авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Влияние гомоцистеина на продукцию активных форм кислорода нейтрофилами крыс

МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М.В. ЛОМОНОСОВА Биологический факультет

На правах рукописи

БРЮШКОВА ЕКАТЕРИНА АЛЕКСАНДРОВНА ВЛИЯНИЕ ГОМОЦИСТЕИНА НА ПРОДУКЦИЮ АКТИВНЫХ ФОРМ КИСЛОРОДА НЕЙТРОФИЛАМИ КРЫС 03.01.04 – биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва - 2012 Диссертационная работа выполнена на кафедре биохимии биологического факультета Московского государственного университета имени М.В. Ломоносова

Научный консультант: доктор биологических наук, профессор Болдырев Александр Александрович

Официальные оппоненты: доктор биологических наук, профессор Муронец Владимир Израилевич кандидат биологических наук, профессор Пантелеев Михаил Александрович

Ведущая организация: Учреждение Российской Академии Наук Институт Биофизики Клетки РАН

Защита диссертации состоится 19 марта 2012 г. в 15 часов 30 мин на заседании диссертационного совета Д 501.001.71 при Московском государственном университете имени М.В. Ломоносова по адресу: 119991, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоноcова, Биологический факультет, Большая биологическая аудитория (ББА).

С диссертацией можно ознакомиться в библиотеке биологического факультета Московского государственного университета имени М.В. Ломоносова.

Автореферат разослан «_» февраля 2012 года

Ученый секретарь диссертационного совета, кандидат биологических наук Медведева М.В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Гомоцистеин (ГЦ) является природным метаболитом, связывающим обмен метионина и глутатиона. В норме его стационарный уровень в крови не превышает 15-20 мкМ [Seshadri et al., 2002], но в условиях нарушения метаболизма ГЦ наблюдается гипергомоцистеинемия, характеризующаяся повышением его уровня в крови до 100-500 мкМ и выше. При этом увеличение концентрации ГЦ в плазме крови может быть как причиной, так и следствием патологических состояний. Повышение стационарного уровня ГЦ в организме коррелирует с разнообразными сердечно сосудистыми и нейродегенеративными заболеваниями [Boushey et al., 1995]. ГЦ является фактором риска инфарктов и инсультов [Mangoni and Jackson, 2002], а также усиливает развитие атеросклероза [McCully et al., 1975;

Tehlivets, 2011].

Токсическую роль ГЦ в повреждении клеток нервной системы связывают с его взаимодействием с глутаматными рецепторами и явлением экзайтотоксичности, которое характеризуется повышением концентрации ионов Са2+ в цитоплазме, активацией Са2+ зависимых ферментативных каскадов и росту свободных радикалов в нейронах [Dingledine et al., 1999].

Данные о влиянии ГЦ на иммунокомпетентные клетки немногочисленны и фрагментарны. Известно, что ГЦ усиливает адгезию лейкоцитов к сосудистой стенке [Guo and Dudman, 2001], вызывает активацию, дифференциацию и апоптоз Т-лимфоцитов [Dawson et al., 2004], усиливает продукцию активных форм кислорода (АФК) в тромбоцитах [Signorello et al., 2002], стимулирует сборку и активацию NADPH-оксидазы в нейтрофилах и моноцитах [Alvarez-Maqueda et al. 2004;

Siow et al., 2006]. Эти факты свидетельствуют о том, что ГЦ направленно стимулирует цитотоксичность данных клеток, но механизм описанных явлений до конца не установлен.

Уровень активных форм кислорода и хлора в клетках крови является важной характеристикой их метаболического состояния. Его изменение служит сигнальным механизмом для запуска различных клеточных процессов, таких как дифференцировка, пролиферация, апоптоз. С другой стороны, при нарушениях работы организма несбалансированная продукция АФК становится очень опасной, причем ведущая роль в подобных патологических состояниях принадлежит нейтрофилам – единственным клеткам организма, продуцирующим в межклеточное пространство значимое количество активных форм кислорода и хлора.

В связи с вышесказанным, изучение влияния ГЦ на продукцию активных форм кислорода нейтрофилами и исследование возможных механизмов действия ГЦ является актуальной проблемой, имеющей как теоретическое, так и практическое значение для современной биохимии.

Целью данной работы явилась оценка влияния гомоцистеина на генерацию активных форм кислорода и хлора в интактных и активированных in vivo нейтрофилах.

Задачи исследования:

1. Исследовать продукцию активных форм кислорода и хлора в суспензии интактных и активированных in vivo нейтрофилов крысы в присутствии гомоцистеина методом люминол-зависимой хемилюминесценции.

2. Исследовать возможные механизмы действия гомоцистеина на нейтрофилы, находящиеся в разных функциональных состояниях.

3. Изучить возможность нерецепторного влияния ГЦ на уровень активных форм кислорода и хлора, продуцируемых нейтрофилами.

4. Выявить возможные рецепторы, участвующие в реализации эффектов ГЦ, на мембране нейтрофилов.

Установить возможность экспрессии de novo канальной NR1-субъединицы 5.

NMDA-рецептора в нейтрофилах после их активации.

Научная новизна и практическая значимость работы. В настоящей работе охарактеризовано влияние гомоцистеина - соединения, которое образуется в ходе взаимопревращения метионина и цистеина, на нейтрофилы крыс, находящиеся в разных функциональных состояниях. Обнаружено, что интактные и активированные in vivo нейтрофилы различным образом реагируют на повышенные концентраций гомоцистеина.

Показано, что для интактных клеток ГЦ выступает в роли умеренного супрессора уровня АФК. Установлено, что в пределах физиологических концентраций ГЦ ингибирует миелопероксидазу, специфический фермент азурофильных гранул нейтрофилов.

Обнаружена способность ГЦ напрямую реагировать с продуктом миелопероксидазной реакции гипохлоритом, приводящая к образованию хлораминового производного гомоцистеина.

В работе впервые установлена способность нейтрофилов экспрессировать NMDA рецепторы в результате их активации in vivo. При помощи иммунофлуоресцентного окрашивания показано связывание антител с внеклеточным доменом NR2B субъединицы NMDA-рецепторного комплекса на мембране активированных in vivo нейтрофилов. С помощью иммунопреципитации выявлены белки, соответствующие NR1 и NR2B субъединицам NMDA-рецептора. Показано участие NMDA-рецепторов в реализации эффекта ГЦ, приводящего к увеличению продукции АФК нейтрофилами, выделенными из очага острого воспаления.

Полученные результаты расширяют представления как об экспрессии NMDA рецепторов в клетках иммунной системы, так и о механизмах взаимодействия гомоцистеина с нейтрофилами в зависимости от их иммунного статуса, что существенно для понимания молекулярных механизмов токсичности гомоцистеина.

Апробация работы. Результаты работы докладывались на научных семинарах кафедры биохимии Биологического факультета МГУ имени М.В. Ломоносова, на Международной конференции студентов и аспирантов по фундаментальным наукам «Ломоносов» (Россия, Москва, 2008);

Ehrlich II World Conference on Magic Bullets (Germany, Nurnberg, 2008);

7th Int. Conference on Homocysteine Metabolism (Czech Republic Prague, 2009);

12th Int. Congress on Molecular Mechanisms of Neurological and Psychiatric Disorders (Slovakia, Martin, 2009);

the 6th European Meeting for Vascular Biology and Medicine (Poland, Krakow, 2011). Апробация работы прошла на кафедре биохимии МГУ имени М.В. Ломоносова (26 сентября 2011 г.).

Публикации. По теме диссертации опубликовано 9 печатных работ, включая статьи в журналах, входящих в список ВАК РФ, 1 статья в зарубежной монографии и тезисов научных докладов.

Структура и объем диссертации. Диссертация состоит из Введения, Обзора литературы, разделов «Материалы и методы исследования», «Результаты и их обсуждение», «Выводы» и «Список литературы».

Работа изложена на 120 страницах печатного текста, содержит 38 рисунков и 10 таблиц. Список литературы включает отечественных и зарубежных источников.

В работе используются следующие сокращения:

АФК – активные формы кислорода, ГЦ – гомоцистеин, МПО – миелопероксидаза, -МЭ – бета-меркаптоэтанол, ПЦР – полимеразная цепная реакция, РТ-ПЦР – полимеразная цепная реакция в реальном времени, ФМА – форболмиристатацетат, FITC – флуоресцеин изотиоционат, GAPDH – глицеральдегид-3-фосфат-дегидрогеназа, MK– – транс-S-метил-10,11-дигидро-5н-бензо[a,d]циклопентен-5,10-имин малеат, NMDA – N метил-D-аспартат, TBS – трис-фосфатный буфер, ZM 241385 – (4-(2-[7-амино-2-(2-фурил) [1,2,4]-триазоло[2,3-a][1,3,5]триазин- 5-ил амино]этил) фенол).

СОДЕРЖАНИЕ РАБОТЫ

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Объектом исследования явились нейтрофилы крыс, находящиеся в двух различных функциональных состояниях – в виде интактных клеток и активированных клеток, полученных из очага острого воспаления.

Выделение интактных нейтрофилов проводили из гепаринизированной крови крыс линии Wistar. Животных перед опытом усыпляли раствором хлоралгидрата, взятым из расчета 400-600 мг вещества на 1 кг веса животного, и отбирали кровь из яремных вен с помощью шприца, содержащего раствор гепарина (50 ед/мл крови). Для получения нейтрофилов кровь наслаивали на селективную среду MonoPoly («ICN Biomedicals», США), центрифугировали при 300 g, после чего собирали кольцо нейтрофилов, локализованное на границе двух сред. Собранные после выделения клетки дважды отмывали и полученный осадок ресуспендировали в среде Хенкса («ПанЭко», Россия). В случае необходимости от эритроцитов избавлялись путем ресуспендирования пробы в 0,83% NH4Cl в течение 8 мин с последующим отмыванием. Подсчет клеток проводили в камере Горяева.

Выделение активированных in vivo нейтрофилов производили после создания у животного локального очага воспаления. Воспалительный процесс осуществляли путем внутрибрюшинной инъекции крысе 2,25 мг неопсонизированного зимозана по методике Сафроновой В.Г. [Сафронова и соавт. 2001], модифицированной нами для крыс путем пропорционального увеличения объема и концентрации используемых растворов.

Через 5 ч после инъекции делали смыв клеток из брюшной полости средой Хенкса.

Полученную суспензию центрифугировали для осаждения нейтрофилов, затем осадок ресуспендировали в среде Хенкса. Подсчет клеток также проводили в камере Горяева.

Выделение гранулярных клеток мозжечка крыс. Для получения гранулярных клеток мозжечка использовали 10-дневных крыс линии Wistar. Животных декапитировали, вскрывали черепную коробку и извлекали мозжечок, который помещали в стоящую во льду чашку Петри, промывали холодным раствором Тироде (148 мM NaCl, мM KCl, 2 мM CaCl2, 1 мM MgCl2, 10 мM глюкозы, 10 мM HEPES, рН 7,4) измельчали и добавляли 2 мг/мл (400 ед. активности) раствор коллагеназы («Wako», Япония), приготовленный на растворе Тироде, для разрушения межнейронных контактов.

Инкубацию с коллагеназой проводили в течение 30 мин при 37С. После инкубации образцы трижды промывали раствором Тироде, аккуратно суспендировали при помощи пастеровской пипетки и фильтровали через тефлоновый фильтр (диаметр пор 60 мкм) для удаления остатков тканей. Подсчет клеток проводили в камере Горяева.

Функциональную активность нейтрофилов Хемилюминесцентный анализ.

оценивали по продукции АФК в присутствии хемилюминесцентного зонда люминола, окисление которого до аминофталевой кислоты сопровождается хемилюминесценцией, измеряемой при 425 нм. Клетки инкубировали 30 мин в присутствии лигандов при 37°С и постоянном перемешивании, затем к образцам добавляли люминол (1 мкМ) и регистрировали сигнал на хемилюминометре Smartlum 5773 («ИнтерОптика», Россия).

Генерацию АФК у интактных нейтрофилов стимулировали добавлением в пробу 1 мг опсонизированного зимозана (30 мг/мл), у активированных in vivo клеток регистрировали собственный уровень хемилюминесценции. В качестве контроля регистрировали хемилюминесценцию клеток, инкубированных в тех же условиях без добавления лигандов.

Влияние гомоцистеина на коммерческий препарат миелопероксидазы (МПО) исследовали двумя способами: хемилюминометрическим и спектрофотометрическим.

Первый метод основан на способности фермента катализировать реакцию образования гипохлорита в присутствии перекиси водорода и анионов хлора. Генерацию ClO регистрировали на хемилюминометре Smartlum 5773 («ИнтерОптика», Россия). В пробу, содержащую 0,1 мМ люминол, 50 мкМ H2O2 (2401мМ = 39,4) и среду Хенкса, добавляли ГЦ в диапазоне концентраций от 1 до 10 мкМ. Реакцию начинали внесением в пробу 0,05 ед.

активности миелопероксидазы («Sigma», США).

Второй метод основан на способности МПО окислять специфический субстрат о дианизидин. Измерения проводили в среде, содержащей 10 мМ калий-фосфатный буфер (pH 7,0), 50 мкМ H2O2, 0,33 мМ о-дианизидина и ГЦ в диапазоне концентраций от 10 до 500 мкМ. Реакцию начинали добавлением 0,05 ед. активности МПО. За ходом реакции следили по возрастанию оптической плотности при = 460 нм, измерения проводили на спектрофотометре Hitachi 20-200 (Япония).

Принципиальное отличие между данными способами заключается в том, что хемилюминометрический метод позволяет оценить влияние ГЦ на общее количество ClO в пробе, тогда как спектрофотометрический метод дает возможность исследовать влияние ГЦ на ферментативную активность, исключая возможность связывания гомоцистеина с гипохлоритом.

Прямое взаимодействие гомоцистеина с гипохлоритом оценивали по спектрам поглощения этих веществ и их смеси в ультрафиолетовой области (220-300 нм).

Появление продукта взаимодействия ГЦ с гипохлоритом (хлораминового производного гомоцистеина) определяли по появлению пика поглощения при 252 нм.

Проточная цитометрия. Измерения проводили на приборе FAСStar («Becton Dikinson», США), оснащенном аргоновым лазером с длиной волны возбуждения 485 нм. В каждой пробе анализировали 10 000 событий. Данные обрабатывали в программе «WinMDI 2.9».

Для идентификации некроза клетки окрашивали иодидом пропидия (PI, ex 485 нм, em 610 нм), в конечной концентрации 10 мкМ.

Для оценки интернализации рецепторов на плазматической мембране нейтрофилов использовали метод иммунофлуоресцентного окрашивания антителами к метаботропным глутаматным рецепторам I и III класса, а также к NMDA-рецепторам.

Перечень используемых антител приводится в Таблице 1.

Суспензию, содержащую 106 клеток, инкубировали 30 мин при комнатной температуре в присутствии первичных антител. После этого клетки отмывали в растворе Хенкса и окрашивали вторичными антителами, меченными флуоресцентными красителями. Инкубацию проводили в течение 40 мин в темноте, после чего клетки повторно отмывали в тех же условиях. Чтобы исключить неспецифическую флуоресценцию вторичных антител, в качестве отрицательного контроля анализировали пробы, окрашенные только вторичными антителами. В качестве положительного контроля использовали суспензию гранулярных клеток мозжечка крысы Таблица 1. Основные характеристики антител, использованных для иммунофлуоресцентного окрашивания нейтрофилов Название Изотип Производитель Титр* Первичные антитела ab51314, Abcam Inc., USA Rabbit anti-rat mGluR1 IgG 1: Rabbit anti-rat mGluR4 ab15305, Abcam Inc., USA IgG 1: Rabbit anti-rat mGluR IgG ab27190, Abcam Inc., USA 1: Rabbit anti-rat mGluR6+ IgG ab15307, Abcam Inc., USA 1: Mouse anti-rat IgM ab33760, Abcam Inc., USA 1: ( антитела к гранулоцитам) Mouse anti-rat NMDA NR2B IgG1 ab 28373, Abcam Inc., USA 1: Вторичные антитела Goat anti-rabbit, FITC-меченные IgG ab 7050, Abcam Inc., USA 1: Goat anti-mouse, FITC-меченные IgG F 0257, Sigma-Aldrich, USA 1: Goat anti-mouse, PE-меченные IgG ab5932, Abcam Inc., USA 1: * - титр антител подбирали экспериментально Идентификация белковых субъединиц NMDA-рецепторного комплекса. Для того чтобы детектировать NMDA-рецепторы (как связанные с мембраной, так и находящиеся во внутриклеточных компартментах), клетки подвергали лизису с последующей иммунопреципитацией с первичными антителами к NR1 субъединице NMDA-рецептора, иммобилизованными на протеин А-сефарозе. Иммобилизацию антител проводили согласно методике, описанной в протоколе производителя.

Нейтрофилы ресуспендировали в течение 5 мин в лизирующем буфере (20 мМ Tris HCl, pH 7,5, 150 мМ NaCl, 1 мМ Na2EDTA, 1 мМ EGTA, 1% Тритон, 2,5 мМ пирофосфат натрия, 1 мМ -глицерофосфат, 1 мМ Na3VO4, 1 мкг/мл леупептин) в присутствии 1 мМ PMSF и 4% раствора ингибиторов протеаз («Sigma-Aldrich», США) при 4°С. Затем образцы подвергали воздействию ультразвука, центрифугировали (10 мин, 13000 g) и проводили реакцию иммунопреципитации с полученным супернатантом в течение 5 ч при при 4°С и постоянном перемешивании.

Полученный комплекс промывали, ресуспендировали в буфере нанесения (200 мМ Трис-НСl, 4% DS-Na, 20% глицерол, 0,02% бромфеноловый синий, 4% -МЭ, pH 6,8) и нагревали до 90°С 5 мин, после чего очищали от протеин А-сефарозы при использовании микроцентрифужных пробирок с белковыми фильтрами (Costar Spin-X (диаметр пор 0, мкм), «Cole-Parmer», Канада).

Супернатант, содержащий исследуемый белок, подвергали электрофорезу в денатурирующих условиях по методу Лэммли с использованием 4,5% концентрирующего и 10% разделяющего полиакриламидных гелей. После окончания электрофореза белки переносили на нитроцеллюлозную мембрану с помощью Вестерн блоттинга, контролируя процесс переноса белков с помощью предокрашенных маркеров («Fermentas», Канада).

Нитроцеллюлозные мембраны блокировали от неспецифического связывания с антителами 10% раствором сухого молока и инкубировали с первичными антителами к NR1 или NR2B субъединицам NMDA-рецептора («Abcam Inc.», США) в течение 1 ч.

Затем мембраны отмывали буфером TBS/T (TBS + 0,1% Твин-20) от несвязавшихся антител и окрашивали вторичными антителами, конъюгированными с пероксидазой хрена («Sigma-Aldrich», США) в тех же условиях. После окончания инкубации мембраны несколько раз промывали TBS/T и проводили идентификацию NR1 (NR2В) субъединицы методом усиленной хемилюминесценции (ECL). В темной комнате при свете красного фонаря на поверхность мембраны наносили состав, содержащий субстрат для пероксидазной реакции («Thermo Scientific», США), накрывали рентгеновской пленкой («Sigma-Aldrich», США) и помещали в кассету для авторадиографии на 10 мин. После этого пленку помещали в раствор проявителя до появления четких полос, промывали водой и обрабатывали фиксирующим раствором.

(ПЦР) Дизайн праймеров и зондов для полимеразной цепной реакции проводили на основании последовательностей, имеющихся в публичных базах данных (GeneBank) с использованием программы «Oligо Master». Специфичность выбираемых праймеров и зондов дополнительно проверяли при помощи программы Blast (сервер NCBI). Оценку температуры отжига проводили с использованием программы «Perl Primer».

Реакцию обратной транскрипции проводили с использованием комплементарного поли(А) участку на 3’-конце мРНК праймера (TGCCCAATGATACAATGAGAC(T)14), содержащего случайную адапторную последовательность. Это позволяет создать библиотеку кДНК с высокой степенью представленности фракции матричных РНК, 3’ конец которых оказывается полиаденилированным. Для ПЦР в качестве обратного праймера использовали эту же адапторную последовательность (без поли(Т)).

Использование адапторного праймера позволяет гарантировать получение продукта ПЦР с кДНК, а не с геномной ДНК.

и обратная транскрипция. Для получения тотальной РНК Выделение РНК 5 106 клеток, лизировали в растворе TRIzol суспензию нейтрофилов, содержащую («Invitrogen», США) в течение 5 мин, а затем проводили фенол-хлороформную экстракцию нуклеиновых кислот. Для удаления примесей ДНК использовали кит, содержащий ДНКазу I («Promega», США), все необходимые реакции проводили по указанной в протоколе производителя методике в присутствии 20 ед. активности ингибитора РНКаз RiboLock («Fermentas», США).

Для разрушения вторичной структуры РНК и эффективного отжига праймеров полученный образец тотальной РНК (10 мкл, 1 мкг/мкл) инкубировали 5 мин при 65°С в присутствии 25 пкмоль полиТ-праймера с адапторной последовательностью. Затем образец охлаждали и добавляли к 10 мкл реакционной смеси для обратной транскрипции (реактивы «Синтол», Россия), содержащей 10 ед. активности RiboLock, 200 ед. активности фермента M-MLV-ревертазы, 1 мM смеси дезоксинуклеозидтрифосфатов и реакционный буфер для M-MLV-ревертазы (50 мМ Трис-HCl pH 8,3, 50 мМ KCl, 4 мМ MgCl2, 10 мМ DDT). В качестве отрицательного контроля (ОТ–) использовали образцы, содержащие вместо M-MLV-ревертазы (обратной транскриптазы) соответствующее количество воды.

Реакцию обратной транскрипции проводили в амплификаторе «Терцик» (ДНК Технология, Россия) при 42°С в течение 60 мин, после чего смесь инкубировали 10 мин при 70°С для остановки реакции.

Проведение полимеразной цепной реакции в реальном времени (РТ-ПЦР).

Для проведения РТ-ПЦР использовали набор реактивов фирмы «Синтол» (Россия).

Реакционная смесь объемом 20 мкл, содержала 3 мкл матрицы (кДНК, пробы «РТ-ОТ+»), 1 ед. активности Taq-полимеразы, 0,5 мкM прямого и обратного праймеров, 0,2 мM дезоксинуклеозид-трифосфатов, 0,5 мкM флуоресцентный зонд (R6G, макс флуоресценции 550 нм), 3 мM MgCl2, и 2 мкл 10х ПЦР-буфера. В качестве праймеров использовали праймер к консервативной последовательности гена NR1-субъединицы NMDA-рецептора и праймер, содержащий адапторную последовательность, а также стандартную пару праймеров («Синтол», Россия) к гену глицеральдегид-3-фосфат дегидрогеназы (GAPDH) в качестве положительного контроля (пробы «РТ+»).

Амплификацию проб проводили в амплификаторе MJ Mini («BioRad», Германия). От рицательным контролем служили пробы, в которые в качестве матрицы вносили продукт обратной транскрипции ОТ– образцов (пробы «РТ-ОТ–») и пробы, содержащие вместо матрицы соответствующий объем воды (пробы «РТ–»).

РТ-ПЦР проводили в следующем режиме: исходная денатурация матрицы – 3 мин при 94°С;

денатурация – 94°С, 30 сек;

отжиг праймеров – 55°С, 30 сек;

элонгация – 72°С, 60 сек. Реакцию проводили в течение 36 циклов. За ходом реакции следили с помощью программы «Opticon Monitor» (MJ MiniOpticon Software).

Статистическая обработка результатов. Измерения проводили не менее чем в параллельных пробах для каждого опыта. Между собой сопоставляли результаты, полученные не менее чем для 3 различных животных. Итоговые результаты количественных измерений представлены в виде «среднее значение ± средняя ошибка».

Статистическую обработку данных внутри одного эксперимента проводили с использованием критерия значимости Y 0,1, а при обработке серии экспериментов использовали t критерий Стьюдента для независимых выборок. Достоверными считали различия при которых Р 0,05.

РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ 1. Исследование действия гомоцистеина на генерацию активных форм кислорода интактными и активированными in vivo нейтрофилами Известно, что гомоцистеин оказывает влияние не только на нейроны, но и на клетки крови. В частности, для лейкоцитов показано усиление экспрессии CD11b/CD18, CD14 и L-селектина под влиянием ГЦ, приводящее к повреждению стенок сосудов в результате избыточной адгезии лейкоцитов [Guo and Dudman, 2002]. ГЦ вызывает также активацию и дифференциацию Т-лимфоцитов и их апоптоз [Dawson et al., 2004], препятствует высвобождению NO тромбоцитами [Mutus et al., 2001], усиливает продукцию АФК и высвобождение арахидоновой кислоты в тромбоцитах [Signorello et al., 2002]. Поскольку генерация АФК является важнейшей функцией нейтрофилов, в первую очередь мы проанализировали влияние ГЦ на этот процесс. На Рис. 1 представлены типичные кривые хемилюминесценции для интактных и активированных in vivo нейтрофилов.

V 15 30 45 60 75 90 105 120 мин Рис. 1. Типичные кривые хемилюминесценции для интактных (1) и активированных in vivo (2) нейтрофилов. Стрелкой показано добавление 1 мг опсонизированного зимозана к интактным клеткам.

На Рис. 1 видно, что активированные in vivo нейтрофилы характеризуются высоким уровнем собственной хемилюминесценции, в то время как хемилюминесценцию интактных нейтрофилов невозможно оценить без их дополнительной активации. В качестве активатора во всех экспериментах использовали зимозан А («Sigma» США), опсонизированный сывороткой крысы. Как видно на Рис. 1, собственная хемилюминесценция интактных нейтрофилов близка к нулю, но стимуляция клеток зимозаном приводит к быстрому росту хемилюминесцентного сигнала во времени. В активированных нейтрофилах подъем интенсивности хемилюминесценции происходит спонтанно. Обе кривые имеют сходную динамику развития хемилюминесцентного сигнала, который через 25-30 мин достигает максимального значения, а затем начинает постепенно снижаться.

Мы показали, что ГЦ по-разному влияет на интенсивность генерации АФК нейтрофилами крыс в зависимости от их функционального состояния. В качестве исследуемых параметров были проанализированы начальная скорость и максимальная амплитуда регистрируемого сигнала. Оба параметра менялись в присутствии ГЦ сходным образом, поэтому для количественного анализа результатов была выбрана максимальная амплитуда как наиболее воспроизводимый параметр. Полученные результаты представлены на Рис. 2.

* А Б Интенсивность хемилюминесцеции, Интенсивность хемилюминесценции, 160 140 120 % от контроля % от контроля 100 * 80 60 40 20 0 контроль ГЦ контроль ГЦ Рис. 2. Интенсивность хемилюминесценции интактных (А) и активированных in vivo (Б) нейтрофилов после 30 мин преинкубации с 500 мкМ ГЦ. Знак «*» соответствует статистически значимым отличиям от контрольного значения (Р 0,05).

На Рис. 2 видно, что ГЦ оказывает на нейтрофилы противоположно направленный эффект, зависящий от функционального состояния данных клеток. С одной стороны, ГЦ вызывает умеренное подавление «дыхательного взрыва» интактных нейтрофилов (Рис.

2А). По итогам анализа серии экспериментов было продемонстрировано подавление амплитуды хемилюминесцентного сигнала в присутствии 500 мкМ ГЦ на 35±7%.

С другой стороны, на клетки, выделенные из очага острого воспаления, ГЦ оказывает стимулирующее действие, усиливая генерацию АФК в среднем в 1,5 раза по сравнению с контролем (Рис. 2 Б).

Исходя из полученных результатов можно предположить, что подавление гомоцистеином генерации АФК нейтрофилами, выделенными из периферической крови интактных животных, является одним из механизмов регуляции уровня АФК, препятствуя избыточной продукции АФК в здоровом организме.

2. Исследование механизмов антиоксидантного эффекта ГЦ Нейтрофилы обладают двумя основными системами генерации АФК во внеклеточное пространство - это NADPH–оксидазный комплекс и миелопероксидаза, причем интенсивность генерации активных форм кислорода нейтрофилами определяется в основном активностью NADPH-оксидазы [Babior et al., 1973].

Учитывая тот факт, что снижение уровня АФК в присутствии 500 мкМ ГЦ в наших экспериментах не превышало 40% от контрольного уровня и не зависело от дальнейшего увеличения концентрации ГЦ (до 2 мМ), мы предположили, что наблюдаемый эффект связан с воздействием ГЦ на миелопероксидазную реакцию.

Для проверки нашего предположения мы проанализировали влияние ГЦ на очищенную миелопероксидазу с использованием двух различных методов:

хемилюминометрического и спектрофотометрического. В обоих случаях протекание реакции регистрируется по образованию продукта, но использование во втором методе о дианизидина, специфического субстрата миелопероксидазы [Klebanoff, 1965], позволяет избежать взаимодействия исследуемых соединений с продуктом реакции. Результаты, полученные обоими методами, приводятся на Рис. 3.

Интенсивность сигнала, % от контроля 0 20 40 60 80 ГЦ, мкМ Рис. 3. Сравнение эффектов гомоцистеина на миелопероксидазную реакцию при разных способах регистрации: 1 – хемилюминометрический способ (оценка образования гипохлорит-аниона);

2 – спектрофотометрический метод (измерение активности фермента).

На Рис. 3 видно, что в диапазоне концентраций ГЦ от 1 до 10 мкМ наблюдается уменьшение хемилюминесцентного сигнала вплоть до нуля (кривая 1), что может быть вызвано подавлением активности фермента и/или связыванием продукта реакции. Тот факт, что в этом же диапазоне концентраций имеет место слабое снижение активности непосредственно фермента (кривая 2) свидетельствует о взаимодействии ГЦ с основным продуктом миелопероксидазной реакции, гипохлоритом.

Чтобы убедиться в правильности данного предположения, мы проанализировали спектры поглощения гомоцистеина, гипохлорита натрия и смеси этих соединений (Рис. 4).

Рис. 4. Регистрация спектров поглощения гипохлорита натрия (1), ГЦ (2) и их смеси (3) в концентрации 0,42 мМ каждого.

На Рис. 4 видно, что в смеси, содержащей одновременно ГЦ и гипохлорит, наблюдается исчезновение пика 290 нм, характерного для гипохлорита. При этом появляется пик поглощения при 252 нм, что соответствует продукту взаимодействия ГЦ с гипохлоритом (хлорамину гомоцистеина). Таким образом, показано, что ГЦ не только ингибирует миелопероксидазу, но и выступает в качестве ловушки для основного продукта ее реакции, гипохлорита.

3. Исследование возможности рецепторного воздействия ГЦ на нейтрофилы Противоположно направленный эффект ГЦ на нейтрофилы, выделенные из очага острого воспаления, указывает на существенные различия в функциональном состоянии интактных и активированных in vivo клеток. С одной стороны, известно, что находящийся в кровяном русле ГЦ инициирует сборку белкового комплекса NADPH-оксидазы нейтрофилов и моноцитов [Alvarez-Maqueda et al., 2004;

Siow et al., 2006], то есть должен вызывать активацию этого фермента и клеточного ответа в целом. С другой стороны, активация иммунокомпетентных клеток в условиях in vivo может запускать экспрессию ряда белков и рецепторов.

Мы предположили, что интактные клетки могут отличаться от активированных in vivo наличием или отсутствием на мембране одного или нескольких типов рецепторов.

Хорошо известно, что в нейронах эффект ГЦ реализуется через глутаматные рецепторы [Lipton et al., 1997;

Zieminska et al., 2003;

Болдырев, 2009;

Ganapathy et al., 2011], наличие которых в последнее время показано также для клеток иммунной системы [Boldyrev et al., 2004;

Miglio et al., 2005;

Mashkina et al., 2010].

Опираясь на все эти данные, мы предположили, что в наших условиях нейтрофилы могут экспрессировать NMDA-рецепторы после активации in vivo. Хорошо известно, что сегментоядерные клетки обладают в высокой степени конденсированным хроматином и низким уровнем синтеза белка. Поэтому принципиально важным было продемонстрировать наличие в нейтрофилах мРНК как минимум для одной из субъединиц NMDA-рецептора. При помощи РТ-ПЦР мы исследовали активированные in vivo нейтрофилы на наличие мРНК для NR1 субъединицы NMDA-рецептора, но на первом этапе наших исследований мы не обнаружили экспрессии целевой мРНК ни в интактных, ни в активированных in vivo нейтрофилах. Учитывая то факт, что мРНК деградирует в среднем в течение 60 мин после синтеза, мы предположили, что экспрессия мРНК для NMDA-рецепторов может происходить в ответ на внешний стимул. Чтобы проверить наше предположение, мы дополнительно стимулировали нейтрофилы, выделенные из очага острого воспаления, инкубацией с зимозаном А и ФМА в течение 45 мин в присутствии 500 мкМ NMDA. По итогам проведенных исследований мы установили, что дополнительная активация зимозаном А нейтрофилов, выделенных из очага острого воспаления, в присутствии 500 мкМ NMDA вызывает экспрессию мРНК для NR1 (Рис. 5).

Рис. 5. Экспрессия мРНК для NR1 субъединицы NMDA рецептора, стимулированная in vitro. 1. GAPDH, (РТ–);

2. NR1, (РТ–);

3. GAPDH, (РТ+);

4. NR1, (РТ-ОТ–);

5. NR1, (РТ-ОТ+), Сt (threshold cycle) пороговый цикл реакции.

На Рис. 5 видно, что в исследуемых образцах с 18 цикла наблюдается значительное увеличение флуоресценции по сравнению с отрицательным контролем, причем уровень флуоресценции NR1-зонда (кривая 5) сопоставим с уровнем флуоресценции в положительном контроле (кривая 3). Мы видим так же, что после 34 цикла наблюдается небольшая флуоресценция «РТ-ОТ–» образца (кривая 4), что объясняется незначительным содержанием геномной ДНК в анализируемых пробах. Полученные данные подтверждают точку зрения, что экспрессия NMDA-рецепторов в нейтрофилах является индуцибельной.

Идентификация субъединиц NMDA-рецептора в активированных in vivo нейтрофилах Считается доказанным, что для формирования функционального NMDA-рецептора в нервной системе млекопитающих необходима комбинация NR1 и NR2 субъединиц, делающая возможным одновременное связывание глицина и глутамата [Laube et al., 1993;

Kuryatov et al., 1994;

Grimwood et al., 1995]. Поэтому в качестве дополнительного доказательства экспрессии NMDA-рецепторов в нейтрофилах после их активации, мы провели идентификацию NR1 и NR2B субъединиц NMDA-рецептора в интактных и активированных in vivo нейтрофилах с помощью Вестерн блоттинга. На Рис. представлены результаты взаимодействия клеточного лизата со специфическими антителами на NR1 (A) и NR2B (Б) субъединицы NMDA-рецептора с последующей идентификацией белка.

Рис. 6. Идентификация NMDA-рецепторов в А интактных и активированных in vivo нейтрофилах крыс.

1 – контроль на неспецифическое связывание протеин А-сефарозы с белками лизата;

2 – результат иммунопреципитации интактных клеток с антителами на NR1 (А) и NR2B (Б) Б субъединицы NMDA-рецептора;

3 – результат иммунопреципитации активиро ванных in vivo клеток с антителами на NR1 (А) и NR2B (Б) субъединицы NMDA-рецептора.

М – фракция микросом, положительный контроль.

После окрашивания образцов клеточного лизата антителами на соответствующие субъединицы NMDA-рецептора в активированных in vivo клетках выявляются два белка (их позиции на Рис. 6 отмечены овалами). Молекулярная масса белка, детектируемого на пленке А, лежит в районе 100 – 110 кДа, что соответствует известной из литературы молекулярной массе NR1 субъединицы NMDA-рецептора, которая находится в диапазоне от 131 кДа (гликозилированная форма) до 102 кДа в случае отсутствия гликозилирования [Reyes-Montan et al., 2006]. Аналогично, полоса детектируемая на пленке Б в районе 180 – 200 кДа, соответствует по молекулярной массе тирозин-фосфорилированной NR2B субъединице NMDA-рецептора [Lau, Huganir, 1995]. Появление ряда дополнительных полос (150-180) кДа мы объясняем частичным протеолизом образцов во время иммунопреципитации, поскольку с положительным контролем (препарат микросом мозжечка) произошли аналогичные изменения.

На Рис. 6 также видно, что в интактных нейтрофилах не выявляются белки, соответствующие исследуемым субъединицам NMDA-рецептора. Таким образом, мы заключаем, что активация нейтрофилов in vivo сопряжена с экспрессией в них NMDA рецепторов, причем эти рецепторы содержат как NR1, так и NR2B субъединицы NMDA рецепторного комплекса, что необходимо для его полноценного функционирования.

Известно, что в нейронах, экспрессирующих NMDA-рецепторы, идет кон ститутивный синтез NR1 субъединиц, которые при отсутствии необходимого количества NR2 субъединиц долгое время могут удерживаться в эндоплазматическом ретикулуме [Prybylowski, Wenthold, 2004]. Поэтому мы дополнительно определяли экспрессию белка NR2B субъединицы на клеточной поверхности нейтрофилов с помощью окрашивания клеток антителами, специфичными к внеклеточному участку этого белка (Рис. 7).

Рис. 7. Иммунофлуоресцентное окрашивание интактных (А) и активированных in vivo (Б) нейтрофилов FITC-мечеными антителами к NR2B субъединице NMDA-рецептора. В положительный контроль - окрашивание нейронов FITC-мечеными антителами к NMDA рецепторам.

На Рис. 7 видно, что после окрашивания активированных in vivo нейтрофилов специфическими антителами к внеклеточному домену NR2B субъединицы NMDA рецептора происходит смещение пика на гистограмме в область более высокой флуоресценции FITC по сравнению с контролем (Рис. 7 Б). Аналогичный результат наблюдается при окрашивании суспензии гранулярных клеток мозжечка (Рис. 7 В, положительный контроль), тогда как флуоресценция в образцах интактных нейтрофилов соизмерима с контрольной величиной (Рис. 7 А). Это свидетельствует о том, что в результате активации нейтрофилов in vivo в них происходит не только экспрессия белков NMDA-рецептора, но и интернализация их на плазматической мембране клеток.

После того, как было показано наличие на мембране активированных in vivo нейтрофилов функционально активных NMDA-рецепторов, осталось выяснить, могут ли данные рецепторы в нейтрофилах быть мишенью для действия ГЦ. Чтобы проверить эту гипотезу, мы использовали неконкурентный антагонист данных рецепторов МК- (дизоцилпин). Клетки инкубировали с 500 мкМ ГЦ в течение 30 мин при 37С отдельно и в присутствии 5 мкМ МК-801, а затем измеряли уровень АФК хемилюминометрическим методом. Полученные результаты представлены на Рис. 8.

* А Б И нтен с ивно с ть х ем илюм инес цен ции, Интенс ивнос ть х ем илюм инес ценции, * 140 % от ко нтро ля 120 % от контроля 100 * * 80 40 20 0 контроль ГЦ МК-801 ГЦ + МК- контроль ГЦ МК-801 ГЦ + МК Рис. 8. Влияние ГЦ на интенсивность хемилюминесценции интактных (А) и активированных in vivo (Б) нейтрофилов, в присутствии антагониста NMDA-рецепторов.

Интактные клетки перед измерением активировали опсонизированым зимозаном, у активированных in vivo клеток регистрировали собственную хемилюминесценцию. Знак «*» соответствует статистически значимым отличиям от контрольного значения (Р 0,05).

На Рис. 8 видно, что в случае активированных in vivo нейтрофилов действие ГЦ частично предотвращается в присутствии МК-801, в то время как в пробах, инкубированных только с МК-801, уровень АФК не отличается от контрольного.

Интересно, что преинкубация интактных нейтрофилов с МК-801 не предотвращала подав ляющего эффекта ГЦ. Таким образом, можно сделать вывод о том, что индуцируемое ГЦ усиление генерации АФК нейтрофилами, выделенными из очага острого воспаления, действительно осуществляется при участии NMDA-рецепторов.

4. Исследование других возможных путей реализации эффекта гомоцистеина Из литературы также известно, что действие гомоцистеина на лимфоциты может осуществляться не только через ионотропные, но и через метаботропные глутаматные рецепторы [Владыченская и соавт., 2006;

Zieminska et al., 2003], экспрессия которых происходит после активации данных клеток [Mashkina et al., 2007]. Исходя из полученных результатов, согласно которым эффект ГЦ предотвращался преинкубацией с МК-801 не полностью, мы предположили, что активация нейтрофилов in vivo также может сопровождаться экспрессией одного или нескольких классов метаботропных глутаматных рецепторов.

Чтобы проверить данную гипотезу, мы провели иммунофлуоресцентное окрашивание нейтрофилов, находящихся в различных функциональных состояниях (перечень использованных антител приведен в Таблице 1). Полученные данные представлены на Рис. 9.

Рис. 9. Иммунофлуоресцентное окрашивание интактных (А) и активированных in vivo (Б) С об ытия События нейтрофилов FITC-мечеными антителами к метаботропным глутаматным рецепторам I и III класса.

FITC FITC Таблица 2. Среднее значение (G mean) FITC-флуоресценции популяции нейтрофилов G mean контроль mGluR1 mGluR4 mGluR5 mGluR6+ Интактные клетки 8,4±2,5 7,8±3,2 7,7±4 8,8±2,3 8,7± Активированные клетки 14,0±4 11,0±2,6 14,0±2,5 11,2±3 12,6±4, В Таблице 2 приводятся средние значения флуоресценции популяций интактных и активированных in vivo нейтрофилов после окрашивания FITC-меченными антителами.

Поскольку в обоих случаях не наблюдается значимого смещения максимума флуоресценции относительно контроля, можно сделать вывод о том, что метаботропные глутаматные рецепторы I и III классов отсутствуют у нейтрофилов в обоих функциональных состояниях.

Говоря об участии глутаматных рецепторов в реализации действия ГЦ на нейтрофилы, нельзя забывать о том, какую роль в регуляции функциональной активности данных клеток играют аденозиновые рецепторы, все известные варианты которых обнаружены в лейкоцитах [Fortin et al., 2006]. Чтобы проверить могут ли аденозиновые рецепторы вовлекаться в индуцируемое гомоцистеином увеличение продукции АФК, мы исследовали влияние антагонистов аденозиновых рецепторов на интенсивность хемилюминесценции активированных in vivo нейтрофилов. Клетки инкубировали с мкМ ГЦ в течение 30 мин при 37С отдельно и в присутствии антагониста соответствующего рецептора, после чего измеряли продукцию АФК хемилюминометрическим методом. Оказалось, что из всех рассмотренных соединений только преинкубация клеток с ZM 241385, селективным антагонистом второго типа аденозиновых рецепторов (A2a), приводила к изменению уровня хемилюминесценции в присутствии ГЦ. Полученные результаты представлены на Рис.10.

* Интенсивность хемилюминесценции, * % от контроля контроль ГЦ ZM 241385 ГЦ + ZM Рис. 10. Влияние антагониста второго типа аденозиновых рецепторов ZM 241385 на хемилюминесценцию активированных in vivo нейтрофилов. Знак «*» соответствует статистически значимым отличиям от контрольного значения (Р 0,05).

На Рис. 10 видно, что стимулирующий эффект ГЦ частично предотвращается ингибированием аденозиновых рецепторов второго типа. На основании полученных данных можно предположить участие аденозиновых рецепторов в регуляции ГЦ индуцированного ответа клеток.

Полученные результаты согласуются с нашей гипотезой о том, что ГЦ усиливает генерацию АФК в нейтрофилах, выделенных из очага острого воспаления не только путем воздействия на NMDA-рецепторы. В реализации этого воздействия оказываются задействованы также A2a рецепторы, хотя детальный механизм обсуждаемого эффекта требует дальнейших и более подробных исследований.

ЗАКЛЮЧЕНИЕ В настоящей работе мы впервые продемонстрировали, что влияние гомоцистеина на нейтрофилы зависит от функционального состояния клеток. ГЦ, не вызывая активации интактных нейтрофилов, в значительной степени стимулирует генерацию активных форм кислорода клетками, полученными из очага воспаления, индуцированного in vivo, действуя через глутаматные рецепторы NMDA-класса, аналогично специфическому агонисту данных рецепторов, NMDA. Мы предполагаем, что данный эффект связан с активацией NADPH-оксидазы, для сборки которой, как известно из литературы, необходима активации Са2+-зависимых ферментов, таких как протеинкиназа С и тирозинкиназы [Liu et al., 1998;

Kelher et al., 2003].

С другой стороны, в отсутствие дополнительной активации иммунокомпетентных клеток, гомоцистеин выступает в роли ловушки гипохлорит-аниона, аналогично таурину или карнозину, нейтрализуя гипохлорит, продуцируемый миелопероксидазой. Мы также продемонстрировали, что ГЦ уже в физиологических концентрациях обладает способностью ингибировать миелопероксидазу, снижая уровень свободных радикалов, продуцируемых нейтрофилами при локальной активации.

Появление в активированных in vivo нейтрофилах NMDA-рецепторов, регулирующих активность этих клеток, частично объясняет цитотоксический эффект ГЦ.

В случае, когда развитие патологических процессов сопровождается накоплением таких токсических метаболитов, как ГЦ, который является аналогом глутамата, способным активировать NMDA-рецепторы, его действие может быть направлено не только на нейроны, но и на клетки иммунной системы, экспрессирующие эти рецепторы. Недавно была показана способность ГЦ стимулировать образование АФК лимфоцитами периферической крови [Владыченская и соавт., 2006, Mashkina et al., 2007]. Все эти факты свидетельствуют, что в условиях гипергомоцистеинемии, осложненной любым воспалительным процессом, может иметь место избыточная драматическая активация клеток иммунной системы.

ВЫВОДЫ 1. ГЦ оказывает противоположно направленный эффект на нейтрофилы, находящиеся в различных функциональных состояниях.

2. ГЦ подавляет дыхательный взрыв интактных нейтрофилов, выделенных из кровяного русла, путем прямого ингибирования миелопероксидазы, одновременно связывая продукт миелопероксидазной реакции, гипохлорит.

3. В нейтрофилах, полученных из очага острого воспаления, в отличие от интактных клеток, обнаружено присутствие NR1 и NR2B субъединиц NMDA-рецептора.

Метаботропные глутаматные рецепторы I и III классов отсутствуют у нейтрофилов как в интактном, так и в активированном состоянии.

4. ГЦ вызывает увеличение продукции АФК в нейтрофилах, выделенных из очага острого воспаления, посредством действия на NMDA-рецепторы.

5. Впервые показано, что нейтрофилы, выделенные из очага воспаления, обладают способностью экспрессировать NR1 субъединицу NMDA-рецептора de novo.

6. Установлено, что в реализации прооксидантного эффекта ГЦ принимают участие аденозиновые рецепторы II типа.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Е.А. Брюшкова (2008). Влияние гомоцистеина и гомоцистеиновой кислоты на генерацию активных форм кислорода нейтрофилами грызунов. Международная конференция студентов, аспирантов и молодых ученых Ломоносов-2008 (Москва, Россия), с.32.

2. А.А. Болдырев, Е.А. Владыченская, Л.В. Карпова, Е.А. Брюшкова, Е.Е.

Аккуратов, М.С. Беляев, И.С. Добротворская, О.А. Трунова (2008). Роль природных факторов в защите мозга от окислительного стресса. Международная конференция Нейрохимические механизмы формирования адаптивных и патологических состояний мозга (Санкт-Петербург, Россия), с.19.

3. L. Karpova, E. Bryushkova, A. Makhro, A. Mashkina, E. Bulygina, E. Vladychenskaya, M. Stepanova, T. Fedorova, A. Boldyrev. Toxic effect of homocysteine on nervous and immune system (2008). Abstr. of II Ehrlich World Conference on Magic Bullets (Nurenberg, Germany), p.151.

4. E. Bryushkova, E. Vladychenskaya, T. Fedorova, A. Boldyrev. Molecular mechanisms of homocysteine toxicity (2009). Abstr. of 7th Int. Conference on Homocysteine Metabolism (Prague, Czech Republic), p.60.

5. E. Bryushkova (2009). Toxic effect of homocysteine on neutrophils is mediated by NMDA-receptors. Abstr. of 12th Int. Congress on Molecular Mechanisms of Neurological and Psychiatric Disorders. (Martin, Slovakia), p.38.

6. A. Boldyrev, E. Bryushkova, A. Mashkina, E. Vladychenskaya, T. Fedorova, M.

Maximova, S. Illarioshkin (2011). Hyperhomocysteinemia as a risk factor for neuronal and immune systems. In t he book «Molecular Mechanisms of Neurological and Psychiatric Disorders». (Babusikova E., Dobrota D. and Lehotsky J., Eds.), 1, 86-101.

7. Е.А. Брюшкова, Е.А. Владыченская, М.С. Степанова, А.А. Болдырев (2011).

Влияние гомоцистеина на свойства нейтрофилов, активированных in vivo.

Биохимия, 76(4), 573–580.

8. E.A. Bryushkova, O.V. Tyulina (2011). Dual effect of homocysteine on rat neutrophils.

Abstr. of 6th European Meeting for Vascular Biology and Medicine (Krakow, Poland), p.152.

9. А.А. Болдырев, Е.А. Брюшкова, Е.А. Владыченская (2012). NMDA-рецепторы в клетках иммунной системы. Биохимия, 77(2), 160-168.

ДЛЯ ЗАМЕТОК ДЛЯ ЗАМЕТОК

 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.