (ЗММГУ R-121218) с нашими экземплярами из сибирской зоны гибридизации, приводит к выводу об отсутствии сколько-нибудь заметных отличий.

По всей видимости, persica не является валидным таксоном, поскольку пред ставляет собой некоторые варианты фенотипических гибридов [Семенов и др.

2010а].

3.4. Границы распространения трясогузок на юге Сибири и фенотипический состав в некоторых выборках До настоящего момента мы рассматривали сибирскую гибридную зону в це лом, однако, такой подход не вполне корректен. Если провести границы области совместного обитания по самым удаленным точкам встреч отдельных особей, об ласть перекрытия ареалов занимает значительную площадь (вкладка рис. 2). Тем не менее, на основании данных из регионов, где фенотипический состав подробно изучен, мы можем судить, что собственно гибридные зоны гораздо менее обширны и имеют резко очерченные границы, а в остальной области перекрытия ареалов до ля особей с общим обликом той либо другой формы (включая экземпляры со сла бым проявлением промежуточных признаков) близка к 100 % [Семенов и др., 2010;

Семенов и др., 2010а]. Возможно, в других частях зоны контакта также существуют участки гибридных зон, однако доступные на текущий момент материалы не по зволяют сделать заключение на этот счет. Правильнее всего охарактеризовать про странственные и репродуктивные отношения между данными формами как пара патрию [Панов, 1989] с гибридизацией в зонах контакта и регулярными залтами соседствующих форм.

Далее под гибридными зонами мы будем подразумевать территории, где присутствуют обе родительские формы (или фенотипически близкие к ним экземп ляры) в количестве не менее 5 % каждая. На юге Сибири ареал маскированной тря согузки окружен, по меньшей мере, четырьмя участками гибридных зон (вкладка рис. 2). Если рассмотреть выборки (n=80) из ареала маскированной трясогузки в Сибири за пределами зоны контакта (вкладка, рис. 2, «1»), то доля фенотипически чистых особей составит 15 %, а доминируют (73.8 %) экземпляры со слабым разви тием промежуточных признаков – II ф.к. При этом в аллопатрических частях ареа ла вблизи гибридных зон присутствуют (11.2 %) особи с сильным развитием про межуточных признаков – III ф.к. Для сравнения, в выборках (вкладка, рис. 2, «2») из ареала M. alba s. s. (n=25) с территорий, удалнных от гибридных зон на при мерно такое же расстояние (200-400 км), фенотипически чистые особи составят 92.0 %, а близкие к фенотипически чистым (V ф.к.) 8.0 %. Следует указать на абсо лютное доминирование фенотипически чистых особей в ареале белой трясогузки и отсутствие экземпляров с сильным развитием промежуточных признаков уже на некотором удалении от гибридной зоны. Напротив, у маскированной трясогузки соотношение изменяется в пользу фенотипически чистых птиц только в регионах, максимально удаленных от гибридных зон (не менее 700 км). Эти данные (вкупе с материалами по изменчивости пластических признаков и молекулярных маркров, см. ниже) позволяют предполагать, что поток генов в аллопатрические популяции M. (a.) personata в Сибири интенсивнее (выше уровень интрогрессии), чем в попу ляции M. alba s.s.

3.5. Различия в уровне гибридизации на некоторых участках сибирской гиб ридной зоны На различных участках сибирской гибридной зоны варьирует соотношение фенотипических классов. Мы располагаем материалами для сравнения фенотипи ческого состава на трех из них (вкладка рис. 2, А-В) Достоверно различаются (p0.05) выборки из южной Тувы (вкладка рис. 2, В) и со среднего Енисея (А). В южной Туве выше доля фенотипически чистых осо бей обеих родительских форм, и значительно меньше экземпляров с сильным раз витием промежуточных признаков. Так, на среднем Енисее доля фенотипически чистых маскированных трясогузок составляет 1.0 %, белых – 13.4 %. В Туве фено типически чистых маскированных трясогузок 27.9 %, белых – 16.3 %. Особенно заметны отличия в численности особей с сильным развитием гибридных призна ков, которых в Туве 2.3 % III ф.к. и 2.3 % IV ф.к., в то время как на среднем Енисее 14.4 % III ф.к. и 9.3 IV ф.к.

Такие различия в фенотипическом составе обусловлены меньшим уровнем гибридизации в Туве, что на наш взгляд, указывает на существование изолирую щих механизмов, которые в Туве действуют более эффективно. Не обнаружено статистических отличий между выборками из южной Тувы (В) и северными частя ми Кузнецкого Алатау (Б), Кузнецким Алатау (Б) и средним Енисеем (А) (p0.1).

Это не особенно удивительно, поскольку различия в уровне гибридизации обу словлены (как мы предполагаем), главным образом, экологическими факторами.

Район Кузнецкого Алатау имеет промежуточное широтное положение между уча стками «А» и «В» и, по всей видимости, характеризуется промежуточными эколо гическими условиями, влияющими на уровень гибридизации.

3.6. Изменчивость пластических признаков Результаты анализа метрических признаков свидетельствуют о значительном влиянии гибридизации на размерные характеристики симпатрических популяций изучаемых форм [Семенов, 2009]. На основании данных дисперсионного анализа, аллопатричные популяции всех трех форм (M. (a.) personata, M. a. dukhunensis.

M. a. baicalensis) достоверно отличаются друг от друга, однако, в условиях симпат рии достоверных различий между ними нет. Маскированная трясогузка, которая в области аллопатрии крупнее baicalensis по длине крыла и клюва, и по всем трем признакам крупнее dukhunensis, в условиях симпатрии «мельчает» настолько, что ее симпатрические и аллопатрические популяции достоверно отличаются. Напро тив, dukhunensis в условиях симпатрии «крупнеет» по средним длинам крыла и хвоста и тоже достоверно отличается от аллопатрически обитающих популяций.

Таким образом, в симпатрии у M. (a.) personata и M. alba s.s. изученные размерные признаки «усредняются», что на наш взгляд, объясняется интенсивным генетиче ским обменом между ними.

3.7. Возможный механизм наследования признаков окраски Мы располагаем материалами, позволяющими предполагать, что за наследо вание окрасочных признаков, отличающих обсуждаемые формы, ответственно ма лое число генов, по всей видимости, не более двух пар аллелей. На эту мысль наво дит сам характер фенотипических переходов, имеющих лишь несколько промежу точных вариантов и высокая коррелированность в наследовании элементов рисун ка оперения у гибридов (данные положения подробно обсуждается в диссертаци онной работе) [Семенов и др., 2010а]. В 2006 из гибридной зоны (вкладка, рис. 2,А) на среднем Енисее (с. Новоназимово) был доставлен и содержался в неволе выво док смешанной пары (самец – маскированная трясогузка II ф.к., самка – белая тря согузка V ф.к.). В брачном наряде фенотипы 4 потомков распределились следую щим образом: одна из птиц (самка) имела фенотип маскированной трясогузки II ф.к. (как у отца), одна птица (также самка) имела фенотип белой трясогузки со сла бым развитием промежуточных признаков V ф.к. (как у матери), двое других (сам цы) имели облик белой трясогузки с сильным развитием промежуточных призна ков IV ф.к. Подобное распределение фенотипов у смешанной пары и данные о зна чительном числе экземпляров с сильным развитием гибридных признаков на сред нем Енисее, позволяют предполагать, что фенотипы III-IV ф.к. не являются про дуктом сочетания рецессивных аллелей (в противном случае, они заметно уступали бы в числе родительским фенотипам). Однако, против таких особей, по всей види мости, действуют какие-то формы отбора (вероятнее всего, полового) на большей части ареала, поэтому их распространение ограничено собственно гибридными зо нами и их ближайшими окрестностями.

3.8. Изменчивость митохондриальных последовательностей По молекулярным данным, генетические дистанции между маскированной и белой трясогузками существенно меньше, чем между белой трясогузкой и другими видами подрода Motacilla [Voelker, 2002;

Alstrm et al., 2003;

Pavlova et al., 2005].

По нашим данным для участка контрольного района мтДНК число замен у макси мально дивергировавших гаплотипов из аллопатрических участков ареалов обсуж даемых форм, составило 3 нуклеотида на фрагмент в 610 п.о. (0.5 %).

Для аллопатрических частей ареала M. alba s. s. характерны несколько гап лотипов («северная ветвь»), но доминирует один [Pavlova et al., 2005;

наши данные] (вкладка рис. 4). В аллопатрии у M. (a.) personata также численно превалирует один гаплотип, характерный только для южных частей ареала и встречаются несколько вариантов гаплотипов с признаками предкового полиморфизма («южная ветвь»), сочетающие черты «южных» и «северных». Один из восьми гаплотипов от маски рованной трясогузки из аллопатрии (Киргизия) был полностью тождественен «се верному». Среди M. (a.) personata из сибирской зоны контакта (от южной Тувы до устья Подкаменной Тунгуски) ни мы (n=10), ни предыдущие исследователи (n=15) [Pavlova et al., 2005] не обнаружили ни одного «южного» гаплотипа, как и среди M. a. dukhunensis и M. a. baicalensis в симпатрических (вкладка рис. 4) и аллопат рических частях ареала [Voelker, 2002;

Alstrm, 2002, 2003;

Pavlova et al., 2005;

си квенсы из GenBank];

все особи имели гаплотипы «северной группы» (как и у дру гих M. alba s. s.). Этот результат не удивителен, принимая во внимание тот факт, что ареал маскированной трясогузки в Сибири окружен гибридными зонами. По всей видимости, в результате потока генов из этих зон, автохтонный «южный» ми тохондриальный гаплотип маскированной трясогузки был вытеснен «северным», т.е. маскированная трясогузка заимствовала мтДНК у белой за счет гибридизации.

Сходная картина генетической изменчивости с однонаправленным заимствованием митохондриального генома из гибридных зон известна для ряда видов позвоноч ных животных [Wirtz, 1999;

Rohwer et al., 2001;

Deffontaine et al., 2005;

Irwin et al., 2009].

Принимая скорость фиксации мутаций в мтДНК у птиц как 2 % за 1 млн. лет (это очень приблизительная оценка, т.к. скорость замен может различаться в разы между различными митохондриальными генами) [Price, 2008;

Weir, Schluter, по Рубцов, 2009], можно получить оценку расхождения между маскированной и белой трясогузками, примерно в 250 тысяч лет. Это соответствует периоду Плей стоценовых оледенений, что согласуется с гипотезой, предполагающей, что фор мирование современных северопалеарктических полувидов происходило в ледни ковых рефугиумах в течение Плейстоцена [Voelker, 2002]. Еще раз подчеркнем, что эта оценка весьма условна, но она дает представление о порядке цифр, даже если истинное время дивергенции отлично в несколько раз. Между тем, по некоторым данным, у птиц, время необходимое для достижения устойчивой репродуктивной изоляции, составляет порядка 1-6 млн. лет [Weir, 2007;

Price, 2008], что явно суще ственно больше, чем в случае с трясогузками.

Присутствие «северного» гаплотипа в аллопатрических частях ареала маски рованной трясогузки согласуется с предположением о наличии интрогрессии. Од нако, на настоящий момент нельзя исключать, что обнаруженный гаплотип может быть проявлением предкового полиморфизма. Следует оговориться, что наши ре зультаты по изменчивости молекулярных маркеров носят предварительный харак тер. Поскольку нами был взят участок D-петли контрольного района мтДНК, пред ставляющий собой самую изменчивую часть митохондриального генома [Лукашов, 2009], мы не можем утверждать, что анализ других участков митохондриального генома подтвердит полученные результаты (хотя некоторые данные о согласован ности с другими участками есть в литературе [Pavlova et al., 2005]). Кроме того, из вестно, что топологии дендрограмм на основе митохондриальных и ядерных генов у трясогузок различаются [Alstrm et al., 2003]. Все это заставляет с осторожностью относиться к трактовке полученных данных. Одним из возможных путей проясне ния ситуации может быть проведение анализа других участков мтДНК и ядерных генов, локализованных в половых хромосомах.

ГЛАВА IV. ОБЗОР ВОЗМОЖНЫХ МЕХАНИЗМОВ РЕПРОДУКТИВНОЙ ИЗОЛЯЦИИ 4.1. Биотопические предпочтения Ярко выраженные различия в биотопических предпочтениях между обсуж даемыми формами отсутствуют. Все они в гнездовой период занимают сходные местообитания: поймы рек, берега водоемов и селитебный ландшафт. Большая пластичность трясогузок в выборе мест для постройки гнезда определяет широкий спектр подходящих биотопов и сама по себе создает предпосылки для симбиото пии. Однако на Алтае, в Казахстане, Туве и Западном Саяне маскированная трясо гузка отдает большее предпочтение горным и предгорным районам, в то время как в тайге и открытых ландшафтах она гнездится лишь в постройках человека. Белая трясогузка, наоборот, горных районов избегает, при этом зачастую гнездится в тай ге по берегам рек вдали от населенных пунктов [Сушкин, 1938;

Дементьев, 1954;

Гынгазов и др., 1977;

Кучин, 1982;

Нейфельдт, 1986;

Семенов и др., 2010]. Хотя определенные различия в биотопических предпочтениях существуют, однако они вряд ли способны приводить к существенной биотопической сегрегации в силу тя готения обсуждаемых форм к антропогенным ландшафтам.

4.2. Демонстрационное поведение и вокализация Наши исследования демонстрационного поведения трясогузок находятся на ранних этапах, систематический сбор материала был начат в 2009 г. Однако, мы считаем необходимым изложить полученные результаты по причине значимости данного аспекта в проблеме гибридизации [Панов, 1989]. Наши материалы по мо торике сигнального поведения свидетельствуют о значительном сходстве элемен тарных двигательных актов (ЭДА) у маскированной трясогузки с таковыми у дру гих членов комплекса M. alba s. l. [Дементьев, 1954;

Долгушин и др., 1970;

Панов, 1973;

Glutz von Blotzheim, 1985 Cramp, 1988]. Мы не обнаружили отличий между известными брачными демонстрациями самцов [Панов, 1973;

Glutz von Blotzheim, 1985;

Cramp, 1988]. По ЭДА используемых в территориальных демонстрациях мас кированная трясогузка, по-видимому, неотличима от других форм комплекса бе лых трясогузок (кроме M. a. ocularis) [Панов, 1973;

Glutz von Blotzheim, 1985;

Cramp, 1988]. Прекопулятивные демонстрации самок M. (a.) personata и M. a. alba, по-видимому, тождественны, однако отличия есть между M. (a.) personata и M. a. alba с одной стороны и M. a. leucopsis и M. (a.) lugens с другой [Панов, 1973;

Glutz von Blotzheim, 1985;

Cramp, 1988]. У обсуждаемых форм есть характерные черты в вокализации [Alstrm, 2003], вероятно, отличия более резки между M. (a.) personata и M. a. dukhunensis, чем между M. (a.) personata и M. a. baicalensis.

Следует отметить, что в роде Motacilla многие формы имеют слабую степень ди вергенции по акустическим сигналам, в отличие от окраски брачного оперения [Al strm. 2002]. Слабая изученность поведения и вокализации трясогузок не позволяет сделать окончательные выводы о значимости перечисленных факторов для ограни чения уровня гибридизации. На данный момент мы не обнаружили эффективных барьеров как в случае территориального, так и брачного демонстрационного пове дения, подтверждением чему служат размножающиеся пары самого различного со става. Следует, однако, учитывать, что на ранних этапах дивергенции демонстра ционного поведения, различия могут заключаться не в самих ЭДА, но в частоте и комбинаторике их использования [Панов, 1978]. К сожалению, мы не располагаем необходимым материалом для того, чтобы проверить, есть ли такие отличия в дан ном случае.

4.3. Состав пар и успешность размножения в Южной Туве По нашим наблюдениям, у трясогузок плодовиты гибриды обоего пола. Нормаль ное потомство имеют пары, включающие гибридную и фенотипически чистую особь, а также пары гибрид/гибрид. Статистические различия в успешности вылу пления у гомоспецифических и смешанных пар (в т.ч., включающих гибридов) от сутствуют (n=10, p0.1). Следует учесть, что наши сведения получены из области скопления гибридов. Мы не можем отрицать возможности пониженного репродук тивного успеха у гибридов вне зоны симпатии. По результатам сравнения наблю даемого и теоретически ожидаемого числа пар в Туве, мы отметили достоверную тенденцию к гомономному скрещиванию у птиц с преобладанием фенотипа M. (a.) personata (I-II) и M. alba (V-VI) (табл. 2).

Таблица 2. Соотношение наблюдаемого и теоретически ожидаемого (в скобках) числа пар на двух участках гибридных зон. Жирным шрифтом выделено значение, свидетельствующие о достоверном различии.

Тува n=39 Ср. Енисей n= I-II III-IV V-VI I-II III-IV V-VI =8. =22. I-II 20 (17) I-II 28 (24) df= df= III-IV 9 (7) 1 (1) III-IV 2 (2) 0 (1) p0. p0. V-VI 2 (11) 0 (2) 7 (2) V-VI 9 (15) 1 (1) 5 (2) Обращает внимание существенное различие (в 5.5 раз) между теоретически ожи даемыми и наблюдаемыми частотами смешанных пар состоящих из разных роди тельских форм (табл. 2, V-VI*I-II). На среднем Енисее, как можно было ожидать, исходя из фенотипического состава, мы не обнаружили ассортативности скрещи вания, хотя слабая тенденция (не подтвержденная статистически) все же существу ет. Кроме того, можно заметить неожиданно малое число особей III и IV ф.к., в сравнении с данными по фенотипическому составу (вкладка рис. 2). Это связано с тем, что учеты на среднем Енисее были произведены в 2006 году, на начальных этапах нашей работы, и, к сожалению, без использования оптических приборов.

Как выяснилось позднее, с расстояния, даже особи со значительным развитием промежуточных признаков зачастую воспринимаются как более близкие к феноти пически чистым. Поэтому, наши результаты по составу пар на среднем Енисее сле дует рассматривать, как предварительные.

4.4. Сроки образования пар По нескольким признакам мы можем судить, что в южной Туве самцы белой и маскированной трясогузок приходят в состояние половой активности в разные, хотя и сильно перекрывающиеся сроки. На наш взгляд, это связано с более ранним прилетом самцов маскированной трясогузки на места гнездования, поскольку зи мовки этой формы менее удалены [Дементьев и др., 1954]. В последней декаде ап реля семенники M. (a.) personata достоверно крупнее, чем у M. alba s. s. (p=0.04) [Семенов и др. 2010]. В это время большинство самцов M. alba s. s. еще находятся в стаях, они редко поют, не проявляют признаков антагонизма по отношению друг к другу. В те же сроки большинство самцов M. (a.) personata уже занимают гнездо вые участки и начинают маркировать их. Безусловно, наших данных недостаточно для того, чтобы делать уверенные выводы, однако мы отметили тенденцию (не подкрепляющуюся статистически) к более раннему размножению пар, состоящих из маскированных трясогузок в южной Туве [Семенов и др. 2010]. На наш взгляд, некоторый хиатус в сроках гнездования пар различного фенотипического состава отражает различия в сроках прихода самцов в половую активность. Таким образом, сроки образования пар перекрываются широко, но не полностью, что может слу жить одним из механизмов, поддерживающих некоторый уровень изоляции. Время прибытия трясогузок в таежные местообитания определяется наличием доступных кормовых ресурсов, которые здесь появляются позднее, чем в Туве. Видимо, при лет белой и маскированной трясогузок в северные части области совместного оби тания сильнее, чем в Туве синхронизирован климатическими условиями, что опре деляет большее перекрытие в сроках образования пар [Семенов и др., 2010]. Суще ствующая тенденция к образованию гомоспецифических пар, отчасти или полно стью может быть следствием частичного несовпадения периода образования пар за счет различий в сроках фенологических явлений. Хотя мы не обнаружили отличий в рассмотренных элементах брачного демонстрационного поведения, определен ный уровень этологической изоляции может достигаться за счет резких различий в брачном оперении обсуждаемых форм. Возможно, некоторый уровень изоляции, наблюдаемый в Туве, поддерживается за счет суммарного действия нескольких экологических и этологических факторов, хотя по отдельности, каждый из них мо жет вносить несущественный вклад. Причина бльшей доли смешанных пар и гиб ридов на среднем Енисее может также заключаться в том, что маскированная тря согузка здесь находит северный предел распространения, и как следствие испыты вает недостаток конспецифических партнеров [Панов, 1989].

ГЛАВА V. ОТНОШЕНИЯ ВНУТРИ КОМПЛЕКСА M. ALBA SENSU LATO:

ТАКСОНОМИЧЕСКИЙ И ЭВОЛЮЦИОННЫЙ АСПЕКТЫ В главе V обсуждаются взаимоотношения между известными формами ком плекса белых трясогузок в пределах мировых ареалов на основании материалов по морфологии, экологии, этологии и генетики. Молекулярные [Voelker, 2002] и па леонтологические [Jnossy, 1995] данные позволяют предполагать, что в истории подрода Motacilla, возникшего в Восточной Палеарктике в позднем Миоцене – раннем Плиоцене (7-4.5 млн. л. н.) было несколько предковых расселений с после дующими событиями изоляции и новыми реколонизациями. Предположительно, становление современных полувидов происходило во время изоляции предковых популяций в ледниковых рефугиумах, занимавших удаленные друг от друга части Евразии. Молекулярные датировки, в данном случае, хорошо согласуются с палео нтологическими, позволяя утверждать, что «южная» ветвь (alboides, personata, leu copsis и lugens) в позднем Плейстоцене на протяжении нескольких сотен тысяч лет была изолирована от «северной» ветви (alba, yarrellii, ocularis, baicalensis) [Voelker, 2002;

Pavlova et al., 2005]. Безусловно, за указанный период изоляции, эти группы форм не могли достигнуть уровня дивергенции, необходимого для устойчивой ре продуктивной изоляции, что в итоге выражается в гибридизации различного уров ня в зонах вторичного контакта. Некоторая изоляция между отдельными расами достигается, в-основном, за счет действия экологических механизмов;

определен ную роль, безусловно, играет склонность к гомономному скрещиванию. Перечис ленные аргументы наводят на мысль, что представителей M. alba s.l. правильнее всего рассматривать как членов одного вида. Однако, ряд форм обладают некото рым уровнем репродуктивной обособленности, поэтому номенклатурно приравни вать их к расам, связанным зонами первичной интерградации вряд ли оправдано.

Оптимальным вариантом может быть присвоение всем формам тринарного латин ского названия, с обозначением круглыми скобками популяций уровня полувидов.

С учетом всех обсуждаемых в главе V замечаний, комплекс белых трясогузок мож но представить следующим образом: Motacilla alba alba, M. a. yarrellii, M. a. sub personata, M. a. baicalensis, M. (a.) alboides, M. (a). personata, M. (a.) leucopsis, M. (a.) lugens. В отношении ocularis необходимы дополнительные исследования. В данной главе также приводятся аргументы в пользу точки зрения о необходимости таксономического включения популяций dukhunensis в состав подвида M. a. alba.

ЗАКЛЮЧЕНИЕ В разделе кратко подведены итоги исследования. Автор акцентирует внима ние на том, что для прояснения ряда вопросов, касающихся изолирующих меха низмов у обсуждаемой пары форм, необходим дополнительный сбор материала.

ВЫВОДЫ:

1. Наиболее значимым для анализа фенотипическим маркром гибридного происхождения особи служит рисунок оперения по бокам головы и шеи. Между белой и маскированной трясогузкой существует ряд переходов по этому признаку.

2. Ареал маскированной трясогузки на юге Сибири со всех сторон окружен ареалом белой трясогузки. Пространственные отношения между ними можно оп ределить как парапатрию при регулярных залетах соседствующих форм.

3. Уровень гибридизации на юге Сибири варьирует по доле фенотипических гибридов в различных зонах от 55.5 до 85.6 %. Несмотря на значительный уровень гибридизации, большинство особей сохраняет облик с преобладанием черт той или иной родительской формы. Существует достоверная тенденция к меньшему уров ню гибридизации в Тувинском участке гибридной зоны. Данные по изменчивости пластических признаков подтверждают предположение о значительном уровне ге нетического обмена в зоне симпатрии.

4. Аллопатрические популяции маскированной трясогузки имеют собствен ные митохондриальные гаплотипы, в то время как в гибридной зоне они замещены гаплотипами белой трясогузки, что подкрепляет точку зрения о значительном раз махе гибридизации и более высоком уровне интрогрессии в ареал M. (a.) personata.

5. Мы не обнаружили пониженной плодовитости у гибридов. У родитель ских форм в зоне гибридизации существует достоверная тенденция к ассортатив ному образованию пар. Мы предполагаем, что гибридизация ограничена, в первую очередь, действием экологических факторов, таких как частичное несовпадение сроков образования пар.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Савченко, А.П. Весенняя миграция птиц на территории юга Центральной Сибири и угроза распространения гриппа птиц (H5N1) / А.П. Савченко, В.И.

Емельянов, А.В. Беляков, Н.В. Карпова, И.А. Савченко, А.Н. Радченко, В.В.

Палунина, А.В. Кутянина, Г.А. Семенов // Вестник КГУ. – 2006. – № 5/1. – С.

19–28.

2. Семенов, Г.А. Влияние гибридизации на окрасочные и размерные показате ли белой трясогузки (Motacilla alba dukhunensis) и маскированной трясогуз ки (M. personata) / Г.А. Семенов // Материалы IV Международной орнитоло гической конференции «Современные проблемы орнитологии Сибири и Центральной Азии». – Улан-Удэ: Издательство БГУ. – 2009. – С. 192–194.

3. Семенов, Г.А. Гибридизация белой Motacilla alba Linnaeus, 1758 и маскиро ванной M. (a.) personata Gould, 1861 трясогузок на юге Сибири / Г.А. Семе нов, А.К. Юрлов, Д.Р. Хайдаров // Сибирский экологический журнал. – 2010.

– Т. XVII, № 5. – С. 788–799.

4. Семенов, Г.А. О характере взаимоотношений между маскированной и белой трясогузками на юге Сибири / Г.А. Семенов, А.К. Юрлов // Орнитология. – 2010а. – Вып. 36. – С. 7–21.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.