авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Механизмы антипролиферативного действия ингибиторов деацетилаз гистонов на эмбриональные стволовые клетки мыши

На правах рукописи

ЧУЙКИН Илья Александрович МЕХАНИЗМЫ АНТИПРОЛИФЕРАТИВНОГО ДЕЙСТВИЯ ИНГИБИТОРОВ ДЕАЦЕТИЛАЗ ГИСТОНОВ НА ЭМБРИОНАЛЬНЫЕ СТВОЛОВЫЕ КЛЕТКИ МЫШИ 03.00.25 – гистология, цитология, клеточная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Санкт-Петербург 2006

Работа выполнена в Институте цитологии РАН, Санкт-Петербург

Научный консультант: доктор биологических наук, профессор Поспелов Валерий Анатольевич Институт цитологии РАН, Санкт-Петербург

Официальные оппоненты: доктор биологических наук, профессор Пинаев Георгий Петрович Институт цитологии РАН, Санкт-Петербург доктор биологических наук, профессор Дондуа Арчил Карпезович Санкт-Петербургский Государственный университет

Ведущая организация: ГУ НИИ Институт экспериментальной медицины РАМН, Санкт-Петербург

Защита состоится «27» октября 2006 года в 13 час на заседании Диссертационного совета Д. 002.230.01 при Институте цитологии РАН по адресу: 194064, Санкт Петербург, Тихорецкий пр., д. 4.

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН

Автореферат разослан 26 сентября 2006 г.

Ученый секретарь диссертационного совета кандидат биологических наук Е.В. Каминская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы.

В настоящее время, изучение механизмов пролиферации эмбриональных стволовых клеток представляет важное направление клеточной и молекулярной биологии.

Эмбриональные стволовые клетки мыши (мЭСК) являются ценным объектом для изучения процессов раннего эмбрионального развития благодаря своей доступности и относительной простоте культивирования. Сохранение плюрипотентности в течение многих пассажей позволяет создавать химерные особи мышей и благодаря этому изучать функции генов in vivo. Способность к дифференцировке в различные типы клеток in vitro делает эмбриональные стволовые клетки перспективным объектом для разработки подходов направленной дифференцировки и их будущего использования в качестве материала для терапии поврежденных тканей (Brook, Gardner, 1997;

Smith, 2001). Для создания и применения таких методов необходимо детально исследовать механизмы, обеспечивающие сохранение недифференцированного состояния эмбриональных стволовых клеток. Ряд морфологических и молекулярных признаков сближает недифференцированные мЭСК с трансформированными клетками. Можно отметить следующие признаки: высокий пролиферативный потенциал мЭСК и независимость пролиферации от экзогенных ростовых факторов (Schratt et al., 2001). Отличительной особенностью мЭСК является также их неспособность к длительной блокам G1/S или G2/M клеточного цикла при действии ДНК-повреждающих агентов и стресс-факторов, что говорит об отсутствии полноценных сверочных точек клеточного цикла (Малашичева и др., 2002). По-видимому, как в опухолевых клетках, так и в мЭСК постоянно функционируют эндогенные митогенные сигналы, которые стимулируют продвижение мЭСК по клеточному циклу.

Активность деацетилаз гистонов (HDAC) может быть связана как с поддержанием автономной пролиферации, так и трансформированного фенотипа, поскольку репрессия некоторых негативных регуляторов пролиферации и индукторов дифференцировки происходит с участием этих ферментов (Dokmanovic, Marks, 2005). Есть данные, позволяющие предполагать, что активность HDAC необходима для пролиферации ранних эмбриональных клеток. Изучение эмбрионов мышей, нокаутных по HDAC1, показало снижение числа клеток внутренней клеточной массы и раннюю летальность зародышей.

Кроме того, мЭСК, полученные из таких эмбрионов, имеют более низкую скорость прироста популяции (Lagger et al., 2002). Есть данные, показывающие, что активность HDAC необходима для дифференцировки мЭСК (Lee et al., 2004). В настоящее время, ингибиторы HDAC рассматриваются как перспективные противоопухолевые агенты и активно используются в научных исследованиях. В зависимости от тканевой принадлежности и функционального состояния, различные клетки обладают разной чувствительностью к ингибиторам HDAC, реализуя как длительные блоки клеточного цикла с признаками дифференцировки и клеточного старения, так и кратковременные остановки с последующим запуском программы апоптоза. Изучение эффекта ингибиторов HDAC на мЭСК является актуальной и интересной задачей, поскольку это позволит получить информацию об особенностях системы регуляции клеточного цикла в этих клетках.

Механизмы автономной пролиферации мЭСК пока изучены недостаточно, в частности, нет четких данных о сигнальных путях, вовлеченных в этот процесс. Недавно было показано, что активация Wnt/-катенинового пути способствует поддержанию плюрипотентного состояния мЭСК даже в отсутствии фактора LIF (Sato et al., 2004). Как известно, -катенин выполняет в клетке разнообразные функции в разных компартментах:

вместе с Е-кадгерином он участвует в образовании межклеточных контактов, в составе комплексов с транскрипционными факторами семейства LEF/TCF -катенин функционирует в качестве ко-активатора транскрипции генов в ядре, а в составе цитоплазматических комплексов с белками CKI, GSK3, APC и аксином -катенин фосфорилируется для последующей протеасомной деградации (Bienz, 2004). Поскольку катенин-зависимая транскрипция, отмечается в быстроделящихся клетках предшественниках тканей (He et al., 2004;



Reya et al., 2003) и в различных типах опухолевых клеток (Fukuchi et al., 1998;

Sparks et al., 1998;

Koch et al., 1999), а экспрессия Е-кадгерина может модулироваться на уровне структуры хроматина (Peinado et al., 2004), большое интерес представляет исследовать внутриклеточную локализацию -катенина в недифференцированных быстроделящихся мЭСК и при их дифференцировке. Учитывая, что сигнальная функция -катенина важна в ходе гаструляции при реализации эпителиально-мезенхимального перехода (Kemler et al., 2004), важно выяснить, как меняется экспрессия генов, характерных для эпителиальных и мезенхимных клеток при дифференцировке мЭСК.

Цели и задачи исследования.

Целями данного исследования являлось:

1. Изучение зависимых от структуры хроматина механизмов регуляции клеточного цикла и пролиферации мЭСК in vitro с использованием ингибиторов гистон деацетилазной активности.

2. Исследование внутриклеточной локализации белков межклеточной адгезии и изменения активности Wnt-сигнального пути при действии ингибиторов HDAC и при дифференцировке мЭСК.

Для реализации этих целей были поставлены следующие задачи:

а) исследовать эффект ингибиторов HDAC на скорость прироста популяции и параметры клеточного цикла недифференцированных мЭСК;

б) оценить уровень экспрессии генов, кодирующих позитивные и негативные регуляторы клеточного цикла, после обработки мЭСК ингибиторами HDAC;

в) исследовать влияние ингибиторов HDAC на жизнеспособность мЭСК и индукцию апоптотической гибели;

г) выяснить, приводит ли обработка ингибиторами HDAC к индукции преждевременного клеточного старения или к дифференцировке клеток;

д) исследовать внутриклеточную локализацию -катенина в недифференцированных мЭСК при обработке ингибиторами HDAC и при активации Wnt-сигнального пути ингибитором киназы GSK3 6-Bromoindirubin-3’-oxime (BIO);

е) исследовать экспрессию генов-маркеров эпителиально-мезенхимального перехода при дифференцировке мЭСК, а также другие признаки этого процесса: особенности организации актинового цитоскелета и внутриклеточную локализацию белков межклеточных контактов -катенина, E-кадгерина и N-кадгерина.

Основные положения, выносимые на защиту.

1. Ингибиторы HDAC подавляют пролиферацию эмбриональных стволовых клеток мыши, вызывают остановку в фазе G1/S или G2/M клеточного цикла и последующую апоптотическую гибель.

2. Эмбриональные стволовые клетки мыши не способны реализовать долговременные блоки клеточного цикла при действии ингибиторов HDAC, которые сопровождались бы признаками ускоренного старения или дифференцировки.

3. Для быстроделящихся эмбриональных стволовых клеток мыши не характерна ядерная локализация -катенина.

4. Дифференцировка мЭСК, индуцированная ретиноевой кислотой (RA), сопровождается активацией Wnt-сигнального пути и индукцией эпителиально мезенхимального перехода.

Научная новизна работы.

Впервые показано, что ингибиторы деацетилаз гистонов (HDAC) оказывают негативное влияние на пролиферацию мЭСК, вызывают блок клеточного цикла и снижают транскрипцию позитивных регуляторов клеточного цикла, таких как циклин D1 и циклин А, фосфатаза cdc25A, c-myc, и e2f1 и индуцируют транскрипцию негативных регуляторов клеточного цикла p21waf1 и p57kip2. Показано, что остановка клеточного цикла мЭСК, вызванная ингибиторами HDAC, не сопровождается признаками ускоренного клеточного старения и дифференцировки, но приводит к массовой апоптотической гибели. Несмотря на сходство мЭСК с трансформированными клетками (опухолей), многие из которых демонстрируют дерегуляцию Wnt-сигнального пути, для быстроделящихся недифференцированных мЭСК не характерна внутриядерная локализация -катенина, который имеет в этих клетках исключительно мембранную локализацию Напротив, при дифференцировке мЭСК ретиноевой кислотой наблюдается релокализация -катенина в ядро, индукция экспрессии генов-маркеров эпителиально-мезенхимального перехода и замена Е-кадгерина на мембране на N-кадгерин.

Теоретическое и практическое значение работы Результаты данной работы могут быть использованы для дальнейшего углубленного изучения механизмов регуляции клеточного цикла ранних эмбриональных клеток;

дают важную информацию о сигнальных процессах, необходимых для самообновления мЭСК.

Данные работы могут быть использованы при исследовании процессов, происходящих при дифференцировке мЭСК. Кроме этого, результаты работы служат иллюстративным практическим материалом в учебном спецкурсе по регуляции клеточного цикла и биологии опухолевых и стволовых клеток, читаемом на кафедре биохимии биолого почвенного факультета СПбГУ.

Апробация работы По теме диссертации опубликовано 4 статьи. Основные положения доложены и обсуждены на Всероссийских симпозиумах «Биология клетки в культуре» (Санкт Петербург, 2003, 2004), на международной студенческой конференции (Берлин, Германия, 2003), на 3-й международной конференции международного общества по изучению стволовых клеток (Сан-Франциско, США, 2005), на Всероссийской конференции «Биология стволовых клеток: фундаментальные аспекты» (Москва, 2005).

Финансовая поддержка работы Работа была поддержана грантами РФФИ (06-04-49058), CRDF (RB1-2511-ST-03) и Программой РАН «Молекулярная и клеточная биология», Научная школа (Госконтракт:

02.445.11.7337), Договор НОЦ РИ-16.0/0010-3. Работа была выполнена с использованием оборудования ЦКП «Материаловедение и диагностика в передовых технологиях».

Объем и структура диссертации Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, изложения экспериментальных данных, обсуждения результатов, заключения, выводов, списка цитируемой литературы и списка сокращений. Работа изложена на 139 страницах машинописного текста и иллюстрирована 1 таблицей, рисунками и 5 схемами.

МАТЕРИАЛ И МЕТОДИКА К у л ь т и в и р о в а н и е клеток. мЭСК линии IOUD2 были любезно предоставлены P.

Savatier (Лаборатория клеточной и молекулярной биологии, Лион, Франция). Клетки культивировали в 7.5 % СO2 при 37 С на пластиковых чашках Петри (Corning, США), покрытых 0.2 % раствором желатина (Sigma, США) в среде DMEM (Gibco BRL, США), содержащей 40 мкг/мл гентамицина, 10 % сыворотки (PAA, Австрия), 25 ед/мл фактора LIF (Sigma, США). Клетки тератокарциномы мыши линии F9, полученные из Банка клеточных культур Института цитологии РАН, культивировали в среде DMEM (ICN, США) с добавлением 10 % эмбриональной сыворотки и 40 мкг/мл гентамицина на пластиковых чашках Петри (Sarstedt, Германия), покрытых 0.2 % раствором желатина (Sigma). Дифференцировку индуцировали, рассевая клетки в среде, не содержащей фактора LIF, через 1 сут культивирования добавляли 1 мкМ ретиноевой кислоты (All-trans retinoic acid, Sigma, США), еще через 7 сут добавляли 100 мкМ дибутирил-цАМФ (Sigma, США) и культивировали еще 2 сут, или культивировали 9 сут только в присутствии ретиноевой кислоты (Strickland, 1981). Для позитивного контроля на активность маркера старения SА-Gal клетки дифференцировали в присутствии 1 мкМ ретиноевой кислоты сначала в суспензии 5 сут, затем в адгезионной культуре в течение 3-х недель. В качестве ингибиторов деацетилаз гистонов (HDAC) использовали: трихостатин А (TSA) и бутират натрия (NaBut), обладающих различной структурой и подавляющих активность ферментов HDAC первого класса (Sigma, США). TSA использовался в большинстве экспериментов, так как этот агент ингибирует ферменты HDAC c большей специфичностью по сравнению с NaBut, действуя в наномолярных концентрациях. В качестве ингибитора киназы GSK3 в среду добавляли BIO (6-Bromoindirubin-3’-oxime, Calbiochem, США) в концентрации мкМ, как рекомендовано другими авторами (Sato et al., 2004).

Для изучения д и н а м и к и р о с т а популяции клетки сеяли по 2х105 клеток на чашку ( мм), через 1 сут добавляли ингибиторы HDAC и проводили подсчет клеток каждые 2 сут.

О ц е н к у ж и з н е с п о с о б н о с т и п о п у л я ц и и проводили с помощью окраски метилтиазолилдифенил-тетразолиум бромидом (МТТ) (Sigma, США). Метод основан на том, что дегидрогеназы митохондрий восстанавливают желтый МТТ до пурпурного формазана. Реакция происходит только в живых клетках с активными митохондриальными ферментами. Для MTT-теста клетки рассевали на 96-луночную плату, через 1 сут меняли среду и добавляли ингибиторы HDAC. Через 24 или 48 ч в каждую лунку добавляли 0. мг/мл МТТ в PBS, инкубировали 1 ч при 37 С в атмосфере 7.5 % CO2. Образовавшийся формазан экстрагировали в 0.04 М HСl на изопропаноле. Оптическую плотность измеряли спектрофотометрически при длине волны 570 нм против раствора МТТ в 0.04 М HCl на изопропаноле. За 100 % на калибровочной кривой принимали оптическую плотность клеток, не обработанных ингибиторами HDAC.

Р а с п р е д е л е н и е к л е т о к п о ф а з а м к л е т о ч н о г о ц и к л а изучали с помощью однопараметрического анализа методом проточной цитофлуориметрии (Розанов, 1987).

Клетки промывали раствором PBS, снимали с чашек раствором PBS, содержащим 0.03 % эмбриональной сыворотки, пермеабилизовали в растворе 0.01 % сапонина 30 мин при 20 С, затем добавляли РНКазу А (100 мкг/мл), иодид пропидия (40 мкг/мл), инкубировали 15 мин при 37 С и анализировали на проточном цитофлуориметре ATC300 (Brucker, Франция). Полученные результаты обрабатывали с помощью программы Modfit.





Оценку активности каспаз in vitro проводили с использованием флуорогенного субстрата AcDEVD-AMC (Sigma, США). Клетки лизировали в буфере, содержащем 50 мМ HEPES (ICN, США) pH 7.4, 0.1 % CHAPS (Sigma, США), 0.5 % IGEPAL-100 (ICN, США), 5 мМ DTT (Sigma, США) 30 мин при 4 С. Затем лизат центрифугировали 20 мин при 14000 g, отбирали супернатант и брали по 40 мкг белка на реакцию. Пробы собирали в луночной плате, реакционная смесь состояла из лизата, реакционного буфера (40 мМ HEPES pH 7.4, 0.1 % CHAPS, 1 мМ DTT), 40 мкМ субстрата AcDEVD-AMC. Для подтверждения специфической активации каспаз применялся ингибитор каспаз ZVAD в концентрации 50 мкМ. Реакцию проводили 1 ч при 37 С. Флюоресценцию измеряли при длине волны 460 нм, используя энергию возбуждающего излучения при длине волны нм. Из полученных значений флюоресценции вычитали флюоресценцию пустого раствора AcDEVD-AMC в реакционном буфере. В эксперименте проводили измерение 3-х независимых проб и делали подсчет стандартного отклонения от среднего значения.

Измерения проведены с использованием флюориметра (Туроверов и др., 1998) в лаборатории структурной динамики, стабильности и фолдинга белков Института цитологии РАН.

В ы я в л е н и е а к т и в н о с т и S A G a l проводили под световым микроскопом. Клетки фиксировали в 4 % формалине и окрашивали в буфере, содержащем Х-Gal рН 6.0 (Dimri et al., 1995) при 37 С в течение 1 сут.

Иммунофлюоресценция. Клетки промывали раствором PBS, фиксировали в 4 % формальдегидом 10 мин, обрабатывали 0.5 % раствором Triton-X-100 на PBS 20 мин, затем добавляли раствор, блокирующий неспецифическое связывание, 5 % бычий сывороточный альбумин (БСА) на PBS. Далее клетки инкубировали при 20 С 1 ч с моноклональными антителами мыши к -катенину (Santa Cruz, sc-7963), E-кадгерину (Transduction Laboratories, 610182), N-кадгерину (Transduction Laboratories, 610921) в разведении 1:300, а затем при 20 С 1 ч с антителами против иммуноглобулинов мыши, конъюгированными с флюорохромами GAM-TRITC (Santa Cruz, sc-3796) или GAM Alexa488 (Molecular Probes). Первые и вторые антитела разводили в растворе PBS, содержащем 5 % БСА и 0.05 % Tween-20. Окраску ядер проводили с помощью ДНК связывающего красителя Topro-3 (Molecular Probes), а окраску актина с помощью родамин-фаллоидина (Molecular Probes). Анализ изображений проводили на конфокальном микроскопе (Leica, Германия).

Для выявления олигонуклеосомной фрагментации проводили выделение экстрахромосомной ДНК. Собирали все (плавающие + прикрепленные) или отдельно плавающие и прикрепленные клетки, промывали PBS, лизировали 20 мин при 4 С в буфере, содержащем 5 мМ Трис-HCl, 0.5 % Тритона Х-100 и 100 мМ ЭДТА рН 8.0. Лизат центрифугировали 20 мин при 14000 g. Супернатант отбирали в отдельные пробирки, в которые добавляли NaCl и РНКазу А (конечная концентрация 0.15 М и 100 мкг/мл соответственно), а затем инкубировали 1 ч при 37 С. В пробы добавляли SDS и протеиназу К (конечная концентрация 0.5 % и 200 мкг/мл соответственно), инкубировали ч при 37 С. Депротеинизацию проводили смесью фенола с хлороформом. Затем проводили переосаждение и промывку ДНК. ДНК растворяли в буфере TE и проводили вертикальный электрофорез в 2 % агарозном геле. Гель окрашивали бромистым этидием и фотографировали.

Для исследования содержания белков Oct-4, циклина D1, циклина A, p27Кip1, p21Waf методом в е с т е р н - б л о т т и н г а клеточные экстракты получали путем лизиса клеток в буфере PBS, содержащем 1 % NP-40, 0.5 % дезоксихолата натрия, 0.1 % SDS, ингибиторы протеаз (1 мМ PMSF, по 10 мкг/мл пепстатина А, леупептина и апротинина), ингибиторы фосфатаз (1 мМ ортованадата натрия, 5 мМ EGTA, 10 мМ NaF) с последующим центрифугированием. Количество белка в пробах измеряли по методу Брэдфорд (Bradford, 1976) и уравнивали пробы для электрофореза между собой по количеству белка. После диск-электрофореза в ПААГ в денатурирующих условиях белки из геля переносили на нитроцеллюлозную мембрану (Amersham, Великобритания). В качестве первых использовали антитела к Oct-4 (sc-5279), p27kip1 (sc-1641), циклину D1 (sc 717), циклину A (sc-751) (Santa Cruz), p21Waf1 (Ab-3, Calbiochem). В качестве вторых антител использовали козьи антитела против иммуноглобулинов кролика и мыши, коньюгированные с пероксидазой хрена. Белки выявляли методом усиленной хемилюминесценции (ECL, Amersham).

Анализ ДНК-связывающей активности методом ретардации в ПААГ.

Ядерные экстракты получали согласно протоколу Шрайбера с соавторами (Schreiber et al., 1989). Для получения ядерных экстрактов клетки отмывали от среды раствором Версена, 107 клеток суспендировали в 0.4 мл буфера А (10 мМ HEPES, pH 7.9, 0.1 мМ ЭДТА, 10 мМ KCI, 0.1 мМ EGТА, 1 мМ ортованадата натрия, 1 мМ PMSF, 1 мМ DTT и по 10 мкг/мл леупептина и апротинина), инкубировали 15 мин на льду, затем добавляли NP-40 до 0.06 % и инкубировали 3 мин. Далее центрифугировали при 12000g 2 мин, отделяя цитоплазматическую фракцию (супернатант) и ядра. Осадок ядер помещали в буфер Б ( мМ HEPES, pH 7.9, 1 мМ ЭДТА, 0.4 М NaCI, 1 мМ EGTA, 1 мМ ортованадата натрия, мМ PMSF, 1 мМ DTT и по 10 мкг/мл леупептина и апротинина), 15 мин интенсивно встряхивали на шейкере, центрифугировали 30 мин 12000 g при 4 С, экстракты хранили при –70 С. Количество белка в пробах измеряли методом Брэдфорд (Bradford, 1976).

Экстракты ядер инкубировали 30 мин при 20 С в буфере для реакции, содержащем 5 мМ HEPES-КОН pH 7.9, 2.5 мМ DTT, 2.5 мМ ЭДТА, 15 % глицерина, 2.5 мМ DTT, 5 мМ MgCl2. В реакцию добавляли 1 мкг неспецифического конкурента polydI/polydC (Pharmacia) и 2 мкг экстрактов ядер так, чтобы конечная концентрация NaCl была в пределах 75-100 мМ. Объем реакции был 10-20 мкл. Затем добавляли 1 нг меченых [23-Р] АТФ олигонуклеотидов и инкубировали дополнительно 20 мин при 20 С. В качестве меченых олигонуклеотидов использовали последовательности из регуляторных областей гена коллагеназы (Col-AP-1: 5’-AGCATGAGTCAGCC-3’) и c-jun, jun2-TRE (Jun2-AP-1: 5’ AGCTAGCATTACCTCATCCC-3’) (Pospelova et al., 1999). При исследовании специфичности выявляемых комплексов использовали немеченный олигонуклеотид в 10- и 50-кратном избытке (10 и 50 нг соответственно). В качестве неспецифического конкурента использовали сайт связывания SRF из промотора c-fos DSE 5’ CACAGGATGTCCATATTAGGAC-3’. Электрофорез проводили в 5 % ПААГ в буфере TBE, гель фиксировали (10 % этанол 10 % уксусная кислота), сушили и экспонировали с рентгеновской пленкой Kodak X-OMAT K 1-2 сут. Для выяснения белкового состава выявляемых комплексов использовали поликлональные антитела Santa Cruz к с-Fos (sc 52x), c-Jun (sc-45x), ATF-2 (sc-19) (Santa Cruz, США), пробы в буфере для реакции инкубировали 2 ч 4 0С в присутствии антител, затем добавляли меченую пробу на 20 мин 20 С.

Т о т а л ь н у ю к л е т о ч н у ю Р Н К выделяли с помощью Trizol® (Gibco BRL). Реакции обратной транскрипции (ОТ) и амплификации (ПЦР) проводили по протоколу, описанному ранее (Kukushkin et al., 2002). Праймеры для генов oct-4, циклин E, циклин D1, c-myc, cdc25A, p27kip1, p21Waf1 были описаны ранее (Kukushkin et al., 2002;

Абрамова и др., 2003;

Лянгузова и др., 2004). Последовательности использованных праймеров к генам:

p57kip2 - 5’-CCCGGACGCGAACCCGGACG -3’/5’-CGAGAGAGGCTGGTCCTTCA-3’ (расчетная длина продукта 312 п. о.;

циклин A2 - 5’- GCATGAGGGCGATCCTTGTG 3’/5’-ACAGTTTGCAGGCTGCAGGTG -3’ (расчетная длина продукта 355 п. о.);

p16ink4a 5’-CCGAACTCTTTCGGTCGTAC-3’/5’-GGGTCGCAGGTTCTTGGTCA-3’(расчетная длина продукта 280 п. о.);

tcf4 - ;

-катенин - ;

dab2 - ;

E-кадгерин - ;

N-кадгерин - ;

snail - ;

.

Температура отжига приведенных праймеров составляла 58 С. Электрофорез ПЦР продуктов с маркером молекулярного веса ДНК 100 bp-ladder (Gibco BRL) проводили в % агарозном геле на буфере ТВЕ. Денатурирующий электрофорез рибосомных РНК приведен в качестве контроля нагрузки.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 1. Влияние ингибиторов деацетилаз гистонов на скорость прироста популяции и клеточный цикл мЭСК. Высокая скорость роста и деления является характерным признаком недифференцированных эмбриональных стволовых клеток мыши (мЭСК), причем, в отличие от большинства соматических нетрансформированных клеток, скорость деления мЭСК не зависит от присутствия факторов роста сыворотки (Schratt et al., 2001).

Мы предположили, что конститутивная пролиферация и подавление апоптотической программы мЭСК связаны с наличием эпигенетических механизмов регуляции транскрипции. Ацетилирование и деацетилирование гистонов, осуществляемое ферментами ацетилазами и деацетилазами, вносит существенный вклад в регуляцию транскрипции генов, среди которых есть регуляторы клеточного цикла и дифференцировки. На других клеточных системах показано, что ингибиторы деацетилаз гистонов (HDAC) обладают антипролиферативным действием, вызывая как длительные, так и кратковременные остановки клеточного цикла, старение или апоптоз в зависимости от происхождения клеточной линии и от ее функционального статуса (Ogryzko et al., 1996;

Peart et al., 2003;

Dokmanovic, Marks, 2005). Специфический ответ клетки на действие ингибитора HDAC зависит от функциональной настройки системы регуляции клеточного цикла, возможности реализовать длительный блок клеточного цикла. Чтобы оценить эффект ингибиторов HDAC на пролиферацию мЭСК, мы сравнивали динамику роста популяции клеток в контроле и в присутствии различных концентраций трихостатина А (TSA) и бутирата натрия (NaBut). Оказалось, что даже небольшие концентрации ингибиторов оказывают сильный эффект на прирост популяции мЭСК. Количество клеток на 4 сут после рассева (8х106 в контроле) уменьшается более чем в два раза в чашках, обработанных 12.5 нМ TSA и 2.5 мМ NaBut (3.8х106 и 1.76х106 клеток соответственно) (рис.1, а, Чуйкин и др., 2006). Поскольку замедление прохождения по клеточному циклу – один из возможных механизмов антипролиферативного действия ингибиторов HDAC на мЭСК, методом проточной цитометрии исследовали распределение клеток по фазам клеточного цикла. Было установлено, что при действии TSA доля клеток в фазе S снижается с 71 % до 31 %, а доля клеток, находящихся в фазе G2 увеличивается c 9 % до %. Эффект TSA на клетки является обратимым, и после отмывки средой, не содержащей TSA, доля клеток в фазе S возрастает до 50 %, в то время как в фазе G2 остается около 24 % клеток (рис. 1, б).

G0-G1: 20 % G0-G1 : 15 % б а G2-M: 9 % G2-M : 54 % S: 71 % S: 31 % Number Number Число клеток. 0 50 100 150 200 Channels 0 50 100 150 200 Channels TSA 1 сут Контроль G0-G1 : 19 % G0-G1 : 26 % G2-M : 47 % G2-M : 24 % S: 50 % 6 S: 34 % Number Number 0 50 100 150 200 Channels 0 50 100 150 200 2 4 6 Channels TSA 2 сут TSA 1 сут Время, сут отмывка 1 сут Рис. 1. Воздействие ингибиторов HDAC TSA и NaBut приводит к подавлению пролиферации мЭСК;

а - динамика роста популяции в контроле кривая 1, при действии 0.5 или 2.5 мМ NaBut (кривые 2, 4 соответственно) и при действии 12.5 или 25 нМ TSA (кривые 3, 5 соответственно);

б – гистограммы распределения клеток по фазам клеточного цикла в контроле и после обработки 150 нМ TSA;

по оси абсцисс – количество ДНК, усл. ед, по оси ординат – число клеток.

2. Изучение эффекта ингибиторов деацетилаз гистонов на жизнеспособность мЭСК.

Индукция клеточной гибели может быть причиной снижения числа клеток при действии ингибиторов HDAC на мЭСК. Влияние TSA на клеточный цикл мЭСК наблюдается и на сут воздействия (рис. 1, б), кроме того, визуально наблюдается увеличение количества мертвых и открепившихся клеток. Чтобы подтвердить индукцию апоптотической гибели был сделан анализ олигонуклеосомной фрагментации ДНК. Показано, что TSA и NaBut вызывают дозо-зависимое увеличение доли фрагментированной ДНК, причем характерная для апоптотирующих клеток «лесенка» на электрофореграммах отмечается именно в открепленных клетках (рис. 2, а), а это значит, что гибель и открепление клеток происходят практически одновременно. Чтобы оценить долю живых (метаболически активных) клеток был использован MTT-тест, в результате чего показано, что существенное снижение числа метаболически активных клеток происходит после 2 суточного действия TSA, причем эффект прямо зависит от концентрации TSA (рис. 2, б). В первые сутки действия TSA эффект незначителен. Поскольку апоптоз – процесс, происходящий с участием цистеиновых протеаз (каспаз), было проверено изменение активности каспаз после воздействия TSА. Для этого применялся флюоресцентный метод оценки активности каспаз с использованием искусственного субстрата AcDEVD-AMC. На рис. 2, в видно, что активность каспаз увеличивается на 1 и 2 сут обработки TSA. На 2 сут воздействия 150 нМ TSA отмечается увеличение активности каспаз более чем в 5 раз, причем увеличение активности каспаз наблюдалось, когда в опыт брали прикрепленные и открепившиеся клетки. Экстракты для анализа активности каспаз получали из прикрепленных + открепившихся клеток, за исключением дорожки 4. В прикрепленных клетках после 2 сут воздействия TSA активность каспаз практически не отличается от контроля (рис. 2, в, дорожки 1, 4 соответственно). Присутствие в реакции ингибитора каспаз широкого спектра действия, ZVAD в концентрации 50 мкМ, приводило к снижению активности каспаз (рис. 2, в, дорожка 5). Таким образом, можно сделать вывод о том, ингибитор HDAC TSA вызывает блок клеточного цикла и последующую апоптотическую гибель клеток.

3. Влияние ингибитора деацетилаз гистонов на экспрессию позитивных и негативных регуляторов клеточного цикла. Поскольку активность ацетилаз и деацетилаз гистонов в первую очередь связана с регуляцией транскрипции, мы исследовали влияние TSA на уровень экспрессии генов, кодирующих регуляторы клеточного цикла после 1 сут воздействия, временной точке, в которой отмечается подавление пролиферации, но отсутствует массовый апоптоз. На рис. 3, видно, что после воздействия TSA снижается содержание транскриптов для позитивных регуляторов клеточного цикла e2f1, циклина D1, циклина A, с-myc и cdc25A на уровне мРНК. Снижение содержания белка Oct-4, циклина D1 и циклина A показано c помощью вестерн-блоттинга (рис. 4, б). Данные о негативном влиянии ингибиторов HDAC на экспрессию генов e2f1, циклин А, cdc25A могут объясняться тем, что воздействие ингибиторов HDAC может приводить к снижению содержания гиперфосфорилированной формы белка Rb в фибробластах человека, и, следовательно, подавлению активации транскрипционного фактора E2F. Такой эффект ингибиторов HDAC был показан на фибробластах человека (Ogryzko et al., 1996). В наших экспериментах показано, что воздействие TSA приводит к снижению транскрипции e2f1.

Падение транскрипции e2f1 и снижение активности транскрипционных факторов E2F может объяснять подавление транскрипции генов циклина A2, cdc25A (рис. 3), содержащих в промоторах сайты связывания E2F (Araki et al., 2003;

Stevens, La Thangue, 2003).

Транскрипционный фактор c-Myc стимулирует прохождение по клеточному циклу независимо от пути Rb/E2F. Недавние исследования показали, что в мЭСК ген c-myc является мишенью STAT3 и играет важную роль в сохранении плюрипотентности (Cartwright et al., 2005). Согласно нашим данным, TSA вызывает подавление транскрипции гена c-myc (рис. 3, а). Ранее на линии клеток лейкемии CEM-CM3 было показано, что ингибиторы HDAC вызывают увеличение транскрипции негативных регуляторов функции c-Myc, MXI1, Mad, MLX, и кроме того, подавляют транскрипцию самого гена c-myc (Peart et al., 2005).

Известно, что ферменты HDAC оказывают негативное влияние на транскрипцию гена ингибитора циклин-киназных комплексов p21Waf1, и что после воздействия ингибиторов HDAC происходит его экспрессия по р53-независимому механизму (Xiao et al., 1997;

Burgess et al., 2000;

Richon et al., 2001;

Gui et al., 2004). Количество белка p21Waf1 в мЭСК мало, в результате чего не происходит реализации блоков клеточного цикла при действии генотоксических и стресс-факторов (Малашичева и др., 2002). Результаты нашей работы показывают, что TSA вызывает в мЭСК активацию экспрессии гена p21Waf1 на уровне мРНК и белка (рис. 3, а, б). Впервые показано, что воздействие TSA вызывает индукцию транскрипции ингибитора циклин-киназных комплексов p57kip2 (рис 3, а).

Данные RT-PCR и Вестерн-блотинга показывают тенденцию к снижению экспрессии третьего члена семейства ингибиторов циклин-киназных комплексов p27kip1 на уровне мРНК, и белка (рис. 3). Данных о том, что ген p27kip1 является геном, индуцируемом ингибиторами HDAC, как, например, ген p21Waf1, нет. Исследование профиля транскрипции генов после воздействия ингибиторов HDAC на клеточную линию аденокарциномы поджелудочной железы показывает снижение транскрипции p27kip (Moore et al., 2004), что согласуется с нашими данными. Таким образом, способность ингибиторов HDAC вызывать блок клеточного цикла коррелирует с активацией экспрессии p21Waf1 и p57Кip2, но не p27kip1 (рис. 3, Чуйкин и др., 2006;

Лянгузова и др., 2006).

[TSA] [NaBut] TSA NaBut нМ мМ - 1 сут - 2 сут а в б 150 нМ 10 мМ - 25 75 150 5 10 M 100 % 0 25 75 150 200 0 25 75150 -+-+ 1 2 3 [TSA], нМ Рис. 2. Обработка ингибиторами HDAC приводит к апоптотической гибели мЭСК;

а – нуклеосомная фрагментация ДНК в мЭСК через 2 сут действия TSA и NaBut, а также в прикрепленных (-) и открепившихся (+) клетках;

б – MTT-тест через 1 и 2 сут воздействия на мЭСК TSA;

в – анализ активности каспазы 3 в клеточных экстрактах с применением флюоресцентного субстрата AcDEVD-AMC;

по оси ординат – относительные единицы флюоресценции, 1 – Контроль, 2 – 1 сут обработки TSA, 3 – 2 сут обработки TSA, 4 – 2 сут обработки TSA, только прикрепленные клетки, 5 – 2 сут обработки TSA, в реакцию добавлен ингибитор каспаз ZVAD;

TSA использовался в концентрации 150 нМ, кроме пробы 4 экстракты получены из прикрепленных + открепленных клеток.

а б TSA 150 нМ - + oct- - + TSA 150 нМ e2f Oct- циклин D Циклин D циклин E циклин A Циклин A c-myc cdc25A TSA 0 2 6 9 150 нМ (ч) p27kip p21Waf p27kip p57kip p21Waf РНК Рис. 3. Влияние TSA на экспрессию генов, кодирующих регуляторы клеточного цикла;

а – RT-PCR-анализ транскрипции генов oct-4, позитивных (циклин D1, e2f1, циклин E, циклин A, cdc25A, c-myc) и негативных (p21Waf1, p27kip1, p57kip2) регуляторов клеточного цикла;

денатурирующий электрофорез РНК приведен в качестве контроля нагрузки;

б – вестерн блот-анализ уровня экспрессии белков циклина D1, циклина A, p21Waf1, p27kip1.

4. Обработка ингибиторами деацетилаз гистонов не вызывает активации маркера дифференцированных и стареющих клеток SA-Gal. В некоторых клеточных линиях, например в фибробластах человека, ингибиторы HDAC вызывают процесс ускоренного клеточного старения (Ogryzko et al., 1996). Способность подвергаться старению зависит от типа клетки, ее способности избежать запуска апоптоза и реализовать длительный блок клеточного цикла. Поскольку TSA вызывает снижение количества Oct-4, а также Контроль 25 нМ TSA, 5 сут Рис. 4. Выявление активности SAGal в мЭСК через 5 сут обработки 25 нМ TSA и через 1 сут обработки 150 нМ TSA;

позитивный 150 нМ TSA, 1 сут Дифференцированные клетки контроль дифференцированн ые мЭСК, Контроль – мЭСК;

фото в проходящем свете (объектив 40х).

a б TGAGTCA Сайт связывания TTACCTCA Сol-AP-1 Jun2-АР- нд диф4диф6 нд диф4диф Специфическое - + NaBut связывание c-fos gapdh - + TSA Свободная проба c-fos gapdh 1 2 3 1 2 Рис. 5. a - ретардация меченых олигонуклеотидов в ПААГ с белками ядерных экстрактов, полученных из клеток эмбриональной карциномы мыши линии F9 на разных стадиях дифференцировки;

нд - недифференцированные клетки, диф 4 - четверо суток после обработки индукторами (РК), диф 6 шесть суток после обработки индукторами (РК+дб цАМФ);

б - RT-PCR-анализ транскрипции гена c-fos в недифференцированных клетках линии F9 после воздействия ингибиторов HDAC TSA и NaBut, ген gapdh использован для контроля нагрузки кДНК в реакции PCR.

остановку пролиферации, накопление негативного регулятора клеточного цикла p21Waf1 и подавление экспрессии генов, стимулирующих пролиферацию, (рис. 3), мы решили проверить, вызывают ли ингибиторы HDAC клеточное старение мЭСК. Для этого применялись разные сроки воздействия и разные концентрации TSA. Была взята точка сут воздействия 150 нМ TSA. Для возможности исследовать более длительное воздействие брали низкую концентрацию, 25 нМ TSA, и изучали результат действия ингибитора в течение 2-х и 5 сут. Тест на активность SA-Gal, не показал в клетках, обработанных TSA, специфического окрашивания, характерного для дифференцированных и стареющих клеток при всех использованных условиях (рис. 4, Чуйкин и др., 2006). Отсутствие активности SA-Gal, невозможность подавить апоптоз и реализовать длительный блок клеточного цикла после воздействия ингибиторов HDAC, характерны для мЭСК и, по всей видимости, свидетельствуют о том, что система регуляции клеточного цикла настроена на постоянную пролиферацию мЭСК и подавление запуска апоптоза.

5. Активность транскрипционного фактора AP-1 увеличивается при дифференцировке клеток эмбриональной карциномы мыши линии F9 (Чуйкин и др., 2004;

Лянгузова и др., 2004). Клетки F9 обладают близким сходством с мЭСК, сохраняя ограниченный потенциал к дифференцировке при воздействии индукторов. Ретиноевая кислота (РК) и дибутирил-цАМФ (дб-цАМФ) вызывают их дифференцировку в направлении париетальной эндодермы (Strickland, 1981). Мы решили исследовать, как меняется активность фактора АР-1 при дифференцировке клеток F9. Для выявления ДНК связывающей активности транскрипционных комплексов АР-1 использовали метод ретардации в ПААГ олигонуклеотидов меченых [23-Р]-АТФ. В качестве олигонуклеотидных проб использовали последовательности Col-AP-1 и Jun2-АР-1 из промоторов генов коллагеназы (5’-AGCATGAGTCAGCC-3’) и c-jun (5‘ AGCTAGCATTACCTCATCCC-3‘) соответственно. В экстрактах недифференцированных клеток мы выявили низкую интенсивность сигнала на рентгенограмме, соответствующую ДНК-белковым комплексам с обеими мечеными пробами (рис. 5, а, дорожки 1).

Интенсивность сигнала сильно возрастала после четырех и шести сут обработки индукторами, РК и дб-цАМФ (рис. 5, а дорожки 2, 3). Мы также выяснили, что транскрипция гена c-fos, кодирующего один из белков, входящих в состав транскрипционного фактора AP-1, в недифференцированных клетках F9 находится под негативной регуляцией деацетилаз гистонов. Воздействие ингибиторов HDAC TSA и NaBut приводит к индукции транскрипции гена c-fos (рис. 5, б).

6. Недифференцированные быстроделящиеся мЭСК не содержат -катенин в ядре.

Сигнальные пути, обеспечивающие высокопролиферативный статус мЭСК, в настоящее время изучены недостаточно. Недавно появились данные о том, что активация Wnt/ катенинового пути способствует поддержанию плюрипотентного состояния мЭСК даже в отсутствии фактора LIF (Sato et al., 2004). Поскольку ядерная локализация -катенина отмечается в быстроделящихся клетках-предшественниках тканей (Reya et al., 2003;

He et al., 2004) и в различных типах опухолевых клеток (Fukuchi et al., 1998;

Sparks et al., 1998;

Koch et al., 1999), большой интерес представляло исследовать внутриклеточную локализацию -катенина в мЭСК. Методом иммунофлюоресценции показано, что в недифференцированных мЭСК -катенин имеет примембранную локализацию и не детектируется в ядре (рис. 6, а). Мы использовали окраску родамин-фаллоидином, чтобы увидеть расположение актина в мЭСК и не обнаружили актиновых фибрилл в цитоплазме клетки, так как актин преимущественно располагается в кортикальном слое возле а б Контроль Е-кадгерин Актин N-кадгерин BIO Topro- -катенин Topro-3 Негативный контроль -катенин Рис. 6. Внутриклеточная локализация -катенина, актина и E- и N-кадгеринов в мЭСК (а) и локализация -катенина до и после обработки мЭСК 5 мкМ BIO (б) методом иммунофлюоресции и конфокальной микроскопии;

а – шкала 11 мкм, б – шкала 30 мкм;

фаллоидин – окраска на актин с помощью родамин-фаллоидина, Topro-3 – окрашивание ядер с помощью красителя Topro-3, негативный контроль - контроль без первых антител.

а б К РК РК+цАМФ E кадгерин snail N кадгерин -катенин Е-кадгерин -катенин tcf- oct- dab РНК РНК Актин Topro- Рис. 7. Внутриклеточная локализация катенина, актина и E- и N-кадгеринов в дифференцированных мЭСК методом иммунофлюоресценции и конфокальной микроскопии, шкала 15 мкм (а). RT-PCR анализ экспрессии генов E-кадгерина, snail, N-кадгенина, -катенина, Тcf-4, oct-4, dab Topro-3 N-кадгерин в недифференцированных и дифференцированных мЭСК (б);

К –недифференцированные клетки;

РК – дифференцировка 9 сут в присутствии 1 мкМ ретиноевой кислоты, РК+цАМФ – дифференцировка 7 сут в присутствии 1 мкМ ретиноевой кислоты, затем сут в среде, содержащей 100 мкМ дибутирил-цАМФ.

мембраны и фактически ко-локализуется с E-кадгерином и -катенином (рис. 6, а).

Обработка клеток ингибитором киназы GSK3 BIO заметно изменяет морфологию клеток:

колонии мЭСК приобретают сферическую форму, однако перемещения -катенина в ядро при этом не происходит (рис. 6, б).

7. Изменение локализации белков межклеточных контактов, Е- и N- кадгеринов и катенина при дифференцировке мЭСК. Постоянное присутствие -катенина в примембранном слое мЭСК позволяет предположить, что изменение его локализации может произойти только в случае изменения статуса клетки. Из литературных источников известно, что в клетках тератокарциномы мыши линии F9, близкой по свойствам к мЭСК, воздействие ретиноевой кислоты приводит к увеличению экспрессии гена dab2, который является регулятором эпителиально-мезенхимального перехода (ЭМП) (Prunier, Howe, 2005). Кроме того, мы установили, что в ходе дифференцировки клеток F9 происходит активация транскрипционного фактора AP-1 (рис. 5), который вовлечен в ЭМП в ряде клеточных линий (Eger et al., 2000). Мы решили исследовать, локализацию белков межклеточных контактов E- и N-кадгеринов, -катенина, общую организацию цитоскелета и транскрипцию генов, регулирующих ЭМП при дифференцировке мЭСК в присутствии РК. Дифференцировка мЭСК, индуцированная ретиноевой кислотой (9 сут), изменяет как морфологию клеток, так и организацию цитоскелета, окраска родамин-фаллоидином выявляет актиновые фибриллы (рис. 7, а). При дифференцировке ЭСК наблюдаются изменения внутриклеточной локализации основных компонентов кадгерин/Wnt сигнального каскада. Так, E-кадгерин обнаруживается преимущественно в цитоплазме, а не в примембранном слое, как в недифференцированных мЭСК (рис. 7, а). Кроме того, в области межклеточных контактов появляется N-кадгерин, который не экспрессируется в недифференцированных мЭСК, (рис. 7, а). -катенин в дифференцированных клетках локализуется как на мембране, так и ядре клеток, а также диффузно распределен в цитоплазме. Появление на мембране N-кадгерина вместе с изменением локализации E кадгерина и -катенина при дифференцировке указывает на то, что дифференцировка мЭСК сопровождается утратой "эпителиального" фенотипа.

8. Экспрессия генов-маркеров эпителиально-мезенхимального перехода при дифференцировке мЭСК. Исследование уровня транскрипции методом RT-PCR показало, что в результате дифференцировки увеличивается содержание мРНК -катенина и tcf-4, который является партнером -катенина по транскрипционной функции. Кроме того, снижается содержание мРНК гена Е-кадгерина и увеличивается содержание мРНК его негативного регулятора - гена snail (Cano et al., 2000) (рис. 7, б). В дифференцированных клетках появляется мРНК генов N-кадгерина и dab-2, которые не детектируются в недифференцированных ЭСК мыши (рис. 7, б). В результате дифференцировки отмечается снижение транскрипции маркера ЭСК oct-4 (рис. 7, б).

Таким образом, ядерная локализация -катенина не является необходимым условием для обеспечения автономной пролиферации недифференцированных мЭСК. Локализация катенина в ядре отмечается в дифференцированных клетках, которые попутно демонстрируют признаки ЭМП.

ЗАКЛЮЧЕНИЕ Результаты настоящей работы свидетельствуют о том, что активность деацетилаз гистонов необходима для обеспечения высокопролиферативного статуса мЭСК.

Ингибиторы HDAC оказывают негативное влияние на пролиферацию мЭСК, влияя на систему регуляции клеточного цикла. Инкубация с ингибиторами HDAC в течение 1 сут приводит к снижению экспрессии позитивных регуляторов клеточного цикла, e2f1, циклина D1, A, фосфатазы cdc25A, c-myc. Известно, что отсутствие длительных блоков клеточного цикла после ДНК-повреждающих воздействий на мЭСК, коррелирует с низким уровнем экспрессии негативного регулятора пролиферации, ингибитора циклин-киназных комплексов, p21Waf1 (Малашичева и др., 2002). В настоящей работе показано, что ингибитор HDAC TSA индуцирует экспрессию гена p21Waf1 на уровне мРНК и белка и усиливает транскрипцию другого ингибитора циклин-киназных комплексов, p57kip2, что коррелирует с индукцией блока клеточного цикла.

Неспособность мЭСК реализовать программу дифференцировки или ускоренного клеточного старения после воздействия ингибиторов HDAC, по всей видимости, связана с тем, что остановка пролиферации, вызванная этими агентами, приводит к запуску программы апоптоза. Система регуляции клеточного цикла мЭСК настроена на постоянное размножение, а постепенное снижение интенсивности деления может происходить при дифференцировке. В ходе дифференцировки происходит репрограммирование хроматина, процесс, при котором происходят многообразные посттрансляционные модификации гистонов. В одной из работ показано, что активность деацетилаз необходима для процесса дифференцировки (Lee et al., 2004). Поэтому обработка ингибиторами HDAC приводит к временному подавлению пролиферации, обратимому при возврате клеток в чистую среду и гибельному при продолжительном воздействии, но не может вызывать полноценную дифференцировку. То, что признаки апоптотической гибели, олигонуклеосомная фрагментация ДНК и активация каспаз отмечаются именно в плавающих, а не в прикрепленных клетках, может означать, что контакты клеток могут обеспечивать сигнал выживания. Известно, что эмбриональные стволовые клетки предпочитают расти колониями.

В качестве модели дифференцировки в настоящей работе использовалось воздействие ретиноевой кислоты, отдельно или в сочетании с дибутирил-цАМФ.

Показано, что в результате дифференцировки принципиально изменяется морфология клеток, экспрессия маркеров эпителиально-мезенхимального перехода, структура цитоскелета и локализация белков межклеточных контактов, E- и N- кадгеринов, катенина. Показано, что в ходе дифференцировки клеток F9 увеличивается транскрипция генов c-fos, c-jun и ДНК-связывающая активность фактора AP-1, который может участвовать в ЭМП. Воздействие TSA, хотя и вызывает морфологические изменения клеток, а кроме того индуцирует транскрипцию гена c-fos, неспособно вызвать таких признаков эпителиально-мезенхимального перехода как экспрессию dab2, N-кадгерина и появление актиновых стресс-фибрилл. В настоящей работе показано, что в недифференцированных мЭСК, обладающих чертами трансформированного фенотипа и высоким пролиферативным потенциалом, -катенин локализуется исключительно у мембран и его локализация не меняется даже после активации Wnt-пути ингибитором киназы GSK3, BIO. Ядерная локализация -катенина в клетках, обработанных ретиноевой кислотой, свидетельствует о том, что активация Wnt-пути происходит при дифференцировке мЭСК.

ВЫВОДЫ 1. Ингибиторы деацетилаз гистонов вызывают подавление пролиферации мЭСК, индуцируя блок клеточного цикла и последующий запуск апоптотической гибели.

2. Подавление пролиферации мЭСК после воздействия ингибиторов деацетилаз гистонов сопровождается снижением уровня мРНК таких позитивных регуляторов клеточного цикла как циклин D1, циклин A, фосфатаза cdc25A, c-myc, e2f1 и усилением экспрессии негативных регуляторов – p21Waf1 и p57Kip2.

3. Воздействие ингибиторов деацетилаз гистонов вызывает появление некоторых признаков дифференцированных клеток, но не приводит к полноценной дифференцировке или к индукции ускоренного клеточного старения.

4. В недифференцированных быстроделящихся мЭСК -катенин локализован в области клеточных мембран и не детектируется в ядрах клеток.

5. Установлено, что перемещение -катенина в ядро, появление на мембране N кадгерина и перераспределение E-кадгерина из мембран в цитоплазму наблюдается при дифференцировке клеток, вызванной ретиноевой кислотой.

6. Показано, что дифференцировка мЭСК, индуцированная ретиноевой кислотой сопровождается изменением транскрипции генов, характерным для эпителиально мезенхимального перехода.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Лянгузова М. С., Чуйкин И. А., Поспелов В.А.. Необходимость активации PI3 киназы для пролиферации клеток эмбриональной карциномы мыши линии F9.

Цитология. 2004. Т 46. № 1. С. 26- 2. Чуйкин И. А., Лянгузова М. С., Поспелов В. А. Транскрипция гена c-fos и ДНК связывающая активность транскрипционного фактора AP-1 увеличиваются в результате дифференцировки клеток эмбриональной карциномы мыши линии F9.

Цитология. 2004. Т. 46. № 12. С. 1080- 3. Лянгузова М.С., Чуйкин И.А., Поспелов В.А. Фармакологические ингибиторы киназы PI3K вортманнин и LY294002 оказывают различное действие на пролиферацию эмбриональных стволовых клеток мыши. 2006. Цитология. Т. 48. № 7. С. 560- 4. Чуйкин И. А., Лянгузова М. С., Поспелов В. А. Механизмы антипролиферативного действия ингибиторов деацетилаз гистонов на эмбриональные стволовые клетки мыши. Цитология. 2006. Т 48. № 8. С. 612- 5. Чуйкин И.А., Поспелов В.А.. Анализ ДНК-связывающей активности фактора АР- и транскрипции генов раннего ответа c-fos и c-jun в клетках эмбриональной карциномы мыши линии F9. Всероссийский симпозиум 1-й съезд общества клеточной биологии. Санкт-Петербург, 14-16 октября 2003. Стендовое сообщение.

Цитология. 2003. Т. 45. № 9. С. 6. Tchouikine I.A., Pospelov V.A. Regulation of AP-1 transcription factor through different signaling pathways in mouse F9 teratocarcinoma cells. Oral presentation. 14th European Student Conference at Charite, Берлин, Германия. 4-9 ноября 2003.

Abstract

Book. P.

7. Чуйкин И.А., Лянгузова М.С., Поспелов В.А.. Ингибитор PI3-киназы LY вызывает обратимое подавление пролиферации эмбриональных стволовых клеток мыши линии IOUD-2. Международный симпозиум по биологии клетки в культуре «Стволовые клетки, регенерация, клеточная терапия». Санкт-Петербург, 25- октября 2004. Стендовое сообщение. Цитология. Т. 46. С. 8. Chuykin I.A., Liangouzova M.S., Pospelov V.A. PI3-kinase inhibitor LY supresses proliferation of murine embryonic stem cells but does not affect STAT- phosphorylation. 3rd Annual Meeting of the International Society for Stem Cell Research.

San-Francisco, June 23-25, 2005. Стендовое сообщение. Abstract book. P. 9. Чуйкин И.А., Лянгузова М.С., Поспелов В.А.. Механизмы антипролиферативного действия ингибитора HDAC на эмбриональные стволовые клетки мыши.

Конференция «Биология стволовых клеток: фундаментальные аспекты». Москва 17 18 ноября 2005 г. Устный доклад. Программа и тезисы докладов. С. 73- СПИСОК ЦИТИРОВАННОЙ ЛИТЕРАТУРЫ 1. Абрамова М. В., Светликова С. Б., Аксенов Н. Д., Поспелова Т. В., Поспелов В. А.

Игибитор деацетилаз гистонов останавливает пролиферацию клеток, трансформированных онкогенами Е1А и cHA-RAS. Цитология. 2003. Т. 45. № 11. С.

1100- 2. Лянгузова М. С., Чуйкин И. А., Поспелов В.А.. Необходимость активации PI3 киназы для пролиферации клеток эмбриональной карциномы мыши линии F9.

Цитология. 2004. Т 46. № 1. С. 26- 3. Лянгузова М.С., Чуйкин И.А., Поспелов В.А. Фармакологические ингибиторы киназы PI3K вортманнин и LY294002 оказывают различное действие на пролиферацию эмбриональных стволовых клеток мыши. 2006. Цитология. Т. 48. № 7. С. 560- 4. Малашичева А.Б., Кислякова Т.В., Саватьер П., Поспелов В.А. Эмбриональные стволовые клетки не вступают в арест клеточного цикла под воздействием ДНК повреждающих факторов. Цитология. 2002. Т. 44. № 7. С. 643- 5. Туроверов К.К., Бикташев А.Г., Дорофеюк А.В., Кузнецова И.М. Комплекс аппаратных и программных средств для измерения спектральных, поляризационных и кинетических характеристик флуоресценции в растворе. Цитология. 1998. Т. 40. № 8/9. С. 806- 6. Чуйкин И. А., Лянгузова М. С., Поспелов В. А. Механизмы антипролиферативного действия ингибиторов деацетилаз гистонов на эмбриональные стволовые клетки мыши. Цитология. 2006. Т 48. № 8. С. 612- 7. Чуйкин И. А., Лянгузова М. С., Поспелов В. А. Транскрипция гена c-fos и ДНК связывающая активность транскрипционного фактора AP-1 увеличиваются в результате дифференцировки клеток эмбриональной карциномы мыши линии F9.

Цитология. 2004. Т. 46. № 12. 1080- 8. Araki K., Nakajima Y., Eto K., Ikeda M. 2003. Distinct recruitment of E2F family members to specific E2F-binding sites mediates activation and repression of the E2F promoter. Oncogene. V 22. № 7. 7632– 9. Bienz M. -Catenin: A Pivot between Cell Adhesion and Wnt Signalling. Curr Biol. 2004.

V. 15. № 2. P. 64- 10. Bradford M.M. A rapid and sensitive method for the quantitation of mocrogram quantities of protein utilizing the principle of protein-dye binding. Annal Biochem. 1976. V. 72.

248- 11. Brook F.A., Gardner R.L. The origin and efficient derivation of embryonic stem cells in the mouse. PNAS. 1997. V. 94. № 11. P. 5709– 12. Burgess A.J., Pavey S., Warrener R., Hunter L.J., Piva T.J., Musgrove E.A., Saunders N., Parsons P.G., Gabrielli B.G. Up-regulation of p21(WAF1/CIP1) by histone deacetylase inhibitors reduces their cytotoxicity. Mol Pharmacol. 2001. V. 60. № 4. P. 828- 13. Cano A., Perez-Moreno M.A., Rodrigo I., Locascio A., Blanco M.J., del Barrio M.G., Portillo F., Nieto MA. The transcription factor Snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol. 2000. V. 2. № 2. P. 76– 14. Cartwright P., McLean C., Sheppard A., Rivett D., Jones K., Dalton S. LIF/STAT controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. 2005.

Development. V. 132. № 5. P. 885- 15. Dimri G.P., Lee X., Basile G., Acosta M., Scott G., Roskelley C., Medrano E.E., Linskens M., Rubelj I., Pereira-Smith O., et al. 1995. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. PNAS. 1995. V. 92. № 20. P. 9363- 16. Dokmanovic M., Marks P. A. Prospects: Histone deacetylase inhibitors. J Cell Biochem.

2005. V. 96. № 2. P. 293- 17. Eger A., Stockinger A., Schaffhauser B., Beug H., Foisner R. Epithelial mesenchymal transition by c-Fos estrogen receptor activation involves nuclear translocation of -catenin and upregulation of -catenin/lymphoid enhancer binding factor-1 transcriptional activity.

J Cell Biol. 2000. V. 148. № 1. P. 173– 18. Fukuchi T., Sakamoto M., Tsuda H., Maruyama K., Nozawa S., Hirohashi S. -Catenin mutation in carcinoma of the uterine endometrium. Cancer Res. 1998. V. 58. № 16. P.

3526– 19. Gui C.Y., Ngo L., Xu W.S., Richon V.M., Marks P.A. Histone deacetylase (HDAC) inhibitor activation of p21Waf1 involves changes in promoter-associated proteins, including HDAC1. PNAS. 2004. V. 101. № 5. P. 1241– 20. He X.C., Zhang J., Tong W.G., Tawfik O., Ross J., Scoville D.H., Tian Q., Zeng X., He X., Wiedemann L.M., Mishina Y., Li L. BMP signaling inhibits intestinal stem cell self renewal through suppression of Wnt-beta-catenin signaling. 2004. Nat Genet. V. 36. № 10.

P. 1117- 21. Kemler R., Hierholzer A., Kanzler B., Kuppig S., Hansen K., Taketo M.M., de Vries W.N., Knowles B.B., Solter D. Stabilization of -catenin in the mouse zygote leads to premature epithelial-mesenchymal transition in the epiblast. Development. 2004. V. 131.

№ 23. P. 5817- 22. Koch A., Denkhaus D., Albrecht S., Leuschner I., von Schweinitz D., Pietsch T.

Childhood hepatoblastomas frequently carry a mutated degradation targeting box of the beta-catenin gene. Cancer Res. 1999. V. 59. № 2. P. 269- 23. Kukushkin A.N., Abramova M.V., Svetlikova S.B., Darieva Z.A., Pospelova T.V., Pospelov V.A. Downregulation of c-fos gene transcription in cells transformed by E1A and cHa-ras oncogenes: a role of sustained activation of MAP/ERK kinase cascade and of inactive chromatin structure at c-fos promoter. Oncogene. 2002. V. 21. № 5. P. 719- 24. Lagger G., O'Carroll D., Rembold M., Khier H., Tischler J., Weitzer G., Schuettengruber B., Hauser C., Brunmeir R., Jenuwein T., Seiser C. Essential function of histone deacetylase 1 in proliferation control and CDK inhibitor repression. EMBO J. 2002. V. 21.

№ 11. P. 2672- 25. Lee J.H., Hart S.R., Skalnik D.G. Histone Deacetylase Activity Is Required for Embryonic Stem Cell Differentiation. Genesis. 2004. V. 38. № 1. P. 32– 26. Moore P.S., Barbi S., Donadelli M., Costanzo C., Bassi C., Palmieri M., Scarpa A. Gene expression profiling after treatment with the histone deacetylase inhibitor trichostatin A reveals altered expression of both pro- and anti-apoptotic genes in pancreatic adenocarcinoma cells. Biochim Biophys Acta. 2004. V. 1693. № 3. P. 167- 27. Muller R., Wagner E.F. Differentiation of F9 teratocarcinoma stem cells after transfer of c fos protooncogene. Nature. 1984. V. 311. 438- 28. Ogryzko V.V., Hirai T.H., Russanova V.R., Barbie D.A., Howard B.H. Human fibroblast commitment to a senescence-like state in response to histone-deacetylase inhibitors is cell cycle dependent. Mol Cell Biol. 1996. V. 16. № 9. P. 5210- 29. Peart M.J., Smyth G.K., van Laar R.K., Bowtell D.D., Richon V.M., Marks P.A., Holloway A.J., Johnstone R.W. Identification and functional significance of genes regulated by structurally different histone deacetylase inhibitors. PNAS. 2005. V. 102. № 10. P. 3697– 30. Peart M.J., Tainton K.M., Ruefli A A., Dear A E., Sedelies K.A., O’Reilly L.A., Waterhouse N.J., Trapani J.A., Johnstone R.W. 2003. Novel Mechanisms of Apoptosis Induced by Histone Deacetylase Inhibitors. Cancer Res. V. 63. № 15. 4460– 31. Peinado H., Portillo F., Cano A. Transcriptional regulation of cadherins during development and Carcinogenesis. Int J Dev Biol. 2004. V. 48. P. 365- 32. Pospelova T.V., Medvedev A.V., Kukushkin A.N., Svetlikova S.B., van der Eb A.J., Dorsman J.C., Pospelov V.A. E1A + cHa-ras transformed rat embryo fibroblast cells are characterized by high and constitutive DNA binding activities of AP-1 dimers with significantly altered composition. Gene Expr. 1999. V. 8. № 1. P. 19- 33. Prunier C., Howe P.H. Disabled-2 (Dab2) Is Required for Transforming Growth Factor induced Epithelial to Mesenchymal Transition (EMT). J Biol Chem. 2005. V. 280. № 17.

P. 17540- 34. Reya T., Duncan A.W., Ailles L., Domen J., Scherer D.C., Willertk K., Hintz L., Nussek R., Weissman I.A. A role for Wnt signalling in self-renewal of haematopoietic stem cells.

Nature. 2003. V. 423. № 6938. P. 409- 35. Richon V.M., Sandhoff T.W., Rifkind R.A., Marks P.A. Histone deacetylase inhibitor selectively induces p21Waf1 expression and gene-associated histone acetylation. PNAS.

2000. V. 97. № 18. P. 10014- 36. Sato N., Meijer L., Skaltsounis L., Greengard P., Brivanlou A.H. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK3-specific inhibitor. Nat Med. 2004. V. 10. № 1. P.

55- 37. Schratt G., Weinhold B., Lundberg A.S., Schuck S., Berger J., Schwarz H., Weinberg R.A., Ruther U., Nordheim A. 2001. Serum response factor is required for immediate early gene activation yet is dispensable for proliferation of embryonic stem cells. Mol Cell Biol. V. 21. № 8. P. 2933- 38. Smith A.G. Embryo-derived stem cells: of mice and man. Ann Rev Cell Dev Biol. 2001.

V. 17. P. 435– 39. Sparks A.B., Morin P.J., Vogelstein B., Kinzler K.W. Mutational analysis of the APC/beta-catenin/Tcf pathway in colorectal cancer. Cancer Res. 1998. V. 58. № 6. P.

1130- 40. Stevens C., La Thangue N.B. E2F and cell cycle control: a double-edged sword. Arch Biochem Biophys. 2003.V. 412. P. 157- 41. Strickland S. Mouse teratocarcinoma cells: prospects for the study of embryogenesis and neoplasma. Cell. 1981. V. 21. P. 277– 42. Xiao H., Hasegawa T., Miyaishi O., Ohkusu K., Isobe K. Sodium butyrate induces NIH3T3 cells to senescence-like state and enhances promoter activity of p21Waf1/CIP1 in p53-independent manner. BBRC. 1997. V. 237. № 2. P. 457-

 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.