авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Молекулярно-цитогенетическая характеристика прицентромерного гетерохроматина у близкородственных видов подгруппы melanogaster рода drosophila (diptera) генетика –

На правах рукописи

Усов Константин Евгеньевич МОЛЕКУЛЯРНО-ЦИТОГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА ПРИЦЕНТРОМЕРНОГО ГЕТЕРОХРОМАТИНА У БЛИЗКОРОДСТВЕННЫХ ВИДОВ ПОДГРУППЫ MELANOGASTER РОДА DROSOPHILA (DIPTERA) Генетика – 03.02.07

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Томск 2010

Работа выполнена в лаборатории эволюционной цитогенетики Научно исследовательского института биологии и биофизики Томского государственного университета, г. Томск.

Научный консультант: д-р биол. наук, профессор Стегний В.Н.

Научно-исследовательский институт биологии и биофизики Томского государственного университета, г. Томск

Официальные оппоненты: д-р биол. наук Серов О.Л.

Институт цитологии и генетики СО РАН, г. Новосибирск д-р биол. наук Демаков С.А.

Институт химической биологии и фундаментальной медицины СО РАН, г. Новосибирск Ведущее учреждение: Институт биологии развития РАН, г. Москва

Защита состоится «_»_ 201г. на утреннем заседании Диссертационного совета Д 003. 011. 01 по защите диссертаций на соискание ученой степени доктора наук в Институте цитологии и генетики СО РАН по адресу:

630090, г. Новосибирск, пр. Академика Лаврентьева, 10. Факс: (383)3331278;

e-mail:

dissov@bionet.nsc.ru.

С диссертацией можно ознакомиться в библиотеке Института цитологии и генетики СО РАН.

Автореферат разослан «_» _ 201г.

Ученый секретарь Диссертационного совета, доктор биологических наук Т. М. Хлебодарова ВВЕДЕНИЕ Актуальность работы. Хроматин определяют как комплекс геномной ДНК, гистоновых и негистоновых белков и РНК. Различают два типа хроматина – эухроматин и гетерохроматин. Среди целого ряда проблем, связанных с изучением гетерохроматина, наибольшее значение, в общебиологическом смысле, представляют проблемы, затрагивающие эволюционную роль гетерохроматина, его возможное участие в процессах видообразования. Гетерохроматин обладает высокой эволюционной лабильностью, как на цитогенетическом, так и на молекулярном уровне. На основе этого выдвинуто предположение о возможной роли реорганизации гетерохроматина при видообразовании. Видообразование может происходить за счет изменения количества, структуры гетерохроматина, а также перераспределения его по хромосомам (Корочкин, 1983;

Кикнадзе и др., 1991;

Стегний, 1991;

Hennig, 1999;

Корочкин, 2002). Поэтому в данном контексте является актуальным изучение гетерохроматина у филогенетически близких видов.

Удобным объектом для этой цели являются виды Drosophila подгруппы melanogaster. Эта подгруппа включает два комплекса: комплекс «melanogaster» (D.

melanogaster, D. simulans, D. sechellia, D. mauritiana) и комплекс «yakuba» (D. orena, D. erecta, D. teissieri, D. yakuba, D. santomea) (Ashburner, 1989;

Lachaise et al., 2000).

Для многих видов данной подгруппы (D. melanogaster, D. simulans, D.

sechellia, D. erecta, D. yakuba) полностью или частично известна нуклеотидная последовательность ДНК эухроматина (Clark et al., 2007). Наиболее полные данные о последовательностях ДНК эухроматина и гетерохроматина к настоящему моменту опубликованы только для D. melanogaster (Clark et al., 2007). Размер генома D. orena больше чем у остальных видов подгруппы, в основном за счет повышенного содержания повторенной ДНК гетерохроматина (Boulesteix et al., 2006) и данные о последовательностях генома этого вида практически отсутствуют в литературе.

Известно, что гетерохроматин в ядрах трофоцитов яичников Drosophila представлен в большей степени, чем в ядрах клеток слюнных желез (Mal'ceva, Zhimulev, 1993). В связи с этим, изучение состава ДНК хромоцентра трофоцитов D. orena может дать общее представление об организации последовательностей ДНК гетерохроматина у этого вида.

В 1979 г. был выявлен новый видоспецифичный признак – пространственная организация политенных хромосом в ядрах клеток генеративной системы малярийных комаров (Стегний, 1979). Обнаруженный феномен реорганизации архитектуры интерфазного ядра в клетках генеративной системы, которая, вероятно, происходит при видообразовании, был назван системной мутацией (Стегний, 1993). Подобный феномен был выявлен и у близкородственных видов Drosophila (Стегний, Вассерлауф, 1994;

Вассерлауф, 2008). Так, у видов подгруппы melanogaster была выявлена следующая реорганизация хромосом в ядрах трофоцитов при видообразовании: от локального хромоцентра, характерного для анцестрального вида D. orena, к диффузному хромоцентру (D. simulans, D. sechellia, D. erecta), к независимо расположенным хромосомам (D. yakuba, D. teissieri, D.

mauritiana, D. santomea) и к прикреплению хромосом центромерными или теломерными районами к ядерной оболочке (D. melanogaster) (Стегний, Вассерлауф, 1994). Известно, что гетерохроматин определяет пространственную организацию хромосом в интерфазном ядре. При изменениях гетерохроматина связанных с его количеством, структурой и его межхромосомным перераспределением, вероятно, может происходить изменение пространственной ориентации хромосом в клетках генеративной системы. Таким образом, изучение и сравнение состава ДНК районов прицентромерного гетерохроматина политенных хромосом трофоцитов у близкородственных видов подгруппы melanogaster представляется актуальным для понимания механизмов реорганизации архитектуры интерфазного ядра.

Цель и задачи работы. Цель работы: охарактеризовать состав ДНК хромоцентра трофоцитов яичников D. orena и исследовать распределение последовательностей ДНК из хромоцентра на первичных политенных хромосомах трофоцитов у близкородственных видов подгруппы melanogaster рода Drosophila.

Были поставлены следующие задачи:

1. Провести микродиссекцию хромоцентра первичных политенных хромосом трофоцитов яичников D. orena и создать районоспецифичную библиотеку ДНК.

2. Осуществить клонирование в плазмидном векторе фрагментов ДНК районоспецифичной библиотеки хромоцентра первичных политенных хромосом трофоцитов яичников D. orena и определить нуклеотидную последовательность этих фрагментов.

3. Провести поиск гомологии фрагментов районоспецифичной библиотеки ДНК с известными повторяющимися и уникальными последовательностями из геномов разных видов Drosophila при помощи программ «RepeatMasker», «BLAST» и проанализировать фрагменты на наличие внутренних тандемных повторов при помощи программы «Tandem Repeats Finder».

4. Осуществить флуоресцентную in situ гибридизацию зонда на основе районоспецифичной библиотеки ДНК на первичные политенные хромосомы трофоцитов видов подгруппы melanogaster рода Drosophila.

Научная новизна работы. Впервые был изучен молекулярный состав ДНК хромоцентра трофоцитов D. orena. В результате анализа нуклеотидной последовательности клонов в составе минибиблиотеки ДНК хромоцентра D. orena были обнаружены разнообразные повторяющиеся последовательности ДНК (представители различных классов МГЭ, среди которых преобладали LTR ретротранспозоны и LINE-элементы;

минисателлиты и другие различающиеся по нуклеотидной последовательности повторы), а также последовательности, гомологичные генам.

In situ гибридизация ДНК-зонда из хромоцентра трофоцитов D. orena с первичными политенными хромосомами трофоцитов видов подгруппы melanogaster и анализ состава ДНК хромоцентра позволили установить, что хромоцентр трофоцитов D. orena и прицентромерный гетерохроматин видов данной подгруппы (D. erecta, D. teissieri, D. yakuba, D. santomea, D. simulans, D. melanogaster, D.

sechellia, D. mauritiana) содержат консервативные последовательности ДНК, среди которых преобладают разные типы повторов, но также встречаются последовательности, гомологичные генам.

Показано, что ДНК из хромоцентра D. orena консервативна в плане своего распределения преимущественно в прицентромерных районах всех хромосом у видов подгруппы melanogaster, несмотря на различия во взаимном расположении хромосом в трофоцитах у этих видов.

Показано, что у D. orena хромоцентр трофоцитов не подвергается деконденсации в ядрах с ретикулярной структурой и сохраняет свое компактное состояние, в то время когда происходит дезинтеграция всех хромосом и ядро приобретает ретикулярную (сетчатую) структуру.

Положения, выносимые на защиту. 1) Установлено, что в состав ДНК хромоцентра политенных хромосом трофоцитов D. orena входят: диспергированные повторы (представители разных классов МГЭ);

тандемные повторы;

последовательности, гомологичные генам. 2) Показано, что районоспецифичная ДНК из хромоцентра D. orena консервативна в плане своей локализации в прицентромерных районах хромосом X, 2 и 3 трофоцитов яичников всех видов подгруппы melanogaster.

Практическая значимость работы. Полученная районоспецифичная библиотека «Dore1», а также клоны минибиблиотеки ДНК из хромоцентра D. orena являются ценным материалом для проведения дальнейших исследований гетерохроматина у видов подгруппы melanogaster, и, возможно, у других видов Drosophila. Нуклеотидные последовательности клонов минибиблиотеки опубликованы в электронной базе данных «GenBank» (индексы доступа с HM594089 по HM594162).

Полученные результаты могут быть использованы при чтении лекций по ряду биологических дисциплин.

Апробация результатов работы. Результаты исследований были представлены на IV международной конференции по кариосистематике беспозвоночных животных «KARYO-IV», Санкт-Петербург (2006), на VII Межрегиональном совещании энтомологов Сибири и Дальнего Востока (в рамках Сибирской зоологической конференции) «Энтомологические исследования в Северной Азии», Новосибирск (2006), на Международной молодежной научно методической конференции «Проблемы молекулярной и клеточной биологии», Томск (2007), на Международной конференции, посвященной памяти А.А.

Прокофьевой-Бельговской, «Хромосома 2009», Новосибирск (2009), на V Съезде Вавиловского общества генетиков и селекционеров, посвященному 200-летию со дня рождения Чарльза Дарвина, «ВОГиС», Москва (2009). По теме диссертации сделано три публикации в отечественных журналах рецензируемых ВАК.

Вклад автора. Основные результаты настоящего исследования получены автором самостоятельно. Микродиссекция и DOP-ПЦР проводились совместно с д.б.н. Н.Б. Рубцовым и к.б.н. Т.В. Карамышевой (ИЦиГ СО РАН, г. Новосибирск).

Секвенирование и анализ последовательностей ДНК in silico – с к.б.н. Е.А.

Елисафенко (ИЦиГ СО РАН, г. Новосибирск) и м.н.с. Т.А. Шелковниковой (НИИ ББ ТомГУ, г. Томск).

Структура и объем работы. Диссертация состоит из списка сокращений, введения, обзора литературы, материалов и методов, результатов и обсуждения, заключения, выводов, списка использованной литературы, в который входит ссылок. Работа изложена на 119 страницах, содержит 19 рисунков и 7 таблиц.

МАТЕРИАЛЫ И МЕТОДЫ 1. Объекты исследования. В данной работе были использованы следующие виды рода Drosophila (отряд Diptera) подгруппы melanogaster: комплекс «yakuba»:

D. orena Tsacas, David и D. santomea Lachaise, Harry (любезно предоставлены F.

Lemeunier (Laboratoire Populations, Genetique et Evolution, Gif-sur-Yvette, Франция)), D. teissieri Tsacas, D. erecta Tsacas, Lachaies, D. yakuba Burla (получены из Tucson Stock Center, Аризона (США));

комплекс «melanogaster»: D. melanogaster Meigen (лабораторная линия Canton S), D. simulans Sturtevant, D. mauritiana Tsacas, David, D. sechellia Tsacas, Baechli (получены из Tucson Stock Center, Аризона (США)).

2. Приготовление препаратов политенных хромосом. Для приготовления воздушно-сухих препаратов политенных хромосом для микродиссекции и гибридизации in situ использовались яичники самок Drosophila в возрасте 1-1. суток. Яичники выделяли в 0.7 % растворе NaCl и фиксировали в растворе Карнуа (96 % этанол и ледяная уксусная кислота – 3:1). Затем яичники инкубировали в 45 %-ной уксусной кислоте в течение 5 минут, накрывали покровным стеклом и раздавливали. Все дальнейшие процедуры выполняли по стандартному протоколу (Макгрегор, 1986).

Для приготовления давленых лактоацетоорсеиновых препаратов политенных хромосом видов подгруппы melanogaster использовали яичники самок 1-1. суточного возраста, фиксированные в растворе Карнуа. Окраску политенных хромосом лактоацетоорсеином проводили по стандартной методике (Стегний, 1979). Препараты были проанализированы с помощью микроскопа Laboval 4 (Carl Zeiss, ГДР) (увеличение 10100), и были получены фотографии при помощи фотонасадки и фотокамеры Olympus.

3. Микродиссекция хромоцентра D. orena и амплификация ДНК хромоцентра. Для получения набора фрагментов ДНК из хромоцентра политенных хромосом трофоцитов яичников D. orena был использован метод микродиссекции, модифицированный для политенных хромосом (Рубцов и др., 1999).

Микродиссекцию проводили на микроскопе AXIOVERT 10, оснащенном микроманипулятором MRmot (Zeiss, ФРГ) и механическим позиционером, в стерильных условиях специально приготовленными для этого микродиссекционными иглами. Диссектированный материал переносили в коллекционную каплю (20-40 нл), помещенную в силиконизированную микропипетку. Коллекционная капля содержала 10мМ Трис НСl (рН 7.5), 10мМ NaCl, 0.1 % SDS, 30 % глицерин, 500 мкг/мл протеиназы К (Boehringer Mannheim).

По завершению сбора необходимого числа копий хромосомных районов, пипетку с диссектированным хромосомным материалом переносили в стальную коробку, помещенную в водяную баню (60 оС), на 2 часа. Амплификация диссектированного материала с частично вырожденным праймером – DOP-ПЦР проводилась, как описано ранее (Рубцов и др., 1999).

4. Клонирование фрагментов ДНК-библиотеки. Амплифицированную ДНК очищали с помощью колонки «QIA quick PCR Purification Сolumn» (QIAGEN, Германия) и встраивали в плазмидный вектор pCR®4-TOPO® (TOPO TA Cloning® Kit for Sequencing, Invitrogen, США). Полученную ДНК использовали для трансформации компетентных клеток E. coli TOP10 методом теплового шока (Маниатис и др., 1984). Выращивание клеток на селективной среде, отбор колоний, их выращивание на жидкой среде и экстракцию плазмидной ДНК выполняли по стандартным протоколам (Маниатис и др., 1984). Наличие встройки проверяли амплификацией с праймерами M13F (5'-GTAAAACGACGGCCAG-3') и М13R (5' CAGGAAACAGCTATGAC-3') и последующим электрофоретическим разделением фрагментов в 1.5 %-ном агарозном геле.

5. Секвенирование последовательностей ДНК-библиотеки. Клоны ДНК библиотеки были секвенированы с помощью BigDye Terminators v. 3.1 (Applied Biosystems, США) на автоматическом секвенаторе лаборатории эпигенетики развития Института Цитологии и Генетики СО РАН (г. Новосибирск).

6. Анализ последовательностей ДНК-библиотеки in silico. Поиск тандемных повторов внутри клонированных фрагментов ДНК-библиотеки осуществлялся при помощи программы «Tandem Repeats Finder» Program Version 4.00 (Benson, 1999). Поиск гомологии клонированных фрагментов районоспецифичной библиотеки ДНК D. orena с известными повторенными последовательностями из геномов различных видов Drosophila проводился с помощью программы «RepeatMasker» в базе данных «RepBase» (режим доступа http://repeatmasker.genome.washington.edu).

Поиск гомологии фрагментов ДНК-библиотеки D. orena с известными уникальными последовательностями из геномов различных видов Drosophila осуществлялся с помощью программы «BLAST» в базе данных «FlyBase» (Drosophila Genome Projects Blast Searches, режим доступа:

http://flybase.bio.indiana.edu).

7. Флуоресцентная in situ гибридизация. Введение метки в ДНК микродиссекционных ДНК-библиотек. ДНК метили прямым флуорохромом в циклах полимеразной цепной реакции (амплификатор фирмы Eppendorf (Mastercycler® personal), температура крышки – 105 оС). 1 мкл DOP-библиотеки добавляли к 19 мкл ПЦР-смеси: 10х ПЦР-буфер с MgCl2, 2.5мМ MgCl2, 200 мкМ дАТФ, дЦТФ, дГТФ и 100 мкМ дТТФ и 100мкМ Tamra-5'-dUTP (ЗАО БИОСАН, Россия), 2 мкМ DOP-праймера (6-MW) (5'-CCGACTCGAGNNNNNNATGTGG-3'), и 0.5 ед. Ampli Taq ДНК-полимеразы (Fermentas, Франция). ПЦР проводили в режиме: денатурация 94 оС – 1 минута;

отжиг 56 оС – 1.5 минуты;

элонгация цепей при 72 оС – 2 минуты;

с завершающей элонгацией цепей при 72 оС – 8 минут.

Флуоресцентная гибридизация in situ. Все этапы FISH проводили согласно стандартному протоколу (Lichter et al., 1990). Хромосомы окрашивали флуоресцентным красителем DAPI, растворенном в антифэйде Vectashield (Vector Laboratories, Inc., Германия). Анализ и регистрацию результатов проводили с помощью флуоресцентного микроскопа Zeiss AxioImager Z1 (Carl Zeiss, Германия), ССD-камеры AxioCam и программного обеспечения AxioVision LE Rel. 4.5.

В результате проведения FISH было проанализировано не менее 40 ядер трофоцитов для каждого вида подгруппы melanogaster.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 1. Получение районоспецифичной библиотеки ДНК хромоцентра первичных политенных хромосом трофоцитов яичников D. orena. Используя метод микродиссекции политенных хромосом (Рубцов и др., 1999) было вырезано хромоцентра с двух препаратов политенных хромосом трофоцитов яичников D.

orena. Диссектированный район представлен на рисунке 1. Затем диссектированный материал амплифицировали с помощью ПЦР с частично вырожденным праймером (DOP-ПЦР) и получили смесь фрагментов (районоспецифичную библиотеку ДНК) длиной от 200 до 1000 п. н., которой было присвоено имя «Dore1».

Рисунок 1 – Политенные хромосомы трофоцитов яичников D. orena Примечание – Рамкой выделен микродиссектированный хромоцентр;

XL, 2, 3 – политенные хромосомы.

2. Анализ состава ДНК хромоцентра первичных политенных хромосом трофоцитов D. orena. В результате клонирования в плазмидном векторе фрагментов районоспецифичной библиотеки ДНК хромоцентра политенных хромосом трофоцитов D. orena было получено 133 клона. Далее было отобрано клонов и проведено их секвенирование. Общая длина просеквенированных фрагментов составила 23940 п. н. Нуклеотидные последовательности фрагментов библиотеки были опубликованы в базе данных «GenBank» (режим доступа:

http://www.ncbi.nlm.nih.gov;

индексы доступа с HM594089 по HM594162). Затем эти фрагменты подверглись анализу при помощи различных пакетов компьютерных программ.

2.1. Анализ фрагментов библиотеки на наличие внутренних тандемных повторов. Известно, что короткие тандемные повторы являются одним из основных составляющих компонентов гетерохроматина (Plohl et al., 2008). Поэтому все фрагменты библиотеки были проанализированы на наличие тандемных повторов при помощи программы «Tandem Repeats Finder» Program Version 4.00 (Benson, 1999). В результате, внутри 4 фрагментов (1R, 6R, P36F, P97F) были найдены тандемно повторенные последовательности длиной от 14 до 38 п. н., причем фрагмент 6R содержал в себе два повтора, вложенных один в другой. Консенсусная последовательность и другие характеристики повторов представлены в таблице 1.

Таблица 1 – Тандемные повторы в составе фрагментов библиотеки ДНК «Dore1».

Название Размер Количество Консенсусная последовательность фрагмента повтора копий повтора во повтора и его фрагменте размер 6R 19 3.5 TTTTGGATTAAATTTCAAA (193 п. н.) 6R 23 3.5 AGTTTTGGATTGAAATGTCTACA P36F 38 2.1 TACGCTTTTTATGAAACAATATA (283 п. н.) GAAAAGTAGCAGAAGG P97F 14 2.2 AATATTGACTACAG (406 п. н.) 1R 22 3.5 AGTTTTGGATTGAGATGTCACA (190 п. н.) Обнаруженные в составе фрагментов библиотеки тандемные повторы относятся к минисателлитам, согласно классификации тандемных повторов приведенной в работе S. Wang с соавторами (Wang et al., 2008). В результате анализа генома D. melanogaster при помощи программы «Tandem Repeats Finder» были выявлены в довольно большом количестве различные микросателлиты, минисателлиты и сателлиты (Wang et al., 2008). В то время как в составе библиотеки D. orena, при помощи данной программы, микросателлиты и сателлиты обнаружить не удалось.

В целом, надо сказать, что тандемные повторы могут составлять огромные по протяженности участки хромосом и гетерохроматина, но, тем не менее, они были обнаружены только внутри четырех из 76 проанализированных фрагментов библиотеки ДНК «Dore1» (таблица 1). Возможно, это связано с тем, что у D. orena короткие тандемные повторы не занимают таких обширных участков гетерохроматина, как у D. melanogaster. Кроме того, гетерохроматин D. orena может содержать большое количество длинных тандемных повторов, тогда как фрагменты библиотеки относительно небольшие по размеру (в среднем 200-250 п. н.).

2.2. Анализ фрагментов библиотеки ДНК «Dore1» на наличие гомологии с известными повторенными последовательностями из геномов различных видов Drosophila. С использованием базы данных программы «Repeat Masker» была найдена гомология 36 фрагментов библиотеки с различными классами повторов (таблица 2). Среди найденных повторов: один простой повтор – (TATATG)n;

один фрагмент библиотеки имеет значимую гомологию с сателлитом (SAR) D. melanogaster;

один Т-богатый повтор низкой сложности. Большинство фрагментов библиотеки ДНК «Dore1» (33 фрагмента) показало значимую гомологию с фрагментами известных мобильных элементов из геномов других видов подгруппы melanogaster.

Среди 33 фрагментов гомологичных участкам различных МГЭ: фрагментов были гомологичны участкам LTR-ретротранспозонов, 5 – участкам LINE-элементов.

Таблица 2 – Повторы в составе ДНК хромоцентра трофоцитов D. orena.

Мобильные генетические элементы LTR-ретротранспозоны LINE ДНК-транспозоны Семейство Gypsy:

Gypsy 3_I;

Gypsy 9_I;

Семейство Jockey: Гелитроны:

Gypsy4_I Gypsy 10_I;

Gypsy_I;

G3_DM;

DNAREP1_DM;

IDEFIX_I;

DM297_I;

STALKER 4_I;

HELENA_RT Helitron1_DYak Quasimodo_I;

ZAM_I;

HMSBEAGLE_I;

TV1_I;

Семейство I:

QUASIMODO 2-I_DM I_DM Семейство Roo:

ROO_I Полинтоны:

Polinton-1_DY Семейство Copia: Семейство CR1:

Copia_I DMCR1A Cемейство Circe:

Circe Повторы Т-богатый Сателлит Простой повтор SAR_DM (TATATG)n повтор низкой сложности Для остальных показана значимая гомология с участками ДНК-транспозонов, полинтонов и гелитронов (Polintons и Helitrons) D. melanogaster и других видов:

DNAREP1_DM, Polinton-1_DY, Helitron-1_DYak.

Известно, что среди основных классов МГЭ как в эухроматине, так и в гетерохроматине D. melanogaster наиболее богато представлен класс LTR ретротранспозонов, в меньшей степени представлены LINE-элементы и менее всего ДНК-транспозоны (Kaminker et al., 2002;

Smith et al., 2007). Аналогичное соотношение классов МГЭ характерно и для библиотеки ДНК хромоцентра D.

orena.

Среди LTR-ретротранспозонов были обнаружены: gypsy (9 фрагментов), Idefix (4 фрагмента), ZAM (3 фрагмента), roo (3 фрагмента), Quasimodo ( фрагмента), Stalker 4 (2 фрагмента), HMSBeagle (1 фрагмент) copia (1 фрагмент), tv (1 фрагмент), circe (1 фрагмент). Пять фрагментов гомологичны участкам не-LTR ретротранспозонов (LINE-элементов): cr1 (2 фрагмента), G3, Helena, I (по фрагменту). Таким образом, библиотека хромоцентра D. orena содержит значительное количество различных представителей семейства Gypsy, в то время как представители других семейств МГЭ встречались в меньшей степени.

Кроме того, была найдена значимая гомология фрагмента библиотеки «Dore1» с участком одного из представителей недавно открытого подкласса ДНК транспозонов, названных полинтонами (Polintons) (Kapitonov, Jurka, 2006;

Feschotte et al., 2009): Polinton-1_DY D. yakuba. Полинтоны являются самыми сложными ДНК-транспозонами эукариот, так, например Polinton-1_DY D. yakuba имеет длину 14782 п. н.

Также была найдена значимая гомология трех фрагментов библиотеки с участками сравнительно недавно открытых транспозонов, гелитронов (Helitrons), которые даже предложили выделить в отдельный подкласс ДНК-транспозонов (Feschotte et al., 2009): DNAREP1 D. melanogaster (2 фрагмента) и Helitron-1 D.

yakuba (1 фрагмент). Присутствие элемента DNAREP1, свойственного геному D.

melanogaster, в геноме D. orena не является необычным, так как этот элемент найден в геномах многих видов Drosophila, геномы которых были частично или полностью секвенированы. Но в то же время DNAREP1 не был обнаружен за пределами отряда Diptera (Kapitonov, Jurka, 2007). Известно, что геном D.

melanogaster содержит огромное количество копий DNAREP1 – до нескольких тысяч (Kapitonov, Jurka, 2003), однако подобной обогащенности ДНК-библиотеки хромоцентра D. orena этим элементом найдено не было.

Интересно, что степень дивергенции консенсусных последовательностей элементов Polinton-1_DY и Helitron-1 D. yakuba и последовательностей, найденных у D. orena очень низка (8.7 % и 10.5 % соответственно), что, очевидно, связано с филогенетической близостью D. orena и D. yakuba.

2.3. Анализ фрагментов библиотеки ДНК хромоцентра D. orena на наличие гомологии с известными уникальными последовательностями из геномов различных видов Drosophila. Был осуществлен поиск гомологии фрагментов библиотеки D. orena с уникальными последовательностями из полностью или частично аннотированных геномов других видов Drosophila подгруппы melanogaster в базе данных «FlyBase» при помощи программы «BLAST». В результате было показано, что четыре фрагмента (P13F, P70F, P71F, P84F) имеют значимую гомологию с аннотированными генами из геномов видов подгруппы melanogaster (таблица 3).

Так как из всех видов подгруппы melanogaster полная нуклеотидная последовательность генома была определена только у D. melanogaster (Adams et al., 2000;

Clark et al., 2007), локализация генов до хромосомы (иногда до района) возможна только для этого вида. В случае других видов гомологичный фрагменту участок удавалось локализовать в лучшем случае до хромосомы, но чаще всего только до скэффолда.

Фрагмент P70F гомологичен участкам генов D. melanogaster (CG41042-RA), D. yakuba (GE22700-RA), D. erecta (GG23072-RA). Эти гены не имеют названия и занесены в базу данных под номерами. Процессы и функции, за которые отвечают эти гены, неизвестны, локализация известна только для гена D. yakuba (гетерохроматин хромосомы 3).

Фрагмент P84F обнаружил значимую гомологию (E-value=3.4e-23) с участком гена GG23098 D. erecta. Локализация в геноме и функции этого гена неизвестны.

Фрагмент Р13F гомологичен участку гена DIP1 (Disco Interacting Protein 1), локализованному у D. melanogaster в -гетерохроматине X-хромосомы (район 20A4-20A5). Было показано, что этот ген выполняет несколько функций. Так, например, продукт гена DIP1 участвует в регуляции экспрессии гена Disco.

Таблица 3 – Гомология фрагментов библиотеки ДНК «Dore1» с участками генов видов подгруппы melanogaster Название фрагмента Ген Вид E-value Локализация и его размер P13F Х-хромосома, 9.6 e- DIP1-RA D. melanogaster (468 п. н.) район 20А4-20А 4.2 e- GE20549-RA D. yakuba 2L 6.9 e- GM16518-RA D. sechellia Scaffold_ 2.8 e- GD10382-RA D. simulans 2R P71F 3.9 e- (227 п. н.) GG23178-RA D. erecta scaffold_ 2R-хромосома, 4.7 e- vlc-RA (vulcan) D. melanogaster район 41F 2.3 e- CG41042-RA D. melanogaster неизвестна 1.9 e- P70F GG23072-RA D. erecta scaffold_ (241 п. н.) гетерохроматин 5.0 e- GE22700-RA D. yakuba хромосомы P84F 3.4 e- GG23098 D. erecta scaffold_ (384 п. н.) Примечание – E-value – вероятность случайной гомологии.

В свою очередь ген Disco кодирует белок, который является фактором транскрипции (DeSousa et al., 2003). Кроме того, установлено, что белок DIP является компонентом ядерной оболочки и прочно связан с додекасателлитом из прицентромерного гетерохроматина хромосомы 3 D. melanogaster (Felice et al., 2003). Ортолог гена DIP1 был найден у A. gambiae (ENSANGG00000013542) и D.

erecta (GG17525).

Была также обнаружена значимая гомология фрагмента P71F с участками генов D. melanogaster (vulcan), D. erecta (GG23178-RA), D. simulans (GD10382-RA), D. sechellia (GM16518-RA) и D. yakuba (GE20549-RA) (таблица 3). Ген Vulcan (vlc) D. melanogaster расположен на правом плече хромосомы 2 (район 41F8) и участвует в развитии конечностей из имагинальных дисков и межклеточной сигнализации.

Особи, мутантные по этому гену, имеют деформированные конечности и гибнут на ранних стадиях развития (Gates, Thummel, 2000). Ортологи этого гена были найдены у A. gambiae (ENSANGG00000004932.3), C. elegans (W03A5), G. gallus (ENSGALG00000014796.2).

Интересно, что среди фрагментов библиотеки хромоцентра D. orena, представленных в таблице 3, наиболее высокую степень гомологии (самое низкое значение E-value) имеют фрагменты гомологичные участкам генов D. erecta. Так, гомология фрагмента P70F с геном GG23072-RA была 100 %, а в случае с геном GG23178-RA E-value была очень низкой – 3.9e-101. Этот факт вполне объясним – согласно большинству схем филогении подгруппы melanogaster, D. erecta является самым близким в филогенетическом отношении видом к D. orena (Lachaise, Cariou, David, 1988;

Cтегний, Вассерлауф, 1994;

O'Grady, Baker, Durando et al., 2001;

Thomopoulos, 2004).

3. Распределение последовательностей ДНК из хромоцентра трофоцитов D. orena на первичных политенных хромосомах трофоцитов у близкородственных видов подгруппы melanogaster. Материал «Dore1» был помечен Tamra-5'-dUTP и использован в качестве ДНК-пробы для гибридизации с политенными хромосомами трофоцитов яичников видов подгруппы melanogaster:

D. orena, D. teissieri, D. yakuba, D. santomea, D. erecta, D. melanogaster (линия Canton S), D. simulans, D. mauritiana, D. sechellia. Изучение локализации пробы на хромосомах питающих клеток яичников 9 видов подгруппы melanogaster показало следующее:

комплекс «yakuba» У D. orena последовательности, гомологичные последовательностям районоспецифичной пробы, помимо хромоцентра были обнаружены в составе проксимальных районов всех хромосомных плеч (рисунок 2, а).

Рисунок 2 – FISH ДНК-пробы из хромоцентра D. orena на политенные хромосомы трофоцитов видов комплекса «yakuba» Примечание – а – D. orena, б – D. erecta, в – D. teissieri, г – D. yakuba, д – D.

santomea;

XL, 2, 3 – политенные хромосомы;

С – центромерные районы;

Ch – хромоцентр;

стрелкой указана локализация пробы в субтеломерном районе хромосомы 3.

У D. erecta кроме прицентромерных районов последовательности хромоцентра присутствуют в субтеломерном районе хромосомы 3 (рисунок 2, б).

Степень мечения прицентромерного района хромосомы 3 значительно выше, чем на других хромосомах (рисунок 2, б). Менее всего пометился прицентромерный район Х-хромосомы (рисунок 2, б).

D. teissieri, D. yakuba, D. santomea имеют сходную морфологию хромосом трофоцитов, у всех этих видов сигнал обнаружен в прицентромерном районе Х хромосомы, в районах, прилегающих к плотным, ярко окрашивающимся DAPI блокам прицентромерного гетерохроматина хромосом 2 и 3, причем на хромосоме обнаружены два участка интенсивного мечения – с каждой стороны от блока, а на хромосоме 2 – один такой участок (рисунок 2, в, г, д). У всех трех видов в большей степени пометился прицентромерный район хромосомы 3, а в меньшей степени пометился прицентромерный район Х-хромосомы (рисунок 2, в, г, д).

комплекс «melanogaster» У D. melanogaster, D. simulans, D. mauritiana, D. sechellia последовательности хромоцентра D. orena были обнаружены в составе прицентромерных районов всех хромосом (рисунок 3, а, б, в, г). Однако наблюдались некоторые различия в локализации пробы и в степени мечения прицентромерных районов разных хромосом (рисунок 3, а, б, в, г). Так у D. simulans и D. sechellia самая высокая степень мечения характерна для хромосомы 3. Кроме того, у D. simulans сигнал не был обнаружен на одном из плеч хромосомы 2 (рисунок 3, а). У D. mauritiana степень мечения прицентромерных районов хромосом 2 и 3 не отличается друг от друга, но заметно ниже у Х-хромосомы (рисунок 3, г). У D. melanogaster в целом прицентромерные районы всех хромосом пометились в меньшей степени по сравнению с остальными видами подгруппы melanogaster.

Рисунок 3 – FISH ДНК-пробы из хромоцентра D. orena на политенные хромосомы трофоцитов видов комплекса «melanogaster» Примечание – а – D. simulans, б – D. melanogaster, в – D. sechellia, г – D.

mauritiana;

XL, 2, 3 – политенные хромосомы;

С – центромерные районы;

стрелкой указано отсутствие сигнала на одном из плеч хромосомы 2 D. simulans.

Кроме того, было изучено распределение районоспецифичной ДНК-пробы из хромоцентра D. orena в пространстве ядер с ретикулярной структурой у всех видов подгруппы melanogaster. В результате, у всех изученных видов, кроме D. orena, было отмечено диффузное распределение пробы в пространстве ядра с ретикулярной структурой (рисунок 4, а. В качестве примера приведено ядро трофоцита D. mauritiana). У D. orena в отличие от всех остальных видов в ядрах с ретикулярной структурой меченый хроматин выявлялся преимущественно в пределах локальной территории (рисунок 4, б).

Рисунок 4 – FISH ДНК-пробы из хромоцентра D. orena на хроматин ядер трофоцитов с ретикулярной структурой у видов D. mauritiana (а) и D. orena (б) Примечание – Ch – хромоцентр.

Последовательности ДНК гетерохроматина эволюционно лабильны и являются быстро изменяющейся частью генома эукариот, так как представлены главным образом тандемными и диспергированными повторами. Различия по количеству гетерохроматина, а также по его распределению на хромосомах у близкородственных видов встречаются довольно часто (Lohe, Roberts, 2000).

Размер генома у всех видов подгруппы melanogaster, за исключением D.

orena, отличается незначительно, нуклеотидные последовательности, ассоциированные с гетерохроматином, занимают около трети генома этих видов и находятся в основном в прицентромерных и теломерных районах хромосом (Schulze et al., 2006). Геном D. orena приблизительно в 1.6 раза больше по размеру, чем у всех остальных видов подгруппы, что обусловлено высоким содержанием повторенных последовательностей ДНК гетерохроматина (Boulesteix, Weiss, Biemont, 2006).

In situ гибридизация районоспецифичной ДНК-пробы на политенные хромосомы трофоцитов D. orena, D. erecta, D. teissieri, D. yakuba, D. santomea, D.

simulans, D. melanogaster, D. sechellia, D. mauritiana показала, что у D. orena она локализуется в хромоцентре и в проксимальных районах хромосомных плеч (рисунок 2, а), у остальных видов – в основном в прицентромерных районах (рисунок 2, б, в, г, д;

рисунок 3, а, б, в, г). И хотя различия по этому параметру между видами существуют (отсутствие сигнала на одном из плеч хромосомы 2 D.

simulans (рисунок 3, а) и локализация сигнала в субтеломерном районе хромосомы D. erecta (рисунок 2, б)), однако в целом они незначительны. Таким образом, полученные данные свидетельствуют о том что, межвидовые различия во взаиморасположении хромосом трофоцитов яичников незначительно отражаются на распределении пробы ДНК.

В отличие от всех остальных видов, у D. orena существует территориальность распределения пробы в ядрах трофоцитов с ретикулярной структурой (рисунок 4, б), когда хромосомы полностью декомпактизованы. Таким образом, хромоцентр D.

orena не подвергается деконденсации в ядрах с ретикулярной структурой, сохраняясь в компактизированном состоянии, в то время когда происходит дезинтеграция первичных политенных хромосом, в результате чего ядро переходит на стадию «скрытой» политении.

Необходимо отметить, что отсутствие мечения района прицентромерного гетерохроматина одного из плеч хромосомы 2 D. simulans (рисунок 3, а) говорит об отсутствии в его составе последовательностей, гомологичных последовательностям ДНК-пробы из хромоцентра D. orena, и, следовательно, о возможности формирования типичных гетерохроматиновых структур на основе совершенно разных последовательностей ДНК.

С районами интеркалярного гетерохроматина хромосом трофоцитов видов подгруппы melanogaster гибридизации районоспецифичной пробы не наблюдалось.

Однако в ходе in situ гибридизации обнаружилось, что субтеломерный район одного из плеч хромосомы 3 D. erecta содержит последовательности, гомологичные последовательностям ДНК-пробы из хромоцентра D. orena (рисунок 2, б). То есть эти результаты указывают на гетерохроматиновую природу данного субтеломерного района одного из плеч хромосомы 3 D. erecta имеющего сходство с хромоцентром D. orena на уровне состава ДНК.

Таким образом, у восьми видов подгруппы melanogaster – D. erecta, D.

teissieri, D. yakuba, D. santomea, D. simulans, D. melanogaster, D. sechellia, D.

mauritiana – прицентромерный гетерохроматин характеризуется частичным сходством состава ДНК с составом ДНК хромоцентра D. orena. Общим компонентом хромоцентра трофоцитов D. orena и прицентромерного гетерохроматина всех хромосом у видов D. erecta, D. teissieri, D. yakuba, D.

santomea, D. simulans, D. melanogaster, D. sechellia, D. mauritiana являются разнообразные повторенные последовательности ДНК, а также последовательности, гомологичные генам, фрагменты которых были клонированы, секвенированы и охарактеризованы в ходе данной работы.

В целом хромосомы X, 2 и 3 у каждого вида подгруппы melanogaster отличались по степени мечения прицентромерных районов. Причем для видов комплекса «yakuba» была выявлена следующая закономерность – в большей степени пометился прицентромерный район хромосомы 3, а в меньшей степени пометился прицентромерный район Х-хромосомы. В то время как у видов комплекса «melanogaster» подобной тенденции выявлено не было, а степень мечения прицентромерных районов хромосом значительно варьировала у разных видов данного комплекса без соблюдения какой-либо общей закономерности.

Таким образом, районы прицентромерного гетерохроматина разных хромосом у восьми видов подгруппы melanogaster содержат общие с хромоцентром трофоцитов D. orena повторяющиеся последовательности ДНК, но при этом, вероятно, отличаются между собой по их представленности.

Консерватизм распределения пробы (преимущественно в прицентромерных районах хромосом) и наличие гомологии последовательностей в геномах всех видов подгруппы melanogaster свидетельствует, вероятно, о том, что эволюционные преобразования генома, давшие начало видам данной подгруппы, не привели к кардинальному перераспределению ДНК гетерохроматина по геному. Таким образом, можно предположить, что видоспецифичность взаиморасположения хромосом в ядрах трофоцитов генеративной ткани во многом определяется количеством, составом и сочетанием повторенных последовательностей гетерохроматина, но, вероятно, не только эти характеристики гетерохроматина вносят вклад в формирование архитектуры ядра.

ЗАКЛЮЧЕНИЕ В результате настоящего исследования установлено, что локальный хромоцентр первичных политенных хромосом трофоцитов яичников D. orena имеет типичный для гетерохроматина состав ДНК – повторенные последовательности: а) Диспергированные повторы (МГЭ). Среди обнаруженных МГЭ в составе библиотеки «Dore1» преобладали представители различных семейств LTR ретротранспозонов. Также были выявлены МГЭ, которые принадлежат к группе LINE-элементов. Кроме того, были обнаружены такие представители ДНК транспозонов как гелитроны (Helitrons) и полинтоны (Polintons). Необходимо отметить, что в результате настоящей работы для генома D. orena впервые описано разнообразие МГЭ. б) Тандемные повторы. В составе библиотеки ДНК хромоцентра D. orena при помощи программы «Tandem Repeats Finder» найдено четыре минисателлита, а с помощью программы «RepeatMasker» обнаружены – сателлит (SAR), простой повтор (TATATG)n и T-богатый повтор низкой сложности.

Кроме того, четыре фрагмента библиотеки «Dore1» оказались гомологичны нескольким аннотированным генам, принадлежащим разным видам подгруппы melanogaster. Среди этих генов наиболее изученными являются DIP1 и Vulcan, которые первоначально были обнаружены в геноме D. melanogaster. Впоследствии ортологи DIP1 и Vulcan были найдены у позвоночных и беспозвоночных животных.

Показано, что у восьми видов подгруппы melanogaster – D. erecta, D. teissieri, D. yakuba, D. santomea, D. simulans, D. melanogaster, D. sechellia, D. mauritiana – прицентромерный гетерохроматин характеризуется частичным сходством состава ДНК с составом ДНК хромоцентра D. orena. Общим компонентом хромоцентра трофоцитов D. orena и прицентромерного гетерохроматина всех хромосом у видов D. erecta, D. teissieri, D. yakuba, D. santomea, D. simulans, D. melanogaster, D.

sechellia, D. mauritiana являются повторенные последовательности ДНК и последовательности, гомологичные генам.

Показано, что только у D. orena в ядрах трофоцитов с ретикулярной структурой районоспецифичная ДНК распределялась в пределах локальной территории в пространстве ядра, для остальных же видов было характерно диффузное распределение по всему ядру. Это указывает на то, что хромоцентр трофоцитов D. orena не подвергается деконденсации в ядрах с ретикулярной структурой.

Установлено, что ДНК из хромоцентра трофоцитов D. orena консервативна в плане своего распределения преимущественно в прицентромерных районах политенных хромосом трофоцитов у всех видов подгруппы melanogaster.

Существует гипотеза, согласно которой перераспределение последовательностей ДНК гетерохроматина по геному может вызвать реорганизацию архитектуры ядер клеток генеративной системы, что, вероятно, сопровождает видообразование.

Консерватизм распределения районоспецифичной ДНК (преимущественно в прицентромерных районах хромосом) и наличие гомологии последовательностей в геномах всех видов подгруппы melanogaster свидетельствует, вероятно, о том, что эволюционные преобразования генома, давшие начало видам данной подгруппы, не привели к кардинальному перераспределению ДНК гетерохроматина по геному.

Возможно, что видоспецифичность архитектуры ядер клеток генеративной системы у разных видов определяется тонкими различиями в структуре гетерохроматина.

ВЫВОДЫ 1. Показано, что хромоцентр первичных политенных хромосом трофоцитов D. orena имеет типичный для гетерохроматина состав ДНК: образован повторенными последовательностями (диспергированными повторами – представителями LTR ретротранспозонов, LINE-элементов, ДНК-транспозонов;

тандемными повторами), а также последовательностями, гомологичными генам.

2. Установлено, что существуют последовательности ДНК, общие для хромоцентра трофоцитов яичников D. orena и прицентромерных районов хромосом X, 2 и трофоцитов яичников всех видов подгруппы melanogaster и субтеломерного района хромосомы 3 D. erecta. Выяснено, что этими консервативными последовательностями являются преимущественно различные повторенные последовательности ДНК, а также последовательности, гомологичные генам.

3. Показано, что, несмотря на межвидовые различия во взаимном расположении первичных политенных хромосом трофоцитов у видов подгруппы melanogaster, распределение районоспецифичной ДНК консервативно в плане её локализации преимущественно в прицентромерных районах хромосом.

4. Обнаружено, что у D. orena в ядрах трофоцитов с ретикулярной структурой районоспецифичная ДНК-проба распределяется преимущественно в пределах локальной территории в пространстве ядра, в то время как у всех остальных видов подгруппы melanogaster проба распределяется диффузно по всему ядру. Эти данные свидетельствуют о том, что хромоцентр трофоцитов D. orena не деконденсируется в ядрах с ретикулярной структурой.

Список работ, опубликованных по теме диссертации:

1. Вассерлауф И.Э., Митренина Е.Ю., Усов К.Е., Стегний В.Н.

Сравнительный анализ динамики архитектуры хромосом и ядрышка трофоцитов яичников на протяжении эндоцикла Drosophila santomea и D. yakuba // Тезисы IV международной конференции по кариосистематике беспозвоночных животных.

Спб: Изд-во Зоологического института РАН, 2006. С. 53.

2. Усов К.Е., Вассерлауф И.Э., Стегний В.Н. Изучение взаимного расположения первичных политенных хромосом трофоцитов яичников в линиях Drosophila simulans // Энтомологические исследования в Северной Азии.

Материалы VII Межрегионального совещания энтомологов Сибири и Дальнего Востока (в рамках Сибирской зоологической конференции). Новосибирск, 2006. – 443 с.

3. Усов К.Е., Вассерлауф И.Э., Стегний В.Н. Архитектура ядер трофоцитов яичников Drosophila santomea и D. yakuba на разных стадиях эндорепликации // Вестник ТГУ. Томск: Изд-во Том. Ун-та, 2007. С. 212-216.

4. Шелковникова Т.А., Усов К.Е., Стегний В.Н. Перераспределение прицентромерного гетерохроматина у видов подгруппы Drosophila melanogaster в процессе эволюции // Проблемы молекулярной и клеточной биологии. Сборник материалов Международной молодежной научно-методической конференции 9- мая. Томск. 2007 г. С. 187-188.

5. Вассерлауф И.Э., Усов К.Е., Митренина Е. Ю., Стегний В.Н. Изучение видовых особенностей взаимного расположения первичных политенных хромосом в ядрах трофоцитов яичников у видов D. yakuba burla и D. santomea lachaise, harry подгруппы «melanogaster» рода Drosophila (Sophophora) // Вестник ТГУ (Биология) №3(4). Томск: Изд-во Том. Ун-та, 2008. С. 78-87.

6. Усов К.Е., Шелковникова Т.А., Вассерлауф И.Э., Стегний В.Н.

Молекулярно-цитогенетический анализ прицентромерного гетерохроматина хромосом трофоцитов яичников у видов подгруппы Drosophila melanogaster // Цитология. 2008. Т.50. №12. С. 1044-1049.

7. Усов К.Е., Шелковникова Т.А., Стегний В.Н. Перераспределение ДНК хромоцентра политенных хромосом трофоцитов Drosophila orena в процессе филогенеза подгруппы Drosophila melanogaster // Материалы международной конференции «Хромосома 2009». Новосибирск. 2009. С. 158.

8. Усов К.Е., Шелковникова Т.А., Вассерлауф И.Э., Стегний В.Н.

Сравнительный анализ распределения ДНК хромоцентра политенных хромосом трофоцитов яичников Drosophila orena у видов подгруппы melanogaster рода Drosophila // Материалы V съезда Вавиловского общества генетиков и селекционеров «ВОГиС». Москва. 2009. С. 268.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.