авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Метилирование днк и экспрессия генов транскрипционных факторов cbf у растений капусты brassica oleracea l. при холодовой акклимации

На правах рукописи

ФАРАФОНТОВ ДМИТРИЙ СЕРГЕЕВИЧ МЕТИЛИРОВАНИЕ ДНК И ЭКСПРЕССИЯ ГЕНОВ ТРАНСКРИПЦИОННЫХ ФАКТОРОВ CBF У РАСТЕНИЙ КАПУСТЫ BRASSICA OLERACEA L.

ПРИ ХОЛОДОВОЙ АККЛИМАЦИИ 03.01.03 – молекулярная биология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Уфа – 2013

Работа выполнена в Федеральном государственном бюджетном учреждении науки Институте биохимии и генетики Уфимского научного центра Российской академии наук Научный руководитель Гималов Фуат Рамазанович кандидат биологических наук Официальные оппоненты Вахитова Юлия Венеровна доктор биологических наук, Федеральное государственное бюджетное учреждение науки Институт биохимии и генетики Уфимского научного центра РАН зав. лабораторией молекулярной фармакологии и иммунологии Каримова Фатима Габдуллазяновна доктор биологических наук, профессор, Федеральное государственное бюджетное учреждение науки Казанский Институт биохимии и биофизики Казанского научного центра РАН зав. группой сигнальных систем Федеральное государственное бюджетное

Ведущая организация:

учреждение науки Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН

Защита диссертации состоится «_» июня 2013 г. в «» часов на заседании Диссертационного совета Д 002.133.01 при Федеральном государственном бюджетном учреждении науки Институте биохимии и генетики Уфимского научного центра РАН по адресу:

450054, Уфа, проспект Октября, д. 71. ИБГ УНЦ РАН

С диссертацией и авторефератом можно ознакомиться в Научной библиотеке Уфимского научного центра РАН по адресу: Уфа, проспект Октября, д. 71;

с электронной версией автореферата - на сайтах ВАК РФ и ИБГ УНЦ РАН:

ibg.anrb.ru e-mail: molgen@anrb.ru.

Автореферат разослан «_» 2013г.

Ученый секретарь диссертационного совета, к.б.н С.М. Бикбулатова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. Существенным фактором окружающей среды, ограничивающим географическое распространение и сроки вегетации растений, является пониженная температура. Многочисленные исследования показали, что холодостойкость – комплексный признак, проявляющийся при слаженном действии различных систем растительного организма (Guy et al., 2008). Она достигается в ходе так называемой холодовой акклимации, которая происходит при экспозиции растений при низких незамораживающих температурах. Холодовая акклимация включает активацию множественных механизмов, вносящих вклад в повышение устойчивости растения к низкотемпературному стрессу. Понижение температуры приводит к индукции экспрессии определенных генов. Многие из этих генов, наряду с холодом, индуцируются также и некоторыми другими стрессовыми воздействиями. Показано, что гены холодового ответа кодируют разнообразный набор белков, включая ферменты дыхания и метаболизма углеводов и липидов, антиоксиданты, молекулярные шапероны, антифризные белки (Thomashow, 1999;

Shinozaki, Yamaguchi-Shinozaki, 2000;

Walter et al., 2011).

Многие регулируемые холодом и дегидратацией гены в промоторных областях содержат одну или несколько копий последовательностей, обозначенных как DRE (dehydration-responsive element)/CRT (C-repeat) цис элементы. С этими цис-элементами, в составе которых имеется консенсусная последовательность A/CCGACNT, связываются транскрипционные факторы CBF1, CBF2 и CBF3 (CRT-binding factor), в результате чего транскрипция генов, регулируемых холодом или дегидратацией, значительно активируется.

Различия в устойчивости растений к низким температурам, определяемые экспрессией регулируемых холодом генов, могут быть обусловлены разным набором генов, относящихся к CBF-регулону, которых у теплолюбивых растений обнаруживается меньше, чем у растений, способных к холодовой акклимации, или отличиями в строении промоторных областей COR (cold responsive)-генов по количеству содержащихся в них CRT/DRE мотивов (Jaglo et al., 2001;

Zhang et al., 2004;

Zhang et al., 2011). Известны и другие механизмы регуляции экспрессии генов, в частности, обусловленные изменениями конформации хроматинового комплекса за счет обратимой конверсии транскрипционно активного эухроматина в транскрипционно неактивный гетерохроматин, различающиеся степенью метилирования цитозина в симметричных CG и CNG последовательностях, а так же в несимметричной CNN последовательности, степенью ацетилирования гистонов и плотностью упаковки хроматина, что меняет доступность хроматина для РНК-полимераз (Bird, 2002).

Известно, что метилирование ДНК находится под контролем различных биотических и абиотических факторов, влияющих на рост и развитие растений. Например, установлено, что внешние воздействия вызывают деметилирование целого ряда цитозинов как в промоторных областях, так и в кодирующих последовательностях генов (Sherman, Talbert, 2002;

Madlung, Comai, 2004;

Чемерис и др., 2007;

Choi, Sano, 2007;

Gonzlez et al., 2011). Что касается холодового стресса, показано, что длительное охлаждение корней сои приводило к увеличению доли гетерохроматина и уменьшению доли эухроматина (Stepinski, 2012). Также было обнаружено, что холодовая обработка проростков кукурузы сопровождается общим снижением степени метилирования ДНК (Steward et al., 2002). Однако изменения уровня метилирования отдельных генов в связи с развитием устойчивости к холодовому воздействию изучены недостаточно.

Цель и задачи исследований. Цель данной работы - выяснение механизмов регуляции экспрессии и уровня метилирования генов транскрипционных факторов CBF у растений капусты Brassica oleracea L.

при холодовой акклимации.

Для достижения намеченной цели были поставлены следующие задачи:

1. Определить нуклеотидные последовательности промоторных областей генов CBF капусты.

2. Провести сравнительный анализ нуклеотидных последовательностей промоторных областей генов CBF капусты, рапса, арабидопсиса и др.

3. Определить уровень экспрессии генов CBF закаленных и незакаленных растений в норме и при холодовом стрессе.

4. Определить характер и степень метилирования промоторных последовательностей генов CBF растений, выращенных в нормальных температурных условиях, при пониженной температуре, а также после снятия низкотемпературного стресса.

Научная новизна. Изучена экспрессия гена транскрипционного фактора CBF капусты, являющегося ключевым элементом в запуске механизма развития устойчивости растений к холодовому стрессу, в нормальных температурных условиях, при холодовом стрессе и при закаливании. Исследована степень метилирования цитозинов в промоторном участке гена CBF капусты у проростков, прошедших и не прошедших этап закаливания. Обнаружено, что у растений, прошедших этап холодового закаливания, происходит уменьшение степени метилирования последовательности ДНК промотора. Исследовано изменение статуса метилирования промоторной области гена CBF капусты после окончания цикла закаливания и показано частичное восстановление метилирования в ранее деметилированных участках промоторной области этого гена.

Полученные нами данные углубляют представления о процессах восприятия растениями холодового сигнала окружающей среды.

Научно-практическая значимость работы. Знание молекулярных механизмов развития холодостойкости и закаливания растений, а также выяснение возможной роли процессов метилирования/деметилирования в активации регулируемых холодом генов, может послужить основой для развития новых стратегий усиления холодостойкости и увеличения продуктивности, а также расширения области возделывания сельскохозяйственных культур.

Апробация работы. Материалы диссертации были доложены на VII съезде Общества физиологов растений (Нижний Новгород, 2011), II и III школе-конференции молодых ученых Волго-Уральского региона по физико химической биологии и биотехнологии «Биомика – наука XXI века» (Уфа, 2011;

2012), III Международной научно-практической конференции «Современные проблемы биологии, экологии и химии» (Запорожье, 2012).

Публикации. По материалам диссертации опубликовано 3 статьи в журналах из перечня ВАК.

Структура и объем работы. Диссертация состоит из введения, обзора литературы (глава 1), описания объектов и методов исследования (глава 2), результатов исследования и их обсуждения (глава 3), заключения, выводов и списка цитированной литературы, включающего 220 наименований, в том числе 195 работ иностранных авторов. Работа изложена на 110 страницах и содержит 14 рисунков и 3 таблицы.

ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Объектом исследования являлись растения цветной капусты Brassica oleracea L. В работе были использованы следующие экспериментальные условия (Таблица 1).

Таблица Условия проведения экспериментов Группа Условия произрастания Температурный Фаза роста и режим длительность I. Нормальные температурные условия 24°С Стадия 4-го листа II. Нормальные температурные 24°С Стадия 4-го листа условия/холодовой стресс 1°С 0,5-3 часа III. Нормальные температурные 24°С Стадия 4-го листа условия/закаливание/холодовой стресс 7-8°С 7 суток 1°С 0,25-24 часа IV. Нормальные температурные 24°С Стадия 4-го листа условия/закаливание/нормальные 7-8°С 7 суток температурные условия 24°С 14 суток Высокомолекулярную ДНК из растений выделяли фенольно детергентным методом по Грехему (Graham, 1978). РНК из растений выделяли реагентом Trizol по рекомендациям фирмы-изготовителя (Invitrogen, США). кДНК получали с помощью набора, содержащего обратную транскриптазу M-MLV (Силекс, Россия). Плазмидную ДНК получали методами мягкого лизиса (Clewell, Helinski, 1969), быстрого щелочного лизиса (Birnboim, Doly, 1979) и с помощью наборов для выделения плазмидной ДНК (Цитокин, Россия) по протоколу фирмы изготовителя. Подготовку и трансформацию компетентных клеток проводили по методике Коэн (Cohen, 1972). Аналитический гель электрофорез проводили в 1-2%-х агарозных или в 10-15%-х полиакриамидных гелях. Элюцию ДНК из агарозных гелей проводили с использованием набора для очистки ДНК (Цитокин, Россия). Оценку степени метилирования ДНК проводили по методу бисульфитной конверсии с помощью наборов EZ DNA Methylation Kit (Zymo Research, США) и MethylCode Bisulfite Conversion Kit (Invitrogen, США) по протоколам фирм-производителей. Изменения уровня метилирования анализировали с помощью программы CyMATE (Hetzl J. et al., 2007). Определение нуклеотидных последовательностей ДНК проводили на автоматическом секвенаторе Genome-Lab фирмы Beckman Coulter (США). Сравнение нуклеотидных последовательностей осуществляли с помощью программы Megalign из пакета программ Lasergene фирмы DNASTAR Inc. (США). Поиск возможных сайтов связывания транскрипционных факторов проводили с помощью программы PLACE (Higo et al, 1999;

Prestridge, 1991). ПЦР проводили со стандартным набором реагентов в приборах МС2 (ДНК Технология), ПЦР-РВ - с использованием TaqMan проб на приборе iCycler iQ5 (Bio-Rad Laboratories, США). Среднее арифметическое значение уровня экспрессии 3-х независимых экспериментов и стандартную ошибку среднего (SEM) находили с помощью модуля описательной статистики в программе Statistica 6.1 (StatSoft. Inc.). Сравнение экспериментальных групп проводили с использованием парного t-критерия Стьюдента для зависимых выборок (n = 3, p 0,05).

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЯ 1. Определение нуклеотидной последовательности гена CBF капусты Фрагмент гена CBF капусты, включающий в себя 5’-транскрибируемый участок, а также прилегающую к нему промоторную область, амплифицировали с помощью полимеразной цепной реакции (ПЦР), используя праймеры, соответствующие аналогичным последовательностям арабидопсиса. Полученный фрагмент ДНК капусты клонировали в векторе pAL-TA (Евроген, Россия) и определяли нуклеотидную последовательность.

Сравнение нуклеотидной последовательности этого фрагмента CBF-гена цветной капусты с имеющимися в GenBank нуклеотидными последовательностями генов капусты, а так же с CBF-подобных последовательностями генов CBF близкородственных растений, таких как Brassica napus, Brassica rapa и Arabidopsis thaliana, показало, что данные последовательности имеют высокую степень гомологии с последовательностью гена цветной капусты: 98% с CBF последовательностью рапса;

76% с последовательностью репы;

77% с последовательностью гена CBF1 арабидопсиса;

77% с последовательностью гена арабидопсиса;

77% с последовательностью гена CBF2 CBF арабидопсиса (Рисунок 1).

BoCBF ATGAACTCAGTCTCTACTTTTTCTGAACTTCTTGGCTCTGAGAACGAGTCTCCGG------TAGGTGGTGAT BnCBF ATGAACTCAGTCTCTACTTTTTCTGAACTTCTTGGCTCTGAGAACGAGTCTCCGG------TAGGTGGTGAT BrCBF ATGACCTCATTTTCTACCTTCTCTGAAATGTTGGGCTCCGAGTACGAGTCTCCTACA---TTAAGCGGGGAG AtCBF1 ATGAACTCATTTTCAGCTTTTTCTGAAATGTTTGGCTCCGATTACGAGCCTCA---------AGGCGGAGAT AtCBF2 ATGAACTCATGTTCTGCTTTTTCTGAAATGTTTGGCTCCGATTACGAGTCTCCGGTTTCCTCAGGCGGTGAT AtCBF3 ATGAACTCATTTTCTGCTTTTTCTGAAATGTTTGGCTCCGATTACGAGTCTTCGGTTTCCTCAGGCGGTGAT BoCBF TACTGTCCCATGTTGGCGGCGAGCTGTCCGAAGAAGCCGGCGGGTAGGAAGAAGTTTCGGGAGACACGTCAC BnCBF TACTGTCCCATGTTGGCGGCGAGCTGTCCGAAGAAGCCGGCGGGTAGGAAGAAGTTTCGGGAGACACGTCAC BrCBF TATTGTCCGACGCTGGCCGCGAGCTGTCCGAAGAAACCTGCGGGTCGGAAGAAGTTTCGGGAGACGCGTCAC AtCBF1 TATTGTCCGACGTTGGCCACGAGTTGTCCGAAGAAACCGGCGGGCCGTAAGAAGTTTCGTGAGACTCGTCAC AtCBF2 TACAGTCCGAAGCTTGCCACGAGCTGCCCCAAGAAACCAGCGGGAAGGAAGAAGTTTCGTGAGACTCGTCAC AtCBF3 TATATTCCGACGCTTGCGAGCAGCTGCCCCAAGAAACCGGCGGGTCGTAAGAAGTTTCGTGAGACTCGTCAC BoCBF CCCATTTACCGAGGAGTTCGCCTTAGAAAATCAGGTAAGTGGGTGTGTGAAGTGAGGGAACCAAACAAAAAA BnCBF CCCATTTACCGAGGAGTTCGCCTTAGAAAATCAGGTAAGTGGGTGTGTGAAGTGAGGGAACCAAACAAAAAA BrCBF CCAATTTACAGAGGAGTACGTCTGAGAAACTCAGGTAAGTGGGTGTGTGAGGTGAGGGAGCCAAACAAAAAG AtCBF1 CCAATTTACAGAGGAGTTCGTCAAAGAAACTCCGGTAAGTGGGTTTCTGAAGTGAGAGAGCCAAACAAGAAA AtCBF2 CCAATTTACAGAGGAGTTCGTCAAAGAAACTCCGGTAAGTGGGTGTGTGAGTTGAGAGAGCCAAACAAGAAA AtCBF3 CCAATATACAGAGGAGTTCGTCGGAGAAACTCCGGTAAGTGGGTTTGTGAGGTTAGAGAACCAAACAAGAAA BoCBF TCTAGGATTTGGCTCGGAACTTTCAAAACAGCTGAGATCGCAGCTCGTGCTCACGACGTCGCCGCCTTAGCT BnCBF TCTAGGATTTGGCTCGGAACTTTCAAAACAGCTGAGATCGCAGCTCGTGCTCACGACGTCGCCGCCTTAGCT BrCBF TCTAGGATTTGGCTCGGTACTTTCCTAACCGCCGAGATCGCAGCTCGTGCTCACGACGTCGCCGCCATAGCC AtCBF1 ACCAGGATTTGGCTCGGGACTTTCCAAACCGCTGAGATGGCAGCTCGTGCTCACGACGTCGCTGCATTAGCC AtCBF2 ACGAGGATTTGGCTCGGGACTTTCCAAACCGCTGAGATGGCAGCTCGTGCTCACGACGTCGCCGCCATAGCT AtCBF3 ACAAGGATTTGGCTCGGAACATTTCAAACCGCTGAGATGGCAGCTCGAGCTCACGACGTTGCCGCTTTAGCC BoCBF CTCCGTGGAAGAGGCGCCTGCCTCAACTTCGCCGACTCGGCTTGGCGGCTCCGTATCCCGGAGACAACCTGC BnCBF CTCCGTGGAAGAGGCGCCTGCCTCAACTTCGCCGACTCGGCTTGGCGGCTCCGTATCCCGGAGACAACCTGC BrCBF CTCCGTGGCAAATCCGCCTGCCTCAATTTCGCCGACTCGGCTTGGCGGCTCCGTATCCCGGAGACAACATGC AtCBF1 CTCCGTGGCCGATCAGCATGTCTCAACTTCGCTGACTCGGCTTGGCGGCTACGAATCCCGGAGTCAACATGC AtCBF2 CTCCGTGGCAGATCTGCCTGTCTCAATTTCGCTGACTCGGCTTGGCGGCTACGAATCCCGGAATCAACCTGT AtCBF3 CTTCGTGGCCGATCAGCCTGTCTCAATTTCGCTGACTCGGCTTGGAGACTCCGAATCCCGGAATCAACTTGC BoCBF GCCAAGGATATCCAGAAGGCTGCTGCTGAAGCCGCATTG--CTTAGAGG BnCBF GCCAAGGATATCCAGAAGGCTGCTGCTGAAGCCGCATTGGCTTTTGAGG BrCBF CCCAAGGATATCCAGAAGGCGGCTGCTGAAGCCGCGGTGGCTTTTCAGG AtCBF1 GCCAAGGATATCCAAAAAGCGGCTGCTGAAGCGGCGTTGGCTTTTCAAG AtCBF2 GCCAAGGAAATCCAAAAGGCGGCGGCTGAAGCCGCGTTGAATTTTCAAG AtCBF3 GCTAAGGACATCCAAAAGGCGGCGGCTGAAGCTGCGTTGGCGTTTCAGG Рисунок 1. Сравнение нуклеотидных последовательностей генов CBF различных видов растений (BoCBF – капусты;

BnCBF – рапса;

BrCBF – репы;

AtCBF1, AtCBF2, AtCBF3 – арабидопсиса).

Выведенные аминокислотные последовательности также имеют большое сходство, включая наличие последовательности, кодирующей домен AP2/EREBP (Рисунок 2). Стоит отметить, что консервативные участки PKKPAGR, AP2 и DSAWRL (Medina, 1999), по наличию которых гены относят к CBF подсемейству, совпадают.

         PKKPAGR                  BoCBF MNSVSTFSELLGSENESP—-VGGDYCPMLAASCPKKPAGRKKFRETRHP BnCBF MNSVSTFSELLGSENESP—-VGGDYCPMLAASCPKKPAGRKKFRETRHP BrCBF MTSFSTFSEMLGSEYESPT-LSGEYCPTLAASCPKKPAGRKKFRETRHP AtCBF1 MNSFSAFSEMFGSDYE-P--QGGDYCPTLATSCPKKPAGRKKFRETRHP AtCBF2 MNSCSAFSEMFGSDYESPVSSGGDYSPKLATSCPKKPAGRKKFRETRHP AtCBF3 MNSFSAFSEMFGSDYESSVSSGGDYIPTLASSCPKKPAGRKKFRETRHP _AP2_  BoCBF IYRGVRLRKSGKWVCEVREPNKKSRIWLGTFKTAEIAARAHDVAALALR BnCBF IYRGVRLRKSGKWVCEVREPNKKSRIWLGTFKTAEIAARAHDVAALALR BrCBF IYRGVRLRNSGKWVCEVREPNKKSRIWLGTFLTAEIAARAHDVAAIALR AtCBF1 IYRGVRQRNSGKWVSEVREPNKKTRIWLGTFQTAEMAARAHDVAALALR AtCBF2 IYRGVRQRNSGKWVCELREPNKKTRIWLGTFQTAEMAARAHDVAAIALR AtCBF3 IYRGVRRRNSGKWVCEVREPNKKTRIWLGTFQTAEMAARAHDVAALALR DSAWRL    BoCBF GRGACLNFADSAWRLRIPETTCAKDIQKAAAEAAL BnCBF GRGACLNFADSAWRLRIPETTCAKDIQKAAAEAAL BrCBF GKSACLNFADSAWRLRIPETTCPKDIQKAAAEAAV AtCBF1 GRSACLNFADSAWRLRIPESTCAKDIQKAAAEAAL AtCBF2 GRSACLNFADSAWRLRIPESTCAKEIQKAAAEAAL AtCBF3 GRSACLNFADSAWRLRIPESTCAKDIQKAAAEAAL Рисунок 2. Сравнение аминокислотных последовательностей, кодируемых генами CBF (BoCBF – капусты;

BnCBF – рапса;

BrCBF – репы;

AtCBF1-3 арабидопсиса). Сплошной линией отмечен AP2/EREBP домен, скобками – консервативные последовательности NLS, DSAWRL.

Сравнение 5’-участка клонированного фрагмента ДНК растений капусты с промоторными областями генов CBF арабидопсиса и некоторых растений рода капустных (Brassica): рапса, репы, а также теллунгиеллы солонцовой (Thellungiella salsuginea), показало различную степень гомологии между ними, а у арабидопсиса наибольшее сходство с данным фрагментом гена CBF капусты имеет промотор гена CBF2 (Рисунок 3).

BoCBF TTCTCAAACCACAAACTTTTAACTCCACCTGAAAAGAAGATAAAAGAGAGAGAAATAAA-TAT BnCBF ----------------------TGCTGCATGAATTCGGCACGAG---GAGAGAAATAAA-TAT BrCBF CTTTCAAACCACAAACTTTTAACTCCACCTGAAAAGAAGCTAAAAGTGAGAGAAATAAA-TAT TsCBF TCTTCAAACTACAAACTTTAAAATCCAACCTGAAAAAAAAAGAGAGAGATAAAAATAAAATAT AtCBF TCTATAACTTCAAACACTTA--CCTGAATTAGAAAAGAAAGATAGAGAGAGAAATAAAT-ATT BoCBF CT-TATCAAAC-----CAGCAGACAGAACAGA-GATCTTGTTACTTACTATACTAC---ACTC BnCBF CT-TATCAAAC-----CAGCAGACAGAACAGA-GATCTTGTTACTTACTATACTAC---ACTC BrCBF CT-TATCAAAC-----CAGCAGACAGAACAGA-GATCTTGTTACTTACTATACTACTACACTC TsCBF TTCTATCAAAAA----CCATCAGGACGGAAGATCTTTTAACCTA-----CTAC----TTAAAC AtCBF TT-ATCATACCATACAAAAAAAGACAGAGATCTTTCTACTTACT---CTACTCTCATAAAAAC BoCBF AGCCTTATCCAGTTTTTC---AAAAGAAGTTTTCAACT------------- BnCBF AGCCTTATCCAGTTTTTC---AAAAGAAGTTTTCAACG------------- BrCBF AGCCTTATCCAGTTTTTC---AAAAGAAGTTTTCAACG------------- TsCBF CTTATCCAGTTTTTCTCAAAAAAGAGTTTTCTTTTTTTCTTAAAGATCAAAA AtCBF CTTATCCAGTTTCTTGAA--ACAGAGTACTCTTCTGATCAA---------- Рисунок 3. Сравнение нуклеотидных последовательностей промоторов генов CBF различных видов растений (BoCBF –капусты;

BnCBF – рапса;

BrCBF – репы;

AtCBF2 – гена CBF2 арабидопсиса;

TsCBF – теллунгиеллы солонцовой).

Так, гомология промоторной последовательности гена CBF капусты составляет 79% с последовательностью промотора рапса;

97% с последовательностью промотора репы;

с последовательностями теллунгиеллы солонцовой и арабидопсиса гомологии значительно меньше.

При этом промотор арабидопсиса оказался протяженнее на 5 п.н. по сравнению с промоторами растений рода капустных, а промотор теллунгиеллы солонцовой – на 17 п.н. В следующей серии экспериментов (прямой праймер соответствовал известным промоторам гена CBF близкородственных растений, обратный соответствовал полученной нами последовательности гена капусты) получен клон, включающий более протяженный фрагмент промотора гена CBF, составляющий 457 п.н. и имеющий высокую гомологию (99%) с промоторной последовательностью гена CBF репы (Рисунок 4).

BoCBF TTAATAGATAAATACAGAGTTGTCCTGCTCAACCCATACATAGCCACACATTCACCCAGTACAAGTTAAAA BrCBF TTAATAGTTAAATACAAGGTTGTCCTGCACAACCCATGCATAGCCACACATTCACCCAGTACAAGTTAAAA BoCBF CACATAAAAGTATAACGAGTGAAGAGTCAGCAGCCATACCACAAAGGTCAAGATGACACGTGGCAGCATAT BrCBF CACATAAAGGTATAGCGAGTGAAGAGTCAGCAGCCATACCACAAAGGTCAAGATGACACGTGGCAGCATAT BoCBF AAGTGAATGAAAACAACGCATTCACACAAACCGTGGGATGATCAATTTAGCTGTGTCGTGTCCACTTGGCA BrCBF AAGTGAATGAAAACAACGCATTCACACAAACCGTGGGAT---CAATTTAGCTGTGTCCTGTCCACTTGGCA BoCBF CTCCGAGAGCCAAAAAAACACCGTGTTCTTTTCTAAAATCCAGCCCCACCCATTTCCAAATATCTCATGCC BrCBF CTCCCAGAGCCAAAA--ACACCGTGTTCTTTTCTAAAAACCAGCCCCACCCATTTCAAAATATCTCATGCC BoCBF AATATAAACACCAACTCTCGCTCCACTTTTCTCAAACCACAAACTTTTAACTCCACCTGAAAAGAAGATAA BrCBF AATATAAACACCAACTCTCGCTCCACTTTTCTCAAACCACAAACTTTTAACTCCACCTGAAAAGAAGCTAA BoCBF AAGAGAGAGAAATAAATATCTTATCAAACCAGACAGAACAGAGATCTTGTTACTTACTATACTAC---ACT BrCBF AAGTGAGAGAAATAAATATCTTATCAAACCAGACAGAACAGAGATCTTGTTACTTACTATACTACTACACT BoCBF CAGCCTTATCCAGTTTTTCAAAAGAAGTTTTCAACT BrCBF CAGCCTTATCCAGTTTTTCAAAAGAAGTTTTCAACG Рисунок 4. Сравнение промоторной области гена CBF капусты и промоторной области CBF репы (BoCBF – промоторная область гена CBF капусты;

BrCBF – репы).

Таким образом, клонированный фрагмент ДНК включал в себя 5’ транскрибируемый участок гена CBF капусты длиной 401 п.н., а также прилегающий к нему участок промоторной области длиной 457 п.н.

2. Экспрессия гена CBF растений капусты при холодовом стрессе Определение уровня экспрессии гена транскрипционного фактора CBF капусты при низкотемпературном стрессе проводили методом количественной ОТ-ПЦР в реальном времени с использованием TaqMan зондов. Результаты показали, что уже через полчаса после экспозиции растений при низкой температуре экспрессия гена CBF повышается в 13- раз относительно контроля, через час она достигает своего пика, превышая значение контроля в 50-70 раз (Рисунок 5). После этого уровень экспрессии гена CBF постепенно снижается, но даже через 3 часа остается на уровне, значительно превышающем контрольные показатели.

Рисунок 5. Изменение уровня экспрессии гена CBF растений капусты при низкотемпературном стрессе. Все различия статистически достоверны (n=3, p0,05). Значения для каждого промежутка времени представлены в виде среднего арифметического±стандартная ошибка среднего. Процент активации рассчитывали по отношению к контролю, который принимали за 100 % (пунктирная линия).

3. Изменение уровня экспрессии гена CBF капусты при закаливании растений Известно, что холодовое закаливание значительно повышает устойчивость растений к низким температурам. Учитывая значение генов CBF в активации генов холодового ответа, представляло интерес выяснение вопроса о том, как влияет закаливание на экспрессию генов CBF.

Определение уровня экспрессии гена транскрипционного фактора CBF капусты у закаленных растений проводили так же, как и в случае незакаленных растений. Растения, выращенные в климатокамере при 22°С, переносили в камеру с положительной температурой (7-8°С) и закаливали таким образом в течение недели. Затем растения переносили в термостатированный бокс, охлажденный до 1°С, и выдерживали при данной температуре до суток. Экспрессию гена оценивали через 15 мин, 30 мин, 1, 2, 3, 9, 12 и 24 час.

Уровень мРНК гена CBF закаленных растений сравнивали с уровнем мРНК гена CBF двух контрольных групп: первая – растения, прошедшие этап холодового закаливания, но не подвергавшиеся низкотемпературному стрессу;

вторая – незакаленные контрольные растения, так же не подвергавшиеся воздействию низкой температуры. Было установлено, что у растений из первой контрольной группы экспрессия CBF превышает таковую у растений из второй группы в 3,5 раза (Рисунок 6), то есть закаливание повышает активность транскрипции мРНК гена CBF у растений.

Рисунок 6. Изменение уровня экспрессии гена CBF закаленных растений капусты при низкотемпературном стрессе. Все различия статистически достоверны (n=3, p0,05). Значения для каждого промежутка времени представлены в виде среднего арифметического±стандартная ошибка среднего. Процент активации рассчитывали по отношению к контролю, который принимали за 100 % (пунктирная линия).

При сравнении с первой контрольной группой было зафиксировано ожидаемое повышение уровня экспрессии гена CBF. Так, через 15 минут после воздействия холодового стресса количество мРНК увеличилось в раза, а через полчаса - достигло 30-40-кратного превышения относительно контрольной группы и находилось на этом уровне в течение трехчасового стрессового воздействия. После 3-хчасового содержания растений в таких условиях наблюдалось постепенное понижение уровня экспрессии данного гена: через 12 часов количество мРНК превышало контрольный уровень в раз, спустя сутки в 3 раза (Рисунок 6).

Относительно контрольной группы, представленной незакаленными растениями, значения экспрессии мРНК гена CBF у закаленных растений были заметно выше. Как упоминалось ранее, содержание мРНК гена CBF у закаленных растений было в 3,5 раза больше, чем у незакаленных растений.

Уже через 15 минут после низкотемпературного стресса содержание мРНК CBF у закаленных растений повышается в 14 раз, а через полчаса превышает контроль в 135 раз, оставаясь на этом уровне в течение 1-2 часа. Через 3 часа начинается постепенное понижение содержания транскрипта и через 24 часа уровень экспрессии превышает контрольную отметку в 11 раз (Рисунок 7).

Рисунок 7. Изменение уровня экспрессии CBF гена закаленных растений капусты при низкотемпературном стрессе (относительно незакаленного контроля). Все различия статистически достоверны (n=3, p0,05). Значения для каждого промежутка времени представлены в виде среднего арифметического±стандартная ошибка среднего. Процент активации рассчитывали по отношению к контролю, который принимали за 100 % (пунктирная линия).  Сопоставление уровня экспрессии генов CBF и ростовых процессов, как интегральных показателей функционирования растений и реализации генетической информации, позволяет хотя бы косвенно судить о защитной роли накопления соответствующих мРНК при холодовом стрессе. Для проведения опыта по сопоставлению ростовых показателей незакаленных и закаленных растений после холодового стресса проростки в фазе 4-х листьев были разделены на 2 группы по 20 штук. Одна группа проростков прошла стадию закаливания при 7°С, 16-часовом фотопериоде и освещенности 15 клк в течение 7 суток, другая группа проростков не закаливалась. Затем обе группы проростков были подвергнуты холодовому стрессу при температуре около 1°С в течение 1 суток, после чего были перенесены в климатокамеру с нормальной температурой выращивания. У данных растений через каждые сутки измеряли прирост биомассы отдельных проростков и использовали по несколько растений для выделения РНК и определения уровня мРНК гена CBF.

Выживаемость:

  58%    73%      Рисунок 8. Изменение массы и выживаемость закаленных и незакаленных растений после низкотемпературного стресса. Все различия статистически достоверны (n=3, p0,05).

Результаты показали, что растения, прошедшие этап холодового закаливания, значительно лучше перенесли низкотемпературный стресс, возвращаясь через сутки к положительной динамике прироста биомассы.

Незакаленные проростки достигли исходной массы только через 4 суток роста при нормальной температуре выращивания и лишь на седьмые сутки после стресса значения прироста закаленных проростков и незакаленных выровнялись (Рисунок 8).

Выживаемость закаленных растений после стресса так же была выше.

В течение двух недель после 24 часов низкотемпературного воздействия среди незакаленных растений выжило 58%, а среди закаленных 73%.

При этом содержание мРНК гена CBF у закаленных растений превышало данный показатель у незакаленных растений (Рисунок 7).

Сопоставление параметров выживаемости, прироста биомассы с динамикой содержания мРНК гена CBF позволяет предположить, что, вероятно, наряду с другими приспособительными реакциями, повышающими адаптацию растений капусты к холоду, уровень экспрессии генов CBF также является фактором, способствующим защите растений от холодовых повреждений.

4. Степень метилирования ДНК промоторной области гена CBF цветной капусты Brassica oleracea L. при различных температурных условиях выращивания Известно, что у высших растений ДНК в значительной степени метилирована по остаткам цитозина. Глобальное метилирование ДНК видо-, ткане-, органоспецифично, оно изменяется при прорастании семян, переходе растений к цветению (Ванюшин, 2009). Метилирование ДНК может существенно модулироваться различными биотическими и абиотическими факторами, влияющими на рост и развитие растений (Ванюшин, 2009).

Детекция метилированных цитозинов в промоторной и кодирующей последовательностях гена проводилась методом бисульфитной CBF конверсии с помощью специализированных наборов по протоколам фирм производителей.

В предварительном опыте было показано, что в клонированном фрагменте гена CBF более половины (70 из 130) из всех цитозинов при бисульфитной обработке ДНК конвертировались в тимин, следовательно, в исходной ДНК это были неметилированные цитозины (Рисунок 9).

1 CAGCAGCCATACCACAAAGGTCAAGATGACACGTGGCAGCATATAAGTGA - 2 TAGTAGTTATATTATAAAGGTTAAGATGATATGTGGTAGTATATAAGTGA - 1 ATGAAAACAACGCATTCACACAAACCGTGGGATGATCAATTTAGCTGTGT - 2 ATGAAAATAATGTATTTATATAAATTGTGGGATGATTAATTTAGTTGTGT - 1 CGTGTCCACTTGGCACTCCGAGAGCCAAAAAAACACCGTGTTCTTTTCTA - 2 CGTGTCCACTTGGCACTCCGAGAGCCAAAAAAACACCGTGTTCTTTTCTA - 1 AAATCCAGCCCCACCCATTTCCAAATATCTCATGCCAATATAAACACCAA - 2 AAATCCAGCCCCACCCATTTCCAAATATCTCATGCCAATATAAACACCAA - 1 CTCTCGCTCCACTTTTCTCAAACCACAAACTTTTAACTCCACCTGAAAAG - 2 CTCTCGCTCCACTTTTCTCAAACCACAAACTTTTAACTCCACCTGAAAAG - 1 AAGATAAAAGAGAGAGAAATAAATATCTTATCAAACCAGACAGAACAGAG - 2 AAGATAAAAGAGAGAGAAATAAATATCTTATCAAACCAGACAGAACAGAG - 1 ATCTTGTTACTTACTATACTACACTCAGCCTTATCCAGTTTTCAAAAGAA - 2 ATCTTGTTACTTACTATATTATATTTAGTTTTATTTAGTTTTTAAAAGAA - 1 GTTTCAACTATGAACTCAGTCTCTACTTTTTCTGAACTTCTTGGCTCTGA + 2 GTTTTAATTATGAATTTAGTTTTTATTTTTTTTGAATTTTTTGGTTTTGA + 1 GAACGAGTCTCCGGTAGGTGGTGATTACTGTCCCATGTTGGCGGCGAGCT + 2 GAATGAGTTTTTGGTAGGTGGTGATTATTGTTTTATGTTGGTGGTGAGTT + 1 GTCCGAAGAAGCCGGCGGGTAGGAAGAAGTTTCGGGAGACACGTCACCCC + 2 GTTTGAAGAAGTTGGTGGGTAGGAAGAAGTTTTGGGAGATATGTTATTTT + 1 ATTTACCGAGGAGTTCGCCTTAGAAAATCAGGTAAG + 2 ATTTATTGAGGAGTTTGTTTTAGAAAATTAGGTAAG + Рисунок 9. Сравнение нуклеотидных последовательностей фрагмента гена CBF в исходной ДНК из растений капусты, растущих в нормальных температурных условиях, до бисульфитной обработки (1) и после бисульфитной обработки (2). Метилированные нуклеотиды отмечены красным цветом. Курсивом выделен старт инициации транскрипции.

В исследуемой последовательности ДНК неметилированными оказались остатки цитозинов, локализованных в диапазоне примерно до -262 и после -41 положений. При этом часть цитозиновых остатков, как в сайтах CG, CNG, так и в сайтах CNN, при бисульфитной обработке ДНК незакаленных растений остались неизменными, что указывает на то, что в исходной ДНК они были метилированы. Наибольшее количество таких метилированных цитозинов (60) обнаруживалось во фрагменте промотора, ограниченном положениями -261 и -40.

Уровень метилирования цитозинов в клонированных фрагментах ДНК промоторов гена CBF, ограниченных положениями -261 и -41, растений капусты, прошедших и не прошедших этап холодового закаливания, в сравнении с нуклеотидной последовательностью ДНК без бисульфитной обработки, приведен в Таблице 2.

Таблица Содержание метилированных цитозинов в гене CBF растений капусты, выращенных в различных температурных условиях Степень метилирования гена CBF у растений капусты (%) перенесенных в Позиция нуклеотида прошедших стадию нормальные без закаливания закаливания условия роста после закаливания -234 100 42,86±2,86 77,27±2, -216 100 80,95±0,95 -204 100 66,67±6,67 -203 100 71,43±1,43 -200 80±1,5 0 -199 80±1,5 0 -198 80±1,5 0 -197 80±1,5 0 95,45±4, -195 100 0 -194 100 0 -193 100 19,05±0,95 -178 100 90,48±0,48 -158 70±1,5 80,95±0,95 -156 100 76,19±6,19 -152 100 80,95±0,95 -150 100 80,95±0,95 -136 100 80,95±0,95 -73 100 71,43±1,43 -63 100 80,95±0,95 -49 100 90,48±0,48 Можно отметить, что содержание метилированных и неметилированных цитозинов в ДНК закаленных и незакаленных растений незначительно отличалось. В различных клонах при закаливании деметилируются от 7 до цитозиновых остатков, метилированных в исходной ДНК. При этом цитозинов в положениях -200… -197 и -195, -194 были деметилированы во всех исследованных клонах.

Следующим этапом работы было выяснение вопроса о сохранении статуса метилирования ДНК у растений, прошедших этап холодового закаливания, а затем перенесенных для выращивания в нормальные температурные условия. Оказалось, что экспрессия генов CBF у таких растений была на уровне контрольных растений до холодового закаливания, а содержание метилцитозинов в промоторной последовательности гена CBF близко к первоначальному уровню, обнаруживаемому в незакаленных растениях (Таблица 2). Из 20 CG, CNG и CNN сайтов, обнаруживаемых во фрагменте ДНК промотора от -261-го до -42-го нуклеотида после холодового закаливания проростков, 3 деметилировались полностью, 1 – частично.

Таким образом, содержание метилцитозинов в рассматриваемом фрагменте последовательности ДНК промотора гена CBF, снижающееся у растений, прошедших этап холодового закаливания, при снятии стрессовых условий приближается к исходному уровню.

Клонированную нами промоторную последовательность гена CBF капусты сравнивали с промоторами генов растений арабидопсиса с целью выявления в них сайтов связывания транскрипционных факторов, возможно, влияющих на экспрессию исследуемого нами гена. Было обнаружено мотивов также встречающихся в промоторах генов CBF арабидопсиса. Среди них три MYC мотива, два MYB и один ICEr2 (Рисунок 10).

-450 TTAATAGATAAATACAGAGTTGTCCTGCTCAACCCATACATAGCCACACAT - -400 TCACCCAGTACAAGTTAAAACACATAAAAGTATAACGAGTGAAGAGTCAGC - -350 AGCCATACCACAAAGGTCAAGATGACACGTGGCAGCATATAAGTGAATGAA - -300 AACAACGCATTCACACAAACCGTGGGATGATCAATTTAGCTGTGTCGTGTC - -250 CACTTGGCACTCCGAGAGCCAAAAAAACACCGTGTTCTTTTCTAAAATCCA - -200 GCCCCACCCATTTCCAAATATCTCATGCCAATATAAACACCAACTCTCGCT - -150 CCACTTTTCTCAAACCACAAACTTTTAACTCCACCTGAAAAGAAGATAAAA - -100 GAGAGAGAAATAAATATCTTATCAAACCAGACAGAACAGAGATCTTGTTAC - -049 TTACTATACTACACTCAGCCTTATCCAGTTTTCAAAAGAAGTTTCAACT - Рисунок 10. Возможные сайты связывания транскрипционных факторов в промоторной области гена CBF капусты. Желтым цветом выделены MYC мотивы (CANNTG);

синим цветом – MYB мотивы (WAACCA);

зеленым – мотив ICEr2 (ACTCCG). Метилированная область промотора подчеркнута.

Большинство из мотивов, с которыми могут связываться транскрипционные факторы, находятся в метилированной области промотора. Мотивы MYC и ICEr2 (Chinnusamy et al., 2003;

Zarka et al., 2003) схожи с таковыми у генов CBF арабидопсиса, у которого они узнаются транскрипционным фактором ICE (Inducer of CBF expression) – положительно регулирующим экспрессию CBF. Мотивы MYB так же обнаруживаются в промоторных последовательностях арабидопсиса, с этими мотивами связывается белок MYB15, что приводит к снижению экспрессии гена CBF (Agarwal et al., 2006). Интерес представляют три цитозина – первый из них (нуклеотид в положении -234) находится в непосредственной близости к ICEr2 сайту связывания, этот нуклеотид деметилируется более чем у половины закаленных растений (57% изученных клонов), а так же это один из 4 цитозинов, который в ряде клонов остается деметилированным после переноса растений в нормальные температурные условия произрастания (23% клонов). Два других цитозина, которые могут представлять интерес – находятся в MYB сайтах, они так же, хоть и с меньшей частотой, частично деметилируются при закаливании (19% клонов в положении -136 и -73, соответственно).

Таким образом, можно отметить, что кодирующая часть исследуемого гена свободна от метилированных оснований, однако его промоторная область имеет метилированный участок. Большинство метилированных цитозинов остаются таковыми вне зависимости от температурных условий, в которых выращивалось растение. Однако, часть из них все же деметилируется при закаливании. Из шестидесяти метилированных нуклеотидов, в той или иной мере деметилируется двадцать. Девятнадцать из них – это цитозины, расположенные в ассиметричной последовательности CNN.

Наибольший уровень деметилирования при закаливании растений наблюдается в центре данного метилированного участка. В положениях от -200 до -194 все цитозины теряют метильную группу во всех исследованных нами клонах, а нуклеотид в положении -193 остается метилированным лишь в 20% случаях, в то время как в остальных положениях деметилирование носит частичный характер и метилированный цитозин обнаруживается в 70 90% клонов.

Так же стоит отметить, что большинство цитозинов, утрачивающих метильную группу в ходе холодового закаливания, возвращаются в исходное состояние, если растение перенести в благоприятные условия произрастания (Рисунок 11).

Рисунок 11. Частота метилирования цитозинов в промоторе гена CBF капусты. 1 – растения, выращенные в нормальных температурных условиях;

2 – растения, прошедшие стадию холодового закаливания;

3 – растения, перенесенные в нормальные температурные условия после этапа закаливания.

Результаты исследований, представленные в данной работе, показали, что последовательности ДНК промотора гена CBF, у которых степень метилирования понизилась при закаливании, становятся более метилированными при переносе растений в благоприятные условия роста.

Механизм данного процесса пока неясен и может быть предметом дальнейших исследований. В этой связи можно отметить действующую у растений систему метилтрансфераз и гликозилаз DME/ROS1, обеспечивающих обратимое деметилирование/метилирование соответствующих последовательностей ДНК (Gong et al., 2002;

Gehring et al., 2006) и способствующих адаптации к условиям среды (Матцке, Шеид, 2010).

Можно предположить, что, возможно, деметилирование цитозинов в метилированной области промотора гена CBF капусты приводит к активации экспрессии этого гена при холодовой акклимации.

Выводы 1. Впервые клонирован фрагмент гена CBF капусты протяженностью 858 пар нуклеотидов, включающий промоторную область и транскрибируемую часть.

Выявлена высокая гомология клонированной последовательности с CBF генами близкородственных видов растений (арабидопсис, репа, рапс и др.).

2. Показано, что экспрессия гена CBF капусты индуцируется холодом, превышая исходный уровень в несколько десятков раз в течение тридцати минут после холодового стресса. Установлено, что экспрессия гена CBF у растений, прошедших этап холодовой акклимации, носит значительно более интенсивный и долговременный характер по сравнению с экспрессией этого гена у растений без холодового закаливания.

3. В промоторной части гена CBF капусты обнаружена метилированная область, включающая в себя 60 метилированных цитозинов. Показано отсутствие метилцитозинов в 5'-транскрибируемом участке данного гена.

4. Сравнение степени метилирования цитозинов в промоторном участке гена CBF у растений капусты, прошедших стадию холодовой акклимации, и у растений, выращенных в нормальных температурных условиях, показало, что закаливание приводит к частичному деметилированию в обнаруженной нами метилированной области.

5. При сравнении степени метилирования цитозинов в промоторной области гена CBF закаленных растений и растений, помещенных в нормальные температурные условия после закаливания, обнаружено, что при снятии стрессовых температурных условий часть деметилированных в процессе закаливания последовательностей промоторной области исследуемого гена метилируется вновь.

Список работ, опубликованных по теме диссертации:

1. Гималов, Ф.Р. Экспрессия CBF-подобного гена цветной капусты (Brassica Oleracea L.) при холодовом стрессе / Ф.Р.Гималов, Д.С.Фарафонтов, Д.А.Чемерис, Р.Т.Матниязов, А.В.Чемерис // Агрохимия. - 2011. - № 11. - С.

71-77.

2. Гималов, Ф.Р. Изменение степени метилирования ДНК промоторной области CBF-гена капусты Brassica oleracea L. при холодовой акклимации / Ф.Р.Гималов, Д.С.Фарафонтов, Д.А.Чемерис, Р.Т.Матниязов, А.В.Чемерис // Вестник Башкирского университета. 2012. - Т. 17, № 1. - С. 82-85.

3. Гималов, Ф.Р. Степень метилирования ДНК промоторной области CBF-гена капусты Brassica oleracea L. при различных температурных условиях выращивания / Ф.Р.Гималов, Д.С.Фарафонтов, Р.Т.Матниязов, А.В.Чемерис // Вестник Башкирского университета. 2012. - Т. 17, № 4. - С. 1749-1752.

4. Гималов, Ф.Р. Холодовая регуляция экспрессии CBF-подобного гена капусты L. / Ф.Р.Гималов, Д.С.Фарафонтов, Д.А.Чемерис, Brassica oleracea Р.Т.Матниязов, А.В.Чемерис // Материалы VII Съезда Общества физиологов растений России. Нижний Новгород. - 2011. - С. 183.

5. Фарафонтов, Д.С. Изменение степени метилирования ДНК промоторной области CBF-гена капусты Brassica oleracea L. при холодовой акклимации / Д.С.Фарафонтов, Д.А.Чемерис, Р.Т.Матниязов // II Всероссийская школа конференция молодых ученых по физико-химической биологии и биотехнологии «Биомика – наука XXI века». Уфа. - 2011. - С. 127.

6. Фарафонтов, Д.С. Влияние низкой температуры на степень метилирования ДНК промоторной области CBF-гена капусты Brassica oleracea L. / Д.С.Фарафонтов, Р.Т.Матниязов, Ф.Р.Гималов // Материалы III Международной научно-практической конференции «Современные проблемы биологии, экологии и химии». Запорожье. - 11-13 мая 2012 г. - С.

54-55.

7. Фарафонтов, Д.С. Зависимость степени метилирования ДНК промоторной области CBF-гена капусты Brassica oleracea L. от температурных условий выращивания / Д.С.Фарафонтов, Р.Т.Матниязов, Ф.Р.Гималов, А.В.Чемерис // II Всероссийская школа-конференция молодых ученых по физико химической биологии и биотехнологии «Биомика – наука XXI века». Уфа. 2012. - С. 110.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.