авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Экспрессия гена мезоглеина в различных типах клеток медузы aurelia aurita.

РОССИЙСКАЯ АКАДЕМИЯ НАУК ИНСТИТУТ ЦИТОЛОГИИ

На правах рукописи

МАТВЕЕВ Иван Владимирович Экспрессия гена мезоглеина в различных типах клеток медузы Aurelia aurita.

03.00.25 - гистология, цитология, клеточная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Санкт-Петербург 2007

Работа выполнена в Институте цитологии РАН, Санкт-Петербург

Научный консультант:

доктор биологических наук, профессор Пинаев Георгий Петрович Институт цитологии РАН Санкт-Петербург

Официальные оппоненты:

доктор биологических наук, профессор Воробьев Владимир Иосифович Институт цитологии РАН Санкт-Петербург доктор биологических наук, профессор Перевозчиков Андрей Петрович ГУНИИ экспериментальной медицины РАМН Санкт-Петербург

Ведущая организация:

Зоологический институт РАН Санкт-Петербург

Защита состоится 19 января 2007 г. в 13 часов на заседании диссертационного совета Д.002.230.01 при Институте цитологии РАН по адресу: 194064, Санкт-Петербург, Тихорецкий проспект, дом

С диссертацией можно ознакомиться в библиотеке Института цито логии РАН

Автореферат разослан _ декабря 2006 года

Ученый секретарь кандидат биологических наук диссертационного совета Е.В. Каминская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы.

Внеклеточный матрикс (ВКМ) имеется у всех многоклеточных жи вотных и может составлять значительную часть объема их тканей (Ал бертс и др., 1994). ВКМ активно участвует в регуляции множества про цессов, происходящих в организме, начиная с самых первых шагов эм брионального развития. Он определяет форму контактирующих с ним клеток, их миграцию, пролиферацию, дифференцировку. В защитных реакциях простых в эволюционном отношении организмов ВКМ и клет ки, его синтезирующие, играют ключевую роль. Молекулярный состав ВКМ сложен и активно изучается. Основная масса исследований, посвя щенных ВКМ, проводится на позвоночных животных, преимуществен но млекопитающих, традиционных объектах лабораторных исследова ний. Результаты исследований ВКМ позвоночных непосредственно ис пользуются в медицине для создания новых способов лечения ран, ле чебной косметики и т.д..

Одна из сложностей в изучении взаимодействий клеток и ВКМ у мле копитающих состоит в разнообразии клеточного состава их тканей. Вза имодействия клеток с ВКМ трудно отличить от взаимодействий меж ду клетками различных типов. Кишечнополостные могут быть хорошей моделью для изучения взаимодействия клеток и ВКМ, т.к. они относи тельно просты по строению и клеточному составу.

В последнее время клонировано значительное количество консерва тивных генов различных видов животных из класса Кишечнополост ных. На основании анализа их последовательностей исследователи при ходят к выводу, что гены, отвечающие за регуляцию экспрессии, кон троль трансляции, проведение внутриклеточных сигналов, апоптоз, пе редачу внеклеточных сигналов, спецификацию миогенной дифферен цировки клеток и взаимодействие между клетками и ВКМ, удивитель но сходны с генами млекопитающих. Некоторые гены Кишечнополост ных, такие как mesoderm specication factor Twist, оказались значитель но ближе к генам позвоночных, чем родственные гены дрозофилы или нематод (Galliot, Schmid, 2002).

Объектом настоящей работы была выбрана сцифоидная медуза Aurelia aurita (Eukaryota;

Metazoa;

Cnidaria;

Scyphozoa;

Semaeostomeae;

Ulmaridae;

Aurelia.).

Жизненный цикл A. aurita состоит из четерех стадий: личинки - пла нулы, полипоидной стадии, эфиры и медузы. Медуза достигает диамет ра 30 см. Она охотится на мелкий планктон с помощью стрекательных клеток эпителия, покрывающего верхнюю поверхность зонтика. Жгу тиковые клетки эпителия перемещают добычу к краю зонтика, откуда медуза, с помощью щупалец, перемещает добычу в рот.

Тело представителей этого вида, как и у других кишечнополост ных, образовано двумя эпителиальными пластами, эпидермой и гастро дермой, между которыми находится мезоглея. У взрослых медуз тол щина мезоглеи составляет несколько сантиметров. Мезоглея выполня ет функцию скелета, придавая определенную форму телу животного;

она участвует также в транспорте и запасании питательных веществ (Chapman, 1966;

Bouillon and Coppois, 1977;

Weber and Schmid, 1985).

Усилие, производимое мышечной системой зонтика, обеспечивает со кращение диаметра внешней части зонтика, тогда как эластичность мезоглеи обеспечивает медузе возврат к первоначальной форме после каждого мышечного сокращения (Bouillon and Coppois, 1977). Мезоглея участвует в регулировании плавучести медузы (Denton, 1963;

Mackay, 1969). Мезоглея играет ключевую роль в контроле миграции клеток и морфогенезе (Schmid, 1992;

Kleinman et al., 2003). Основную массу ме зоглеи составляет внеклеточный матрикс (ВКМ), который у многих ки шечнополостных не содержит клеток.

У медузы A. aurita и ряда других представителей классов Scyphozoa и Anthozoa мезоглея заселена свободными подвижными клетками (Chapman, 1966). У таких кишечнополостных мезоглея приобретает внешнее сходство с соединительными тканями других животных (За варзин, 1945;

Chapman D.M., 1974). Наличие у медузы A. aurita толсто го слоя мезоглеи, заселенной почти исключительно клетками одного ти па, предоставляет исключительные возможности для изучения влияния ВКМ на клетки и наоборот. Происхождение мезоглеальных клеток (Мк) в онтогенезе слабо изучено. Одни авторы полагают, что Мк имеют эк тодермальное происхождение (Hyman, 1940;



Werner, 1984), другие - что источником их развития служит гастродерма (Заварзин, 1945;

Young, 1974). Принято считать, что выселение происходит в ходе позднего эм брионального развития или, скорее, постоянно у взрослых организмов (Заварзин, 1945;

Knight, 1971). Показано что пролиферативная актив ность Мк достаточна для самоподдержания этой популяции, без под сева клетками из эпителиальных пластов. Следовательно, популяция Мк способна самообновляться (Чага, 1996), но это не исключает воз можности постоянного выселения Мк из эпителиев. Показано, что ме зоглея или экстракт мезоглеи сцифоидной медузы Rhopilema nomadica является оптимальной подложкой для переживающих культур клеток пяти видов морских кишечнополостных группы anthozoa (Aiptasia sp., Anemonia sulcata, Stylophora pistillata, Heteroxenia fuscescence, Nephthea sp.) (Frank, Rinkevich, 1999). Возможно, изучение состава мезоглеи ме дузы поможет решить проблему культивирования постоянных клеточ ных линий беспозвоночных.

Полагают, что ВКМ мезоглеи синтезируется клетками эпителиев (Hausman, 1973;

Singer, 1974). Участие Мк в регуляции состава ВКМ мезоглеи не очевидно, однако ранее мы показали, что они являются активно синтезирующими (Shaposhnikova et al., 2005) и это позволяет предполагать, что Мк участвуют в формировании ВКМ мезоглеи. С по мощью электрофоретического анализа белкового состава мезоглеи зре лых медуз A. aurita мы показали наличие в ней нескольких мажорных белков. Одним из них является белок с молекулярной массой 45/47 кДа.

Мы получили поликлональные антитела против белков фракции 45/ кДа и подтвердили их специфичность с помощью иммуноблота. Прове денный нами иммуногистохимический анализ срезов A. aurita показал, что антиген 45/47 кДа локализуется в гранулах Мк и в апикальной ча сти клеток эпидермы, а у зрелых медуз он выявляется также в составе эластических волокон. Следовательно, Мк A. aurita (наряду с эпидер мальными клетками) определенно участвуют в процессах формирова ния межклеточного вещества мезоглеи (Shaposhnikova et al., 2005).

Получение нуклеотидных последовательности генов, экспрессирую щихся в Мк позволит приблизиться к пониманию функций этих клеток.

Выявление генов специфически экспрессирующихся в Мк, позволит су дить о том, насколько специализированной является эта группа клеток.

Такие гены можно будет, также, использовать как маркеры дифферен цировки Мк, что позволит проследить их происхождение в онтогенезе.

Мы клонировали и секвенировали мРНК мажорного белока мезоглеи A. aurita с молекулярной массой около 45 кДа и назвали его мезогле ин, а также показали, что у взрослых медуз этот белок экспрессируется только в Мк.

Цели и задачи исследования.

Целью настоящей работы был поиск генов специфически экспресси рующихся в Мк.

Были поставлены следующие задачи:

1. Сравнить транскрипты Мк с транскриптами клеток эпидермы и гастродермы с помощью метода дифференциального дисплея (ДД).

2. Определить нуклеотидную последовательности мРНК мажорного белка мезоглеи A. aurita с молекулярной массой около 45/47 кДа.

3. Проверить предположение о том, что ген мажорного белка мезо глеи с молекулярной массой 45/47 кДа специфически экспрессируется в Мк.

Основные положения, выносимые на защиту.

1. Клонирована и секвенирована мРНК мажорного белка ВКМ мезо глеи A. aurita - мезоглеина.

2. На основании нуклеотидной последовательности клонированой мРНК сделан вывод что мезоглеин содержит домены ZP и DSL, что характерно для экстраклеточных белков.

3. Мезоглеин синтезируют и экскретируют мезоглеальные клетки.

Научная новизна. Ранее предполагалось, что Мк принимают уча стие в регуляции состава ВКМ мезоглеи. В данной работе показано, что Мк синтезируют один из белков ВКМ мезоглеи. Клонирована и секве нирована мРНК мезоглеина - белка синтезируемого и экскретируемого Мк. Анализ последовательности мезоглеина позволяет делать предпо ложения о функциях этого белка и Мк.

Теоретическое и практическое значение работы. Доказатель ство того, что мезоглеальные клетки A. aurita являются активно синте зирующими, определение нуклеотидной последовательности мРНК ме зоглеина, за синтез которого они ответственны, требует пересмотра об щепринятого взгляда об инертной природе этой клеточной популяции.

Анализ последовательности мРНК мезоглеина позволило отнести его к семейству ZP содержащих белков. Полученный сиквенс может быть использован для сравнительно эволюционных исследований. Среди из вестных обладателей ZP содержащих белков, A. aurita является самым низшим представителем в современной зоологической классификации.

Материалы диссертации используются в курсах лекций для бакалав ров и магистров Биолого-почвенного факультета Санкт- Петербургско го государственного университета и могут быть использованы в общих и специальных курсах лекций биологических факультетов других уни верситетов.

Апробация работы. По теме диссертации опубликовано 6 печатных работ (из них 3 статьи). Основные положения представлены и обсужде ны на XIV Всероссийском симпозиуме "Структура и функции клеточ ного ядра"(2002), 10th Evolutionary Biology Meeting at Marseilles (2006), Всероссийском симпозиуме "Биология клетки в культуре"(2006), на научных семинарах Отдела клеточных культур Института цитологии РАН.

Объем и структура диссертации. Диссертационная работа состоит из введения, обзора литературы, экспериментальной части, включающей методы и результаты исследования, обсуждения, выводов и списка литературы, содержащего 82 публикаций. Работа изложена на 75 страницах машинописного текста и иллюстрирована 9 рисунками.

МАТЕРИАЛЫ И МЕТОДЫ Сбор материала. Объект исследования - представители вида Aurelia aurita (L) (ceM.Ulmaridae, отр. Semaestomae, кл. Scyphozoa).

Животных отлавливали в июле-августе в Чупинской губе Белого мо ря. В работе использовали взрослых животных с диаметром зонтика не менее 10 см. Медуз собирали сачком на глубине до 2 м.

Животных препарировали, отделяя с помощью пинцета и скальпеля эпидерму, мезоглею, очищенную от эпидермы и гастральных каналов, и мезоглею, содержащую гастральные каналы.

Выделение РНК. Для выделения РНК использовали набор реаген тов Trizol (Invitrogen) согласно рекомендациям изготовителя или прото кол с использованием гуанидинтиоцианата (Chomczynski, Sacchi, 1987).

РНК разделяли с помощю электрофореза в 1.5%-ном агарозном геле, содержащем 5 мкг/мл бромистого этидия в ТАЕ буфере (Sambrook et al., 1989). Чистоту выделения и сохранность РНК оценивали по четко сти полос 18S и 28S рибосомных РНК, наблюдаемых в УФ свете. Коли чество РНК измеряли спектрофотометрически по поглощению УФ све та с длиной волны 260 нм (Sambrook et al., 1989).





ДНК удаляли из препарата РНК, обрабатывая препарат ДНКа зой, свободной от РНКазы. Каждая реакционная смесь, объемом мкл, содержала около 12 мкг РНК, 1 ед ДНКазы ( RNase-free;

Roche Boehringer-Mannheim). Реакцию проводили при комнатной температу ре в течении 30 мин. Реакционную смесь депротеинизировали фенол хлороформом, РНК осаждали этанолом (Sambrook et al., 1989).

Дифференциальный дисплей (ДД). Использовали опублико ванный протокол (Liang, Pardee, 1992). Метод состоит из трех эта пов: (1) синтез кДНК, комплементарной мРНК;

(2) ПЦР амплифика ция фрагментов кДНК (ДДПЦР);

(3) визуализация амплифицирова ных фрагментов с помощью электрофореза в денатурирующем полиа криламидном геле (ПААГ).

Синтез кДНК. Обратную транскрипцию (ОТ) проводили в соот ветствии с рекомендациями фирмы производителя обратной транс криптазы MMulV (Fermentas, Литва) с заякоренным праймером ANKl (AAGCTTTTTTTTTTTC). В каждую реакционную смесь объемом мкл брали около 0.3 мкг тотальной РНК и 20 ед Ribonuclease Inhibitor (Fermentas, Литва).

ДДПЦР. Использовали заякоренный ANK1 праймер и произволь ный RAPD5 (AACGCGCAAC) праймер. Реакционная смесь объемом мкл содержала стандартный буфер для Taq ДНК полимеразы, 1.5 мМ MgCl2, 0.02 мМ каждого dNTP, 1 МБк [-P33 ] dATP, 2 ед Taq, 10 пМ каждого праймера и 1 мкл продуктов ОТ, разведенных в 4 раза. Ре акцию проводили по программе 95oC 1 мин, 36oC 1 мин, 72oC 1мин, цикла;

95oC 1 мин, 39o C 1 мин, 72oC 1 мин, 40 циклов.

Денатурирующий электрофорез. Продукты ДДПЦР разделяли при помощи электрофореза в 6%-ном полиакриламидном геле толщиной 0. мм в ТВЕ буфере при денатурирующих условиях (8 М мочевина, 55oC, 2 Вт/см) (Sambrook et al., 1989). Гель помещали на фильтровальную бу магу Wattmann 1ММ и высушивали. Высушенный гель экспонировали с рентгеновской пленкой в течении ночи.

Клонирование и секвенирование. На радиавтографе, представляю щем результат ДД (рис. 1), выбирали те зоны, которые присутствуют на дорожках, соответствующих мезоглее, и отсутствуют на дорожках, со отвествующих эпидерме и гастродеме. Такие зоны содержат фрагменты кДНК генов, возможно, специфически экспрессирующихся в мезоглее.

На рис. 1 три такие зоны обозначены стрелкой. Радиоавтограф совме щали с гелем и отмечали иголкой на геле местоположение интересую щих зон. Гель, содержащий отмеченные зоны, вырезали, отмывали от мочевины в 20 мкл деионизованой воды в течение 20 мин и помеща ли в реакционную смесь для ПЦР. Содержащуюся в вырезанных зонах ДНК реамплифицировали с теми же праймерами, с которыми прово дился ДДПЦР, и по той же программе в течение 30 циклов. Продукты реамплификации клонировали с помощью набора TOPO TA Cloning Kit фирмы Invitrogen. Клетки E.coli DH5 трансформировали продуктами лигазной реакции с помощью набора TransformAid (Fermentas).

Вставки полученных плазмид секвенировали с помощью набора фир мы Медиген (Новосибирск) и в фирме Хеликс (С.Петербург). В резуль тате секвенирования получили несколько дексятков нуклеотидных по следовательностей, из которых для дальнейшей работы выбрали после довательности aurp1, aurp52, aurp54 и aurp7.

Выделение тотальной ДНК A. aurita. Препарированные гонады по ловозрелых самцов A. aurita резорбировали множественным иссечени ем и встряхиванием. Для получения суспензии сперматозоидов резор бированную массу фильтровали через мельничный газ. Сперматозоиды осаждали центрифугированием 10 мин при 8000 g. Осадок ресуспенди ровали в 50 мл CMFSS (0.3 М NaCl, 20 mM KCI, 15 mM EDTA, 10 50 мМ Tris-HCl pH 7.6) и повторно центрифугировали 10 мин при g. Из промытого осадка сперматозоидов выделяли ДНК в системе фе нол:хлороформ (1:1) и осаждали этанолом (Sambrook et al., 1989).

ПЦР на тотальной ДНК A. aurita. Реакционные смеси, каждая объемом 30 мкл, содержали стандартный Taq-буфер, а также 1.5 мМ MgC12, 0.02 мМ каждого dNTP, 2 ед Taq и 15 пМ каждого из двух прай меров к секвенированым фрагментам. Реакции проводили по программе 95oC 30 сек, 55-59oC (в зависимости от температуры плавления прайме ров) 30 сек, 72o C 30 сек, 30 циклов. Использовали пары праймеров:

К фрагменту aurp1 5’-TGCGGATGAATCAGATGCTGT-3’ и 5’ GCGAATATGCGAAGGCTGAA-3’;

к фрагменту aurp52 5’-CAAACACGGTCTAGGAATGTTAAT-3’ и 5’ TTCACCTCATTAAAAATCACTGCT-3’;

к фрагменту aurp54 5’-TTTGTCTGAAATTTGCCACAGC-3’ и 5’ TCAAGGCCAAGGCAGTCAAG-3’;

к фрагменту aurp7 5’-TTCTCTGCATTATGGCAACCAAA-3’ и 5’ GGATGATATAGGTGTTGGCACAG-3’.

Обратнотранскриптазная ПЦР (ОТПЦР). Обратную транскрип цию производили, как описано ранее. Реакционные смеси для ПЦР объ емом 30 мкл содержали стандартный Taq-буфер, dNTP, Taq и праймеры в количествах, описанных для ПЦР на тотальной ДНК A. aurita. Ре акционные смеси также содержали 1 мкл продуктов ОТ, разведенных в четыре раза. Реакции проводили по программе описанной выше для ПЦР на тотальной ДНК A. aurita.

Электрофорез продуктов ПЦР и ОТПЦР. Продукты ПЦР и ОТП ЦР разделяли электрофорезом в 1%-ном агарозном геле, содержащем 5 мкг/мл бромистого этидия в ТАЕ буфере, и фотографировали в УФ свете (Sambrook et al., 1989).

Приготовление проб мезоглеина для MALDI (Pappin et al., 1993) и белкового секвенирования по Эдману (Edman degradation). Гомогенат мезоглеи разделяли методом диск электрофореза в 7%-ном полиакриламидном геле в присутствии додецилсульфата натрия (Laemmli, 1970). Из геля вырезали зону, соответствующую 45/47 кДа, и использовали этот фрагмент геля для MALDI и белкового секвенирования.

MALDI анализ был проведен фирмой ПИННИ (Москва). Белко вое секвенирование было проведено Protein Resource Center of The Rockefeller University (USA).

Кислый-мочевинный электрофорез проводился, как описано в публикациях (Panyim, Chalkley, 1969;

Podgornaya, Shaposhikova, 1998).

Клонирование мРНК мезоглеина. Для клонирования мРНК ме зоглеина использовали протокол, основанный на опубликованном (Matz et al., 1999).

Синтез кДНК. Для удаления ДНК из проб тотальной РНК пробы обрабатывали ДНКазой (RNAse free DNAse;

Roche). ДНКа зу удаляли фенол-хлороформом. Для обратной транскрипции ис пользовали около 1 мкг тотальной РНК, праймер m13rt12v (5’ CAGGAAACAGCTATGACaagcttttttttttttv), специфический к поли-А последовательности мРНК, с адаптерной последовательностью и обрат ную транскриптазу SuperScriptII (Invitrogen). Реакцию проводили при условиях рекомендованных производителями обратной транскриптазы.

Продукты обратной транскрипции разводили в 5 раз и хранили при 20oC.

3’ Rapid Amplication of cDNA Ends (3’RACE ПЦР) с вы рожденными праймерами проводили с помощью двух последователь ных ПЦР реакций. В реакциях использовали гнездовые (nested) прай меры, специфические к пептиду YTFIENR праймеры (DGSP1, DGSP2) и STEP-OUT (Matz et al., 1999) праймеры (m13r-heel, heel), специфи ческие к адаптерной последовательности праймера, использовавшегося для обратной транскрипции.

Нуклеотидную последовательность частично вырожденных гнездо вых праймеров, специфических к пептиду, генерировали с помощью программы CodeHope (Rose et al., 2003). К 5’ концу генерированных CodeHope последовательностей добавили короткие произвольные по следовательности, чтобы получить праймеры, имеющие температуру плавления около 60o C.

Первая 3’RACE ПЦР реакция содержала 1 мкл кДНК, праймеры DGSP1 (5’-accggataatacgcTAyacntty) и STEP-OUT праймер m13r-heel (5’-gtaatacgactcactatagggccaggaaacagctatgac), Taq буфер (Fermentas), ед. Taq (Хеликон, Москва), 0.2 мМ каждого dNTP и 1.5 мМ MgCl2. ПЦР проводили по программе, состоящей из одного цикла с температурой от жига 45oC, 10 циклов touchdown ПЦР (Don et al., 1991) с температурой отжига, снижающейся с 70oC до 60oC, и 20 циклов с температурой от жига 60oC.

Вторая 3’RACE ПЦР реакция содержала 1 мкл продукта пер вой реакции, разведенного в 100 раз, праймеры DGSP2 (5’ aagaggccacaTATACATTTathgaraaymg) и STEP-OUT праймер heel (5’ gtaatacgactcactatagggc), остальные компоненты смеси - как в первой 3’RACE ПЦР реакции. ПЦР проводили по программе, состоящей из од ного цикла с температурой отжига 55oC, 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 70o C до 60oC, и 25 циклов с тем пературой отжига 60o C.

Полученный ПЦР продукт лигировали в вектор pCRII с помощью на бора TOPO TA (Invitrogen). Лигазной смесью трансформировали E.coli линии DH5, как описано выше. Вставки выделенных из бактерий плаз мид секвенировали в фирмах Омникс (С.Петербург), Силекс (Москва), ПИННИ (Москва).

Полученную в результате секвенирования нуклеотидную последо вательность использовали для конструирования последовательностей трех гнездовых праймеров для 5’RACE ПЦР.

5’RACE ПЦР. 3’ конец ранее полученной кДНК полиаденилиро вали с помощью фермента TdT (Fermentas) в соответствии с рекомен дациями производителя фермента. 5’RACE ПЦР проводили в с помо щью трех последовательных ПЦР реакций, использующих гнездовые (nested), специфические к полученному в результате 3’RACE фраг менту нуклеотидной последовательности кДНК мезоглеина праймеры (5GSP1, 5GSP2, 5GSP3) и STEP-OUT праймеры (m13rt12v, m13r-heel, heel), специфические к олиго(дА) последовательности, добавленной к 3’ концу кДНК.

Первая 5’RACE ПЦР реакция содержала полиаденилированую кД НК, праймеры 5GSP1 (5’-tcantttcgcttcgattgggt) и m13rt12v, Taq буфер (Fermentas), смесь Taq (Хеликон, Москва):Vent (NEB) 20:1, 0.2 мМ каж дого dNTP и 1.5 мМ MgCl2. ПЦР проводили по программе, состоящей из одного цикла с температурой отжига 38oC, и повторенных 2 раза циклов touchdown ПЦР с температурой отжига, снижающейся с 60oC до 50oC.

Вторая 5’RACE ПЦР реакция содержала 1 мкл продукта первой реакции, разведенного в 100 раз, праймеры 5GSP2 (5’ gcgttggagtanctgctgtctg) и m13r-heel, остальные компоненты смеси, как в первой 5’RACE ПЦР реакции. ПЦР проводили по програм ме, состоящей из повторенных 2 раза 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 62o C до 52oC.

Третья 5’RACE ПЦР реакция содержала 1 мкл продукта второй ре акции, разведенного в 100 раз, праймеры 5GSP3 (5’-actggaatgcgccaaatcc) и heel, остальные компоненты смеси, как в первой 5’RACE ПЦР реак ции. ПЦР проводили по программе, состоящей из повторенных два раза 10 циклов touchdown ПЦР с температурой отжига, снижающейся с 62o C до 52o C и 3 циклов с температурой отжига 57oC.

Полученный ПЦР продукт клонировали и секвенировали, как описа но выше.

Анализ экспрессии мезоглеина в эпидермисе, мезоглее и га стродерме методом ОТПЦР. кДНК тотальной РНК из эпидермы, гастродермы и мезоглеи, полученную как описано для Дифференци ального Дисплея, использовали как матрицу для ОТПЦР. ПЦР ре акция содержала праймеры, специфические к кДНК мезоглеина 5’ gtttccttcgcacccactcg и 5’-tggatttggcgcattccag, остальные компоненты ре акции, как описано для 3’RACE ПЦР. Реакцию проводили по програм ме, состоящей из 40 циклов с температурой отжига 57oC.

Программное обеспечение. Для конструирования частично вы рожденных праймеров на основе аминокислотной последовательности пептида использовали WWW сервис CodeHop (Rose et al., 2003). Для конструирования всех остальных праймеров использовали программу FastPCR (Kalendar, 2006).

Для вычисления молекулярной массы, теоретической кривой тит рования и pI мезоглеина по его аминокислотной последовательности использовали программы pI/Mw (Gasteiger et al., 2005), ProtParam (Gasteiger et al., 2005) EMBOSS (Rice et al., 2000).

Для предсказания сайтов O-гликозилирования использовали NetOglyc и NetNglyc (Julenius et al., 2005).

Для предсказания того, является ли мезоглеин GPI-ancored белком, использовали big-PI Predictor (Eisenhaber et al., 2000).

Для поиска известных доменов и мотивов в аминокислотной после довательности мезоглеина использовали NCBI Conserved Domain Search online service (Marchler-Bauer, Bryant, 2004) и SMART (Letunic et al., 2006).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ.

Поиск генов, дифференциально экспрессирующихся в мезо глее методом Дифференциального Дисплея. Для выявления ге нов, специфически экспрессирующихся в клетках эпидермы, мезоглеи и гастродермы, каждую особь A. aurita разделяли на 3 соответствую щие части как описано в разделе "Материалы и методы". Из каждого Рис. 1: Радиоавтограф электрофореза продук тов ДДПЦР реакций на РНК трех осо бей A. aurita (I-III) с праймерами ANK и RAPD2. Продукты ДДПЦР с РНК из клеток эпидермы (E), мезоглеи (M), га стродермы (G). Стрелками обозначены дифференциальные зоны.

препарата выделяли тотальную РНК и сравнили эти РНК при помо щи дифференциального дисплея (рис. 1). Чтобы исключить из анали за дифференциальные зоны, специфические для отдельных особей A.

aurita, ДД повторен на РНК трех особей медуз. Продукты ДДПЦР на РНК из одинаковых тканей разных медуз нанесены в соседние карма ны геля. На рис. 1 стрелками отмечены зоны, которые есть в мезоглее, но отсутствуют в эпидерме или гастродерме, и повторяющиеся в пробах РНК разных медуз. Это мезоглеальные дифференциальные зоны. Они содержат фрагменты кДНК, которые могут быть фрагментами диффе ренциально экспрессирующихся транскриптов.

Для того, чтобы добиться повторяемости наборов зон на РНК разных особей медузы и наблюдать при этом дифференциальные зоны, поста вили около 100 ДДПЦР с различными произвольными праймерами и условиями реакций. Праймеры и условия ДДПЦР, с применением кото рых получили лучший результат, описаны в разделе ДДПЦР "Матери алы и методы".

Участки геля, содержащие дифференциальные зоны (рис. 1), выре зали и использовали для реамплификации содержащихся в них фраг aurp GTGCTGCAGC CTTAGTTCAA AACAATGCGG ATGAATCAGA TGCTGTTAAT CCTTCCGTAT TAATGACTAG AATTGTTCAG CCTTCGCATA TTCGCGAAGA ATCAGAAGAT TTACACACTC CTGATACGAA TGAAATTCCT ATTGTAACTA AGAAAAACGG CAAAATATCT ACTGATCCGC ACGATCCGGA T aurp CAAACACGGT CTAGGAATGT TAATGTAAGG AAAGCTATAT CAAAGTATGA AGAATTAACT TCGTATATTA ACTTGTTTTA AGAATATGCT TTCAAACCAT ATTAGCAGTG ATTTTTAATG AGGTGAATAA TTTAATG aurp CCACAACTTT GATTCCCTTT GTCTGAAATT TGCCACAGCT TGACTGCCTT GGCCTTGATT TTGTGTCCTT CAACTTCATG aurp GTAGGAGACT AAACGGTTAT GAAGATTTTA TCGTCAGTAG GTAAGTAGAG CTAAGAGACG TAATACCGTT GGTTTTTATA CTAAGAAGAA CGGTTTGTTT TAACCGTCCC TATCAAATAT GTTCTGNAAA ACCGACACGG TTGTGGATAT AGTAGGTCAC GGTAC Рис. 2: Нуклеотидные последовательности, полученные методом ДДПЦР.

ментов ДНК. Каждая вырезанная дифференциальная зона обычно со держит смесь фрагментов ДНК одинаковой длины. ДНК, реамплифи цированая из вырезанных участков геля, была клонирована и секвени рована.

Секвенировано 10 фрагментов кДНК, полученных при помощи ДДП ЦР. При их сравнении с известными генами в базах данных GenBank и EMBL при помощи программы BLAST (Altschul et al., 1997) 4 фраг мента показали высокую степень гомологии (87-100%) с различными генами бактерий. Поскольку РНК для ДДПЦР была получена из ме дуз, пойманных в природе, и контаминация бактериальной РНК весьма вероятна, такие фрагменты были исключены из дальнейшего анализа.

Один из фрагментов на 99% гомологичен гену AY033611.1 Homo sapiens placenta immunoregulatory factor PLIF mRNA. ПЦР на матрице тотальной ДНК A. aurita с праймерами к данному фрагменту не под твердила его принадлежность медузе. При обработке тотальной РНК и при обратной транскрипции был использован ингибитор РНКазы, полу ченный из плаценты человека (Fermentas), и ОТПЦР показал наличие этого фрагмента только в препаратах кДНК, полученных с использова нием этого ингибитора. Поэтому данный фрагмент также был исключен из дальнейшего анализа.

Рис. 3: Электрофорез в 1% агарозном геле про дуктов ОТПЦР, полученных с РНК из клеток эпидермы(E), мезоглеи(M) и га стродермы(G) двух особей Aurelia aurita (I, II), с праймерми к фрагменту aurp7.

Фрагмент aurp54 (рис. 2) на 98% гомологичен с гену AF161446 Homo sapiens HSPC328. Фрагменты aurp1, aurp7, aurp52 (рис. 2) не показали достоверной гомологии с известными генами содержащимися, в базах данных GenBank и EMBL.

Для того, чтобы проверить принадлежность секвенированых фраг ментов A. aurita, провели ПЦР тотальной ДНК медузы с праймерами к этим фрагментам. Такая проверка позволила подтвердить принад лежность фрагментов aurp7, aurp52 и aurp54 медузе, но не фрагмента aurp1. ОТПЦР РНК нескольких особей A. aurita с праймерами к этому фрагменту дал продукт ожидаемого размера. На основании результатов ОТПЦР можно заключить, что aurp1 принадлежит A. aurita.

Тканеспецифичная экспрессия генов фрагментами которых являют ся последовательности aurp1, aurp7, aurp52, aurp54, была проверена ОТПЦР на РНК из клеток эпидермы, мезоглеи и гастродермы. Для это го РНК из соответствующих клеток была обработана ДНКазой и прове дена обратная транскрипция (ОТ) с праймером ANK1, комплементар ным поли-А концу иРНК. Полученная кДНК была использована для ПЦР с праймерами к секвенированым фрагментам. С помощью ОТП ЦР с праймерами к фрагментам aurp1, aurp52, aurp54 было показано, что они не тканеспецифичны.

Результат ОТПЦР с праймерами к фрагменту aurp7 представлен на рис. 3. На дорожках, содержащих продукты ОТПЦР на РНК из клеток эпидермы разных особей A. aurita (дорожки 1,4), видны зоны, представ ляющие продукты ОТПЦР. Продукты реакции на остальных дорожках отсутствуют (слабые зоны на них - праймеры). Таким образом, ОТПЦР показала, что фрагмент aurp7 специфичен для эпидермы.

Секвенировано 4 фрагмента неизвестных генов A. aurita. Из них дифференциально экспрессируется в эпидерме медузы. Генов, специ фично экспрессирующихся в Мк, с помощью метода дифференциаль ного дисплея, обнаружить не удалось.

Молекулярное клонирование мРНК мезоглеина. С помощью электрофоретического анализа белкового состава мезоглеи зрелых ме дуз A. aurita были обнаружены нескольких мажорных белков. Анти тела к одному из них, белку массой 45/47 кДа, окрашивают белковые гранулы в цитоплазме мезоглеальных клеток;

у зрелых медуз они так же окрашивают волокна в ВКМ мезоглеи и апикальную часть клеток эпидермы (Shaposhnikova et al., 2005). На основании этих данных мож но заключить, что Мк A. aurita участвуют в процессах формирования ВКМ мезоглеи, наряду с эпидермальными клетками.

Масс- спектрометрический анализ набора пептидов (MALDI), полу ченных из белка массой 45/47 кДа трипсинолизом, не позволил обна ружить в базах данных аминокислотной последовательности данного белка.

Попытка получить N-концевой фрагмент аминокислотной последо вательности интересующего белка методом белкового секвенирования по Эдману (Edman degradation) не дала результата. Возможно, N-конец белка 45/47 кДа блокирован.

Белковое секвенирование по Эдману пептидов, полученных из белка 45/47 кДа трипсинолизом, дало 4 аминокислотных последовательности (DDAQGHYTCNADE;

DSXYSNAH;

YTFIENR;

CTSGCEGNNI). Срав нение полученных последовательностей с белками в базах данных пока зало, что пептиды не принадлежат ни одному из известных белков.

Молекулярное клонирование мРНК этого белка дало нуклеотидную последовательность длиной 1421 нп. Последовательность содержит от крытую рамку считывания длиной 1249 нп и вариант сигнала полиаде нилирования (ATTAAA) на 18 нп выше поли-A последовательности на 3’конце (рис. 4).

Теоретическая транскрипция открытой рамки считывания дает ги потетический белок длиной 416 аминокислотных остатков (aa) и рас четной молекулярной массой 47223 Да (ProtParam).

Все 4 аминокислотных последовательности пептидов содержатся в последовательности гипотетического белка (рис. 4).

Сравнение последовательности гипотетического белка с последова тельностями белков содержащимися в базах данных показало, что это новый белок. Мы назвали его мезоглеин.

Нуклеотидная последовательность мРНК мезоглеина размещена в GenBank (Accession Number DQ467654). Была клонирована, также, мР НК мезоглеина, отличающаяся от приведенной на 22 нп. Она размещена в GenBank (Accession Number EF093532).

Отсутствие 5’ нетранслируемого района и отсутствие метионина на N-конце гипотетической последовательности белка указывает на то, что полученная нуклеотидная последовательность является частичной по следовательностью мРНК мезоглеина. То, что масса мезоглеина, опре деленная с помощью диск-электрофореза, близка к массе, рассчитан ной по гипотетической аминокислотной последовательности, позволяет предположить, что клонированная последовательность лишь ненамного короче полной последовательности мРНК мезоглеина.

В результате поиска известных доменов в гипотетической амино кислотной последовательности мезоглеина были обнаружены домены Delta/Serrate/Lag-2 (DSL) и Zona Pelucida (ZP), а также 3 сайта узнава ния протеазы фурин (furin), 2 возможных сайта N-гликозилирования и 1 возможный сайт O-гликозилирования. Расположение доменов и сай тов показано на рис. 4.

Домен Zona Pelucida (ZP) встречается в большом количестве различ ных экстраклеточных белков. В настоящее время известно около белков, содержащих этот домен. Функции ZP-содержащих белков раз нообразны - от структурных компонентов в оболочке яйца или в "сли зистых домиках"аппендикулярий до компонентов, передающих механи ческую нагрузку (mechanotransducers) в крыле дрозофилы, или рецеп торов у млекопитающих и других позвоночных (Jovine et al., 2005).

ZP-содержащие белки могут подвергаться посттрансляционно му расщеплению фурино-подобными эндопептидазами (furin-like endopeptidases), как это было показано для белков млекопитающих ZP и ZP3 (Litscher et al., 1999). Мезоглеин содержит три возможных сайта узнавания протеазы фурин (рис. 4): первый RRRR - перед доменом DSL (позиции 4-7 аа), второй RDSR - между DSL и ZP доменами (позиции 86-89 aa), третий RKER - ниже домена ZP (позиции 370-373 аа).

У многих ZP-содержащих белков есть трансмембранный домен, или GPI-anchor, прикрепляющий эти белки к клеточной мембране. Такие белки экскретируются после того, как фурин-подобная протеаза раз резает белок между ZP-доменом и местом крепления белка к клеточ Рис. 4: Нуклеотидная последовательность мРНК мезоглеина и его теоретическая ами нокислотная последовательность. Домен DSL отмечен пунктирным подчерки ванием. Домен ZP отмечен подчеркиванием. Предполагаемые сайты расщеп ления протеазой фурин (furin) отмечены рамкой. Пептиды, полученные мето дом белкового секвенирования по Эдману, отмечены жирным курсивом. Сайт сигнала полиаденелирования отмечен серым и рамкой. Стоп кодон обозначен звездочкой. Возможные сайты N-гликозилирования и O-гликозилирования от мечены серым.

ной мембране. У мезоглеина не обнаружено ни трансмембранного до мена, ни GPI-anchor. Известны другие ZP-содержащие белки, не имею щие трансмембранного домена и GPI-anchor, например белки семейства oikosins (Jovine et al., 2005).

Домен DSL встречается в экстраклеточных белках или в экстра клеточной части мембранных и трансмембранных белков. Этот домен необходим для активации рецепторов - членов семейства Lin-12/Notch.

Домен DSL может служить связующим звеном при олигомеризации DSL-содержащих белков, в результате которой образуется активный ли ганд, взаимодействующий с экстраклеточной частью Lin-12/Notch бел ков (Fitzgerald, Greenwald, 1995;

Yuan et al., 2001).

Белки семейства Lin-12/Notch являются трансмембранными белка ми, пересекающими клеточною мембрану один раз. Они участвуют в различных процессах, определяющих направление дифференцировки клеток у беспозвоночных и позвоночных (Kiyota, Kinoshita 2002).

Кроме мезоглеина существуют другие белки, содержащие ZP и DSL домены, например Strongylocentrotus purpuratus predicted protein UniProt Accession No. UPI0000583FF7 similar to Neurogenic locus Notch protein precursor.

Гистохимические данные (Napara et al., 1996a) позволяют предполо жить, что мезоглеин имет положительный заряд. Для того чтобы прове рить это предположение, гомогенат мезоглеи был разделен с помощью кислого электрофореза в присутствии мочевины (Panyim and Chalkley, 1969) (рис. 5). В результате такого разделения выявили 5 зон, соответ ствующих положительно заряженым белкам. С помощью иммунобло та обнаружили, что одна из полученных зон окрашивается антителами против мезоглеина.

Соответствие молекулярной массы белка, содержащегося в данной зоне массе мезоглеина, подтвердили с помощью диск-электрофореза и имуноблота (рис. 5, II).

Теоретическая кривая титрования, построенная на основании ами нокислотной последовательности, имеет изоэлектрическую точку 9.03, что поддтверждает предположение о положительном заряде мезогеина.

Сильный позитивный заряд не характерен для ZP-содержащих белков.

Только 12.5% белков этого семейства имеют теоретическую изоэлктри ческую точку выше pI 8. Средняя теоретическая изоэлектрическая точ Рис. 5: I - Кислый-мочевинный гель-электрофорез мезоглеи, окрашеный кумасси (1).

Иммуноблот электрофореза окрашенный преимунной сывороткой (2) и анти телами против мезоглеина (3). II Диск-электрофорез зон вырезанных из геля кислого-мочевинного электрофореза (1-5) и гомогената мезоглеи (6). Номера дорожек соответствуют номерам зон на I(1). Справа приведены молекулярные массы маркерных белков. III - Иммуноблот диск электрофореза, окрашенный антителами против мезоглеина. Стрелки указывают на зоны, соответствующие мезоглеину.

ка ZP-содержащих белков pI 6.3 а средняя изоэлектрическая точка ZP доменов pI 6.2.

Чтобы выяснить, при каких условиях мезоглеин экстрагируется из мезоглеи, применяли экстрагирующие растворы с различыми pH и ион ной силой. Оказлость, что мезоглеин хорошо экстрагируется при pH ни же pH 3, а ионная сила раствора почти не имеет значения.

На основании того, что изоэлектрическая точка мезоглеина сдвину та в щелочную область, можно сделать вывод, что при нейтральном pH мезоглеин заряжен положительно. Положительный заряд белка должен способствовать его хоршей растворимости, однако в ходе экспериментов по экстракции мезоглеина из мезоглеи, было показано что белок хорошо экстрагируется только при кислом pH. Эти данные позволяют предпо ложить, что мезоглеин прочно связан с ВКМ.

В результате анализа экспрессии мезоглеина в эпидерме, гастродерме и мезоглее методом ОТПЦР (рис. 6) было показано, что ПЦР продукт ожидаемого размера наблюдается только в реакциях с РНК из мезоглеи.

Есть расхождение между результатами окраски антителами и Рис. 6: Электрофорез в 1%-ном агарозном геле продуктов ОТПЦР, полученных с РНК из клеток эпидермы(E), мезоглеи(M) и гастродермы(G) двух особей Aurelia aurita, с праймерми комплиментарными мРНК мезоглеина.

ОТПЦР. При окраске антителами к мезоглеину иммуноблотов диск электрофореза мезоглеи, Мк, эпидермы и гастродермы, кроме зоны со ответствующей мезоглеину, окрашиваются также зоны 80 кДа и 120 кДа на дорожках, соответствующих Мк и эпидерме. Возможно, мезоглеин синтезируется в виде белка- предшественника, который подвергается пострансляционному расщеплению. При окраске срезов медузы анти тела к мезоглеину окрашивают Мк, волокна в ВКМ мезоглеи и клетки эпидермы. Возможно, в клетках эпидермы есть мезоглеин, но экспрес сия его гена у взрослых медуз в клетках эпидермы шла на более ран них стадиях онтогенеза. Аминокислотная последовательность мезогле ина составляет около 416 aa из них больше половины занимает домен ZP (246 aa), поэтому одно из объяснений расхождения результатов состоит в том, что, возможно, антитела узнают домен ZP других ZP содержа щих белков в клетках эпидермы. Результаты ОТПЦР представляются достовернее окраски антителами, т.к. праймеры обеспечивают большую специфичность, чем поликлональные антитела. Таким образом, мезо глеин дифференциально экспрессируется в Мк взрослых медуз.

На основании полученных данных можно предположить, что мезо глеин является структурным элементом ВКМ мезоглеи.

Поскольку показано, что ZP-содержащие белки могут выполнять роль элементов, передающих механическую нагрузку (Jovine et al., 2005), можно предположить, что мезоглеин модифицирует механиче ские свойства ВКМ мезоглеи, делая ее более прочной. Это подтвер ждается субъективным наблюдением, что тело медуз, достигших мак симальных размеров, более жесткое, чем у молодых медуз.

Наличие в мезоглеине домена DSL позволяет предположить, что ме зоглеин может направлять дифференцировку какого-то типа клеток.

Возможно DSL мезоглеина является сигналом для клеток, выселивших ся из эпителия в мезоглею, направляющим их дифференцировку в Мк.

На основании данных о том, что у взрослых медуз мезоглеин экс прессируется исключительно в Мк и эти клетки содержат крупные гранулы окрашиваемые антителами к мезогеину, можно предположить, что Мк являются специализированой группой клеток, обогащающей ВКМ мезоглеином.

ВЫВОДЫ 1. Нуклеотидная последовательность мРНК мезоглеина - мажорного белка мезоглеи A. aurita с молекулярной массой около 45/47 кДа состав ляет 1421 нуклеотидных пар.

2. Мезоглеин содержит ZP и DSL домены, а также предполагаемые сайты протеазы фурин, что характерно для экстраклеточных белков.

3. Мезоглеин дифференциально экспрессируется в мезоглеальных клетках и экскретируется во внеклеточный матрикс мезоглеи.

СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ

Матвеев И.В. 2002. Применение метода дифференциального дис плея для изучения экспрессии генов в мезоглеальных клетках медузы Aurelia aurita. Цитология. 44(9): 891.

Матвеев И.В. 2002. Применение метода дифференциального дис плея для изучения экспрессии генов в мезоглеальных клетках A. aurita.

Вестник СПбГУ. 4(27): 108-113.

Матвеев И. В. 2005. Поиск дифференциально экспрессирующихся генов в различных группах клеток медузы Aurelia aurita. Цитология.

47(5): 431-435.

Shaposhnikova T., Matveev I., Napara T., Podgornaya O. 2005.

Mesogleal cells of the jellysh Aurelia aurita are involved in the formation of mesogleal bres. Cell Biol Int. 29(11): 952-958.

Матвеев И.В. 2006. Мезоглеин - белок синтезируемый мезоглеаль ными клетками медузы Aurelia aurita. Цитология. 48: 9.

Shaposhnikova T., Matveev I., Podgornaya O. 2006. Mesoglein a mesogleal protein of the jellysh Aurelia aurita - is an early metazoan member of ZP-domain-containing protein family. 10th Evolutionary Biology Meeting at Marseilles, abstracts p.18.

ЦИТИРОВАННАЯ ЛИТЕРАТУРА Заварзин А.А. 1945. Очерки эволюционной гистологии крови и соединительной ткани. Медгиз. Москва.

Чага О.Ю, Беме К, Напара Т.О. 1996. Пролиферативная активность и рост популяции клеток мезоглеи у сцифоидной медузы Aurelia aurita. 2. Мезоглеальные клетки сцифистом. Цитология. 38(1): с.22- Altschul SF, Madden TL, Schaer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402.

Bouillon J, Coppois G, 1977. Etude comparative de la mesoglee des cnidaires. Cahiers Biol. Marine 13: 339-368.

Chapman D.M. 1974. Cnidarian histology. Coelenterate biology. Reviews and new perspectives. Eds. Muskatine L., Lenho H. Acad.

Press. NY - SF - London. pp. 1-93.

Chapman G. 1966. The structure and function of the mesoglea. Cnidaria and their evolution. ed. Rees. Symp. Soc. London. V.16.

P. 147-168.

Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162(1): 156-159.

Denton EJ, 1963. The buoyancy mechanism of sea creatures. Endeavour 22: 85-87.

Eisenhaber B., Bork P., Yuan Y., Loeer G., Eisenhaber F. 2000. Automated annotation of GPI anchor sites: case study C.elegans.

TIBS 25(7): 340-341.

Fitzgerald K., Greenwald I. 1995. Interchangeability of Caenorhabditis elegans DSL proteins and intrinsic signalling activity of their extracellular domains in vivo. Development 121:4275-4282.

Frank U, Rinkevich B. 1999. Sciphozoan jellysh’s mesoglea supports attachment, spreading and migration of anthozoans’ cells in vitro. Cell Biol. Intern. 23(4): 307-311.

Galliot B., Schmid V. 2002. Cnidarians as a Model System for Understanding Evolution and Regeneration. Int. J. Dev. Biol. 46:

39-48.

Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins M.R., Appel R.D., Bairoch A. 2005. Protein Identication and Analysis Tools on the ExPASy Server. (In) ed. John M. Walker: The Proteomics Protocols Handbook, Humana Press.

Hausman R. 1973. The mesoglea. Biology of Hydra. Eds. Burnett A. London: Acad. Press N.-Y., P.393-453.

Hyman L.H. 1940. The Inverterbrates: Protozoa through Ctenophora. Graw-Hill Book Company N.-Y.-London. 726 p.

Kalendar R. 2006. FastPCR, PCR primer design, DNA and protein tools, repeats and own database searches program.

www.biocenter.helsinki./bi/programs/fastpcr.htm Kiyota T, Kinoshita T. 2002. Cysteine-rich region of X-Serrate-1 is required for activation of Notch signaling in Xenopus primary neurogenesis. Int J Dev Biol. 46(8): 1057-1060.

Julenius K., Molgaard A., Gupta R., Brunak S. 2005. Prediction, conservation analysis and structural characterization of mammalian mucin-type O-glycosylation sites. Glycobiology, 15: 153-164.

Kleinman HK, Philp D, Homan MP, 2003. Role of the extracellular matrix in morphogenesis. Curr Opin Biotechnol 14: 526-532.

Knight D. P. 1971. Sclerotization of the Calyptoblastic hydroid Laomedea exuosa. 2. Histochemical demonstration of phenol oxidase and attempted demonstration of peroxidase. Tiss. and Cell. 3(1): 57-64.

Laemmli U.K. 1970. Cleavage of structural protein during the essambly of the head of the bacteriophage T4. Nature 4: 680-682.

Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. 2006. SMART 5: domains in the context of genomes and networks.

Nucleic Acids Res. 34(Database issue): D257-260.

Liang P., Pardee A.B. 1992. Dierential display of eukaryotic messenger RNA by means of polymerase chain reaction. Science. 257:

967-971.

Litscher E.S., Qi H., Wassarman P.M. 1999. Mouse zona pellucida glycoproteins mZP2 and mZP3 undergo carboxy-terminal proteolytic processing in growing oocytes. Biochemistry. 38: 12280-12287.

Jovine L., Costel C. Darie, Eveline S. Litscher, and Paul M. Wassarman. 2005. Zona pellucida domain proteins. Annu. Rev. Biochem.

74: 83-114.

Mackay NC. 1969. Sulphate regulation in jellysh. Comp. Biochem. Physiol. 30: 481-488.

Marchler-Bauer A, Bryant SH. 2004. CD-Search: protein domain annotations on the y. Nucleic Acids Res. 32: 327- Matz M., Shagin D., Bogdanova E., Britanova O., Lukyanov S., Diatchenko L., Chenchik A. Amplication of cDNA ends based on template-switching eect and step-out PCR. 1999. Nucleic Acids Res. 27(6): 1558-1560.

Panyim S., Chalkley R. 1969. The heterogeneity of histones. I. A quantitative analysis of calf histones in very long polyacrylamide gels. Biochemistry, 8:3972-3979.

Pappin DJ, Hojrup P, Bleasby AJ. 1993. Rapid identication of proteins by peptide-mass ngerprinting. Curr Biol 3: 327-332.

Podgornaya O.I., Shaposhikova T.G. 1998. Antibodies with the cell-type specicity to the morula cells from haemolymph of ascidian Styela rustica, Cell Structure and Function, 23: 349-355.

RH Don, PT Cox, BJ Wainwright, K Baker, and JS Mattick. 1991. Touchdown’ PCR to circumvent spurious priming during gene amplication. Nucleic Acids Res. 19: 4008.

Rose TM, Heniko JG, Heniko S. Nucleic Acids Res. 2003. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design. 31(13): 3763-3766.

Sambrook J., Fritsch E. F., Maniatis T. 1989. Molecular Cloning. A laboratory Manual (2nd Edition). New York: Cold Spring Harbor Laboratory.

Schmid V, 1992. Transdierentiation in medusae. Int Rev Cytol 142: 213-261.

Shaposhnikova T, Matveev I, Napara T, Podgornaya O. 2005. Mesogleal cells of the jellysh Aurelia aurita are involved in the formation of mesogleal bres. Cell Biol Int. 29(11): 952-958.

Singer J. 1974. Electron microscopic and autoradiographic study of mesogleal organization and collagen synthesis in sea anemone Aiplasia diaphana. Cell. Tiss. Ress. 149: 537-554.

Weber C, Schmid V, 1985. The brous system in the extracellular matrix of hydromedusae. Tissue and Cell 17: 811-822.

Werner B. 1984. Stamm Cnidaria, Neseltiere. Lehrbuch der Speziellen Zoologic. Jena. G. Verlag Fischer. Bd 1. T. 2. S.11-305.

Young J. A. 1974. The nature of tissue regeneration after wounding in the sea anemona Calliactis parasitica (Couch). Mar. biol.

Ass. U. K. 54(3): 559-617.

Yuan Z.R., Okaniwa M., Nagata I., Tazawa Y., Ito M., Kawarazaki H., Inomata Y., Okano S., Yoshida T., Kobayashi N., Kohsaka T. 2001. The DSL domain in mutant JAG1 ligand is essential for the severity of the liver defect in Alagille syndrome. Clin. Genet. 59:

330-337.



 

Похожие работы:





 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.