авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:     | 1 ||

Структурно-функциональный анализ днк-узнающих белков с помощью синтетических фрагментов днк

-- [ Страница 2 ] --

Два изошизомера R.MboI - R.Sau3AI и MutH, в отличие от R.MboI принадлежат к -семейству EcoRV-подобных ЭР (рис. 10). Эти ферменты являются примером функциональной схожести белков (одинаковая специфичность действия по отношению к нуклеотидной последовательности в ДНК), которые имели общего предшественника, но подверглись экстремальным изменениям структуры в процессе эволюции. R.MvaI узнает в ДНК тот же двутяжевой участок, что и R.SsoII, R.EcoRII, R.PspGI, но расщепляет его по особому механизму через стадию диссоциации фермент-субстратного комплекса после гидролиза одной из фосфодиэфирных связей.

Это свойство сближает R.MvaI с MutH и с R.Sau3AI, также мономерами, которые димеризуются при связывании лиганда и осуществляют одноцепочечный разрыв в ДНК, но показывает на эволюционную удаленность от R.SsoII, R.EcoRII и R.PspGI (рис. 10). R.EcoRII не имеет особенного подобия с R.NaeI и R.Sau3AI, также относящимися к IIE подтипу. Различная структурная организация этих ферментов свидетельствует о независимых путях решения одной и той же задачи – связывания двух одинаковых участков узнавания в ДНК.

4.4. ДНК-метилтрансфераза SsoII Фермент модификации SsoII как ДНК-метилтрансфераза М.SsoII представляет собой классическую С5-цитозиновую ДНК метилтрансферазу как по структуре (72-379 аминокислотные остатки), так и по механизму действия. Ключевую роль в катализе переноса метильной группы в С5 положение цитозина играет единственный остаток цистеина фермента – Cys142. Мы показали, что этот остаток не вовлечен в специфическое узнавание М.SsoII участка метилирования в ДНК. Константа диссоциации комплекса мутантного белка M.SsoII(C142A) с субстратом всего в 2,5 раза больше аналогичной константы, рассчитанной для исходной формы фермента. Вместе с тем, проведенные эксперименты по аффинной модификации М.SsoII ФДСГ-содержащими дуплексами свидетельствуют, что сульфгидрильная группа Cys142 фермента сближена с углеводофосфатным остовом ДНК при связывании как специфических (содержащих участок узнавания), так и неспецифических лигандов.

Вопрос о том, каким образом С5-МТазы катализируют реакцию переноса метильной группы, практически решен. В то же время механизмы узнавания определенной нуклеотидной последовательности в ДНК и выбора метилируемого dC еще недостаточно изучены. Поэтому основное внимание в данной работе было направлено на изучение связывания М.SsoII с участком метилирования ДНК. Для этой цели был использован ДНК-дуплекс VIII (c. 31), содержащий канонический участок метилирования M.SsoII, и его аналоги. Немодифицированный дуплекс XI отличается от дуплекса VIII центральной нуклеотидной парой участка метилирования (рис. 11). В ДНК-лигандах XII и XIII внутренний остаток dC участка метилирования заменен на остаток 5-метил-2'-дезоксицитидина в одной из цепей. Также был сконструирован ДНК-дуплекс, содержащий m5dС в обеих цепях участка узнавания.

Комплексообразование M.SsoII с ДНК-дуплексами изучали в присутствии 500 мкМ AdoHcy (S-аденозил-L-гомоцистеин) и 50 нг/мкл поли(dI·dC). В этих условиях наблюдалось образование только специфического фермент-субстратного комплекса.

Замена центральной (вырожденной) dАТ-пары участка узнавания на dGdC-пару не влияет на эффективность связывания МТазы с субстратом. Сродство М.SsoII к ДНК лигандам возрастает в ряду: диметилированная ДНК неметилированная ДНК монометилированная ДНК.

Для идентификации групп атомов участка метилирования ДНК, вовлеченных во взаимодействие с М.SsoII на стадии специфического узнавания, был применен метод «отпечатков» в варианте interference footprinting. В качестве модифицирующих реагентов были использованы муравьиная кислота, гидразин, N-этил-N нитрозомочевина и диметилсульфат. Содержащие 32Р-метку по 5'-концу одной из цепей дуплексы VIII, XI-XIII обрабатывали соответствующим химическим реагентом в условиях статистической модификации и затем инкубировали с M.SsoII. Методом «торможения» в геле связавшийся с МТазой субстрат отделяли от ДНК-дуплекса, не связавшегося с ферментом. Олигонуклеотиды выделяли из геля, гидролизовали по месту модификации и анализировали в ПААГ, содержащем 7 М мочевину.

Определяли радиоактивность зон из дорожек, соответствующих разделению продуктов гидролиза ДНК, не связавшейся (R) и связавшейся (Rсв) с M.SsoII.

Полагали, что фрагмент ДНК важен для формирования специфического комплекса с M.SsoII при R/Rсв 1,9. Результаты, полученные методом «отпечатков» при анализе комплексов M.SsoII с немодифицированными ДНК-субстратами VIII и XI, представлены на рис. 11 (а, б).

а б XI VIII в г XII XIII Рис. 11. Идентифицированные с помощью метода «отпечатков» группы атомов ДНК дуплексов VIII (а), XI (б), XII (в) и XIII (г), вовлеченные во взаимодействие с M.SsoII.

Приведены только центральные фрагменты ДНК-дуплексов. Участвующие в узнавании ферментом гетероциклические основания выделены красным, N7-атомы остатков гуанина отмечены зелеными точками, фосфатные группы - синими стрелками. Величина стрелок соответствует степени влияния модификации фосфатных групп на связывание дуплекса с белком. Участок метилирования выделен рамкой.

Во взаимодействии с M.SsoII на стадии узнавания участвуют пуриновые основания, входящие в участок метилирования дуплексов и непосредственно примыкающие к нему с 5'-конца. В формировании специфических контактов с М.SsoII участвуют N7-атомы всех остатков гуанина участка узнавания. Только внешний цитозин обеих цепей участка метилирования вовлечен во взаимодействие с M.SsoII. Метилируемый цитозин не важен для узнавания МТазой субстрата. М.SsoII формирует контакты с 5'-фосфатными группами всех пяти нуклеотидов участка узнавания в обеих цепях ДНК-дуплексов VIII и XI. Как и следовало ожидать, замена центральной вырожденной нуклеотидной пары участка метилирования не влияет на характер взаимодействия M.SsoII с ДНК. Все участвующие во взаимодействии с М.SsoII группы атомов участка метилирования образуют единый кластер. ДНК белковые контакты в пределах участка метилирования носят симметричный характер.

Схемы распределения контактирующих с М.SsoII групп атомов ДНК в неметилированных цепях дуплексов XII, XIII и в соответствующих им цепях дуплекса VIII практически идентичны (рис 11). Замена внутреннего dC участка узнавания на m5dС приводит к увеличению числа функционально важных для взаимодействия с М.SsoII гетероциклических оснований, фосфатных групп и N7 атомов остатков гуанина в метилированных цепях дуплексов XII и XIII. В узнавание вовлечены как группы атомов участка метилирования, так и группы атомов, примыкающие к нему с 5'-конца. Таким образом, повышение сродства М.SsoII к монометилированным субстратам по сравнению с неметилированными обусловлено увеличением числа контактов между ферментом и цепью, содержащей остаток m5dС.

Фермент модификации SsoII как регуляторный белок M.SsoII формирует специфический и стабильный комплекс с промоторной областью генов системы рестрикции-модификации (Р-М) SsoII. В этой области локализован ДНК-фрагмент длиной 48-52 пары нуклеотидов, с которым взаимодействует фермент (Karyagina et al., 1997). Вместе с тем, необходимо было определить «регуляторный» участок ДНК, который обеспечивает максимальное число контактов с M.SsoII. Для решения этой задачи был получен 140-звенный фрагмент ДНК, содержащий промоторную область генов системы Р-М SsoII (рис. 12).

5' CATAAAAAATAACCTTTTATATCTACTTGAAAGTTTTTTCATGCACGTTCATAATT 3' GTATTTTTTATTGGAAAATATAGATGAACTTTCAAAAAAGTACGTGCAAGTATTAA R.SsoII M.SsoII GGAATCAAAACAGGACAAATTGTCCTAAAACCAACACTTAATTCTGGTAGACATGCATG CCTTAGTTTTGTCCTGTTTAACAGGATTTTGGTTGTGAATTAAGACCATCTGTACGTAC Рис. 12. Схема промоторной области генов системы рестрикции-модификации SsoII. Серым фоном обозначена область, «защищаемая» M.SsoII от гидролиза ДНКазой I (Karyagina et al., 1997). Вертикальные стрелки указывают на гуаниновые остатки, N7-атомы которых вовлечены во взаимодействие с M.SsoII. Величина стрелок соответствует степени «защиты» N7-атомов остатков dG от метилирования диметилсульфатом. Жирным шрифтом и горизонтальными стрелками обозначены инициаторные кодоны генов ssoIIR и ssoIIM.

Методом «отпечатков» с диметилсульфатом (в варианте protection footprinting) идентифицированы 7 гуаниновых остатков, вовлеченных во взаимодействие с белком, 6 из них расположены внутри 15-звенного инвертированного повтора симметрично относительно центральной dА·Т пары. В дальнейших исследованиях использовали 31-звенный ДНК-дуплекс XIV, представляющий собой центральный фрагмент промоторной области генов системы Р-М SsoII и включающий 15-звенный инвертированный повтор.

XIV 5' АТСААААСАGGACAAATTGTCCTAAAACCAA 3' 3' TAGTTTTGTCCTGTTTAACAGGATTTTGGTT 5' Методом «отпечатков» (в варианте interference footprinting) с муравьиной кислотой, гидразином, диметилсульфатом и N-этил-N-нитрозомочевиной в качестве модифицирующих реагентов идентифицированы три остатка гуанина, один остаток аденина и два остатка тимина инвертированного повтора, образующие два симметрично расположенных блока: 5'-GGA-3' и 5'-TGT-3' в каждой из цепей ДНК дуплекса XIV (рис. 13). Взаимодействие второго тимидина 5'-TGT-блока с M.SsoII было зафиксировано также методом аффинной модификации белка br5dU содержащим аналогом ДНК. М.SsoII взаимодействует с тремя фосфатными группами в каждой из цепей дуплекса XIV и образует контакты с экспонироваными в большую бороздку ДНК N7-атомами всех остатков гуанина инвертированного повтора, который, вероятно, и представляет собой «регуляторный» участок ДНК.

Рис. 13. Схема контактов аминокислотных остатков ди мера N-концевой области M.SsoII с «регуляторным» участком ДНК. Гетероцикличе ские основания и фосфатные группы, идентифицированные методом «отпечатков» как во влеченные во взаимодействие с M.SsoII, выделены красным или синим цветом соответственно.

Симметричное взаимодействие с обеими половинами участка узнавания ДНК характерно для многих регуляторных белков, взаимодействующих с операторной последовательностью в виде димера и использующих для узнавания -спираль, локализованную в большой бороздке ДНК. Аналогичный механизм взаимодействия с «регуляторным» участком ДНК мы предполагаем и для M.SsoII.

Построена модель комплекса N-концевой области M.SsoII (1-71 аминокислотные остатки) с «регуляторным» участком ДНК (рис. 13, 14). При моделировании были использованы данные РСА комплекса репрессора бактериофага 434 с ДНК, а также результаты метода «отпечатков». Согласно модели N-концевая область M.SsoII включает в себя пять -спиралей, вторая и третья -спирали формируют структурный мотив «спираль-поворот-спираль», при этом третья спираль является «узнающей» (рис. 14). Два N-концевых фрагмента М.SsoII расположены в большой бороздке ДНК с одной стороны двойной спирали.

Следует отметить, что с учетом возможности изгиба ДНК положения Рис. 14. Пространственная модель комплекса димера N-концевой контактов аминокислотных остатков области М.SsoII с 15-звенным M.SsoII с группами атомов «регулятор «регуляторным» участком ДНК.

ного» участка могут быть смещены относительно указанных на рис. 13.

Для исследования возможности «посадки» двух субъединиц M.SsoII на «регуляторный» участок были синтезированы ДНК-дуплексы XV-XVII, содержащие два остатка 2'-О-(2-оксоэтил)уридина (табл. 8). Обе модификации вводились в одну цепь ДНК в разные половины «регуляторного» участка в позиции, предположительно сближенные с остатками лизина N-концевой области M.SsoII в белково-нуклеиновом Работа проводилась совместно с д.б.н. Карягиной А.С. (НИИЭиМ РАМН), к.ф.-м.н. Алексеевским А.В. (НИИФХБ МГУ) и к.ф.-м.н. Спириным С.А. (НИИФХБ МГУ).

комплексе. В контрольных экспериментах использовали ДНК-дуплекс XVIII, содержащий модификации в тех же положениях, что и ДНК-дуплекс XV, но имеющий в своем составе только одну «половину» инвертированного повтора.

Таблица 8. Результаты аффинной модификации метилтрансферазы SsoII ДНК-лигандами, содержащими 2'-альдегидную группу.

Выход ДНК-белкового ДНК-дуплекса конъюгатаб, % № (5' 3') K1 K ATCAAAACAGGAC-AAATTGTCCT-AAAACCAA XV 55±3 6± TAGTTTTGTCCTGoUTTAACAGGAoUTTTGGTT ATCAAAAoUAGGACAAAToUGTCCTAAAACCAA XVI 42±4 5± TAGTTTT-GTCCTGTTTA-ACAGGATTTTGGTT ATCAAAAC-AGGACAAATTGTCCT-AAAACCAA XVII 36±4 11± TAGTTTTGoUCCTGTTTAACAGGAoUTTTGGTT GCATATATAT-ATATAATTGTCCT-AAAACCAA XVIII 26± CGTATATAToUTATATTAACAGGAoUTTTGGTT а. Жирным шрифтом отмечен «регуляторный» участок или его половина, серым выделен остаток 2'-О-(2-оксоэтил)уридина (oU).

б. Приведены средние значения, полученные не менее чем в трех независимых экспериментах. «» Дуплекс не образует конъюгат с M.SsoII.

Аффинную модификацию M.SsoII ДНК-дуплексами XV-XVIII, меченными 32Р по 5'-концу модифицированной цепи, проводили в условиях специфического связывания. Эффективность образования коньюгата одной субъединицы M.SsoII с модифицированной цепью ДНК-дуплексов XV-XVII (конъюгат К1, расчетная молекулярная масса 54,1 кДа) составляла 36-55%, двух субъединиц белка (конъюгат К2, расчетная молекулярная масса 98,7 кДа) – 5-11% (табл. 8, рис. 15).

Рис. 15. Анализ продуктов ковалентного присоединения M.SsoII к 32Р-меченному ДНК дуплексу XV (концентрация 50 нМ).

Авторадиограмма разделения реакционных смесей методом электрофореза в 12%-ном ДСН ПААГ. Дорожки 1-3 - концентрация M.SsoII в расчете на мономер 1 мкМ, 2 мкМ и 4 мкМ, соответственно. Стрелками указаны положения белков - маркеров молекулярной массы, кДа.

Изменение нуклеотидной последовательности в одной из половин «регуляторного» участка (дуплекс XVIII) препятствует связыванию второй субъединицы фермента. С увеличением концентрации M.SsoII в реакционной смеси выход конъюгата двух субъединиц белка с ДНК возрастает, в то время как выход конъюгата одной субъединицы МТазы с ДНК не изменяется (рис. 15). Можно предположить, что регуляторная функция М.SsoII связана с димеризацией фермента при взаимодействии с промоторной областью генов системы Р-М SsoII, которая осуществляется при повышении концентрации МТазы in vivo.

Особый интерес представлял вопрос, может ли белок одновременно взаимодействовать с двумя различными участками узнавания – участком метилирования и «регуляторным» участком. Методом компьютерного моделирования была построена гипотетическая модель, демонстриру ющая возможность такого взаимоде йствия. Она включает в себя две полноразмерные молекулы M.SsoII, три ДНК и две молекулы AdoHcy (рис. 16).

Обе субъединицы M.SsoII распола гаются с одной стороны «регулятор ного» участка ДНК. Области каждой молекулы M.SsoII, ответственные за Рис. 16. Пространственная модель полно метилирование, сближены с субстратом размерной M.SsoII в комплексе с «регуля и AdoHcy и обеспечивают белок- торным» участком ДНК, двумя молекулами белковые контакты между молекулами ДНК, содержащими участок метилирования, М.SsoII. и двумя молекулами AdoHcy.

Методом «торможения» в геле не удалось зафиксировать ДНК-белковый комплекс M.SsoII с двумя немодифици рованными лигандами, содержащим «регуляторный» участок и содержащим участок метилирования. Поэтому был использован метод аффинной модификации M.SsoII последовательно двумя типами модифицированных ДНК-дуплексов. Дуплекс XIX содержал фосфорилдисульфидную группировку в участке метилирования (подчеркнут), дуплекс XX – остаток 2'-О-(2-оксоэтил)уридина в «регуляторном» участке.

XIX 5' ACGTTCCpssTGGCTATTGACTGC 3' 3' СTGCAAGG---ACCGATAACTGACGT 5' XX 5' ATCAAAAC-AGGACAAATTGTCCTAAAACCAA 3' 3' TAGTTTTGоUCCTGTTTAACAGGATTTTGGTT 5' M.SsoII образовывала конъюгат с каждым из модифицированных ДНК-дуплексов (рис. 17, дорожки 2 и 4). Результаты аффинной модификации M.SsoII последовательно двумя типами ДНК-лигандов (3'-32P-меченным XIX и немеченым XX) показали возможность образования «двойного» конъюгата XIX•M.SsoII•XX – продукта ковалентного присоединения белка к реакционноспособным группировкам в составе обоих участков узнавания в ДНК (рис. 17, дорожка 5). Первоначально область M.SsoII, ответственная за метилирование субстрата XIX, формирует конъюгат с входящим в его состав олигонуклеотидом, затем N-концевая область фермента также может ковалентно связаться с «регуляторным» участком ДНК. При проведении аффинной модификации M.SsoII в обратном порядке - сначала 2' альдегидсодержащим ДНК-дуплексом XX, а затем ФДСГ-содержащим дуплексом XIX – эффективность образования соответствующего конъюгата XIX•M.SsoII•XX была ниже (рис. 17, дорожка 6). Возможно, первоначальное ковалентное связывание N-концевой области М.SsoII с «регуляторным» участком изменяет конформацию фермента, что снижает эффективность его взаимодействия с участком метилирования, содержащим ФДСГ.

Рис. 17. Анализ методом электрофореза в 12%-ном ДСН-ПААГ продуктов ковалентного связывания M.SsoII с 2'-альдегидсодержащим ДНК-дуплексом XX (4), с 3'-32P-меченным ФДCГ-содержащим ДНК-дуплексом XIX (в отсутствие (2) и в присутствии (3) NaBH3CN) и последовательно с двумя ДНК-лигандами (5 – сначала с XIX, затем с XX, 6 – сначала с XX, затем с XIX). 1 – Исходный белок M.SsoII. а – Гель окрашен раствором кумасси R250. б – Авторадиограмма геля. Молекулярные массы, соответствующие положению белковых зон, указаны слева.

Заключение Основываясь на полученных данных, можно предложить стратегию исследования механизма действия любого ДНК-узнающего белка и зондирования контактов в комплексах, которые он образует с ДНК:

а) выявление групп атомов ДНК, вовлеченных в связывание с белком, методом «отпечатков», основанным на статистической модификации ДНК химическими реагентами до формирования ДНК-белкового комплекса;

б) анализ взаимодействия белка с синтетическими ДНК-лигандами, в которых модифицированы или элиминированы определенные группы атомов гетероциклических оснований, вовлеченные в узнавание или катализ;

в) поиск гомологии в аминокислотных последовательностях ДНК-узнающих белков;

г) направленная замена аминокислотных остатков белка, предположительно вовлеченных во взаимодействие с ДНК, и определение параметров взаимодействия мутантных форм белка с ДНК-лигандами;

д) определение аминокислотных остатков, сближенных с нуклеиновой кислотой в составе ДНК-белкового комплекса методом аффинной модификации белка лигандами, содержащими реакционноспособные группировки определенных типов в заданном положении олигонуклеотидной цепи;

е) построение схемы контактов в ДНК-белковом комплексе, моделирование его пространственной структуры.

ВЫВОДЫ 1. Предложена стратегия исследования ДНК-белковых взаимодействий в растворе и продемонстрирована ее эффективность в применении к ДНК-узнающим белкам независимо от размера и структуры узнаваемой ими нуклеотидной последовательности.

2. Сконструированы три типа лигандов для аффинной модификации ДНК-узнающих белков: 1) фотоактивируемые ДНК-дуплексы, содержащие остатки 5-бром- или 5 йод-2'-дезоксиуридина;

2) ДНК-дуплексы с межнуклеотидной замещенной пирофосфатной или фосфорилдисульфидной группировкой;

3) ДНК-дуплексы, несущие активную группу (альдегидную, йодацетамидную) в 2'-положении углеводного фрагмента. Разработаны и оптимизированы методики получения, выделения и анализа белково-нуклеиновых конъюгатов и подходы к идентификации участка белка, присоединенного к ДНК.

3. Впервые установлено, что ДНК-лиганды, содержащие единичную фосфорилдисульфидную или 2'-йодацетамидную группировку, могут быть использованы для эффективного ковалентного связывания остатков цистеина ДНК узнающего центра белка. ДНК с 2'-О-2-оксоэтильными группами в участке узнавания белка позволяют фиксировать остатки лизина, сближенные с углеводофосфатным остовом, на начальных стадиях узнавания и связывания лиганда. Предложена структура ДНК-дуплекса - необратимого ингибитора фактора транскрипции NF-B.

4. Сконструирована серия немодифицированных ДНК-дуплексов – субстратов эндонуклеаз рестрикции MvaI, EcoRII, SsoII, PspGI и MboI. Исследована зависимость эффективности функционирования этих ферментов от длины и нуклеотидной последовательности ДНК-субстрата. Установлено, что ферменты MvaI, SsoII, PspGI и MboI принадлежат к подтипу Р эндонуклеаз рестрикции II-го типа. Предложена модельная система, позволяющая исследовать механизм активации гидролиза ДНК эндонуклеазой EcoRII. Выявлены требования к лигандам-активаторам.

5. Расширен спектр ДНК-лигандов с направленно модифицированной структурой.

а) С помощью аналогов субстратов, содержащих ненуклеозидные вставки, обнаружены принципиальные различия в характере расщепления ДНК эндонуклеазами рестрикции SsoII, ScrFI, MvaI, EcoRII, узнающими пентануклеотидную последовательность с различной степенью вырожденности центральной нуклеотидной пары. б) Сделано заключение о перспективности использования лигандов, содержащих нуклеозид с инвертированной OH-группой при С2'- или С3'-атоме или с модификацией в 2'-положении рибозного кольца, для оценки влияния локальных изменений в структуре углеводного фрагмента на ДНК белковое взаимодействие. в) Показано, что шпилечные, гантелеобразные и ковалентно «сшитые» ДНК-дуплексы являются уникальными инструментами исследования механизма действия ДНК-узнающих белков.

6. Впервые обнаружено, что структурные, конформационные параметры и стабильность субстрата существенно влияют на функционирование урацил-ДНК гликозилазы. Установлено, что основой специфичности действия фермента является не стадия комплексообразования, а следующие за ней стадия адаптации структуры лиганда до оптимальной и стадия катализа. Продемонстрировано, что олигодезоксирибонуклеотиды, содержащие остатки 2'-амино-2'-дезоксиуридина и 1 (3'-дезокси--D-трео-пентафуранозил)урацила, являются уникальными негидроли зуемыми аналогами субстратов урацил-ДНК-гликозилазы и могут быть использованы в структурных исследованиях комплекса этого фермента с ДНК.

7. В первичной структуре 30 эндонуклеаз рестрикции II-го типа выявлен консервативный блок, включающий в себя примерно 70 аминокислотных остатков.

Внутри блока выделено 3 мотива, предположительно отвечающие за взаимодействие с углеводофосфатным остовом ДНК, образование контактов с гетероциклическими основаниями и катализ. Экспериментально доказано участие консервативных аминокислотных остатков эндонуклеаз рестрикции SsoII, PspGI и MboI в связывании и гидролизе ДНК-субстрата. Впервые продемонстрирована эволюционная взаимосвязь между ферментами выбранной группы.

9. Обнаружен особый характер функционирования эндонуклеазы рестрикции MvaI, состоящий в избирательном влиянии многих модификаций на гидролиз только одной цепи субстрата. Выдвинуто предположение о принадлежности эндонуклеазы MvaI к семейству ферментов рестрикции.

10. Идентифицированы группы атомов участка метилирования и инвертированного повтора промоторной области генов системы рестрикции-модификации SsoII, существенные для формирования комплексов с С5-цитозиновой ДНК метилтрансферазой SsoII. Установлено, что Cys142 фермента, играющий ключевую роль в катализе, сближен с углеводофосфатным остовом уже на стадии связывания с неспецифической ДНК. Показано, что с «регуляторным» участком ДНК могут связываться две субъединицы метилтрансферазы SsoII. Предложена модель взаимодействия этого фермента с ДНК как бифункционального белка. Зафиксировано образование «двойного» конъюгата метилтрансферазы SsoII с олигонуклеотидами, содержащими реакционноспособные группировки в составе метилируемого и «регуляторного» участков узнавания белка.

11. Разработаны новые методы тестирования активности ферментов рестрикции, модификации и репарации, анализа их взаимодействия с ДНК и определения примесей нуклеаз в препаратах белков.

Cписок основных публикаций по теме диссертации Обзоры 1. Шефлян Г.Я., Кубарева Е.А., Громова Е.С. Методы ковалентного присоединения нуклеиновых кислот и их производных к белкам. // Успехи химии, 1996, т.65, N8, с.766 782.

2. Козлов И.А., Кубарева Е.А. Взаимодействие димера субъединицы р50 фактора транскрипции NF-B c ДНК. // Успехи биологич. химии, 1998, т.38, с.77-93.

3. Козлов И.А., Кубарева Е.А., Шабарова З.А. Применение синтетических олигонуклеотидов для ингибирования активности фактора транскрипции NF-B. // Молекулярн. биология, 1998, т.32, N3, с.389-400.

4. Кубарева Е.А., Крынецкая Н.Ф., Шабарова З.А. Ингибирование фактора транскрипции NF-B модифицированными фрагментами ДНК и их ассоциатами с фталоцианиновыми комплексами переходных металлов. // Российск. химич. журнал, 1998, т.XLII, N5, с.153 162.

5. Зацепин Т.С., Долинная Н.Г., Кубарева Е.А., Ивановская М.Г., Метелев В.Г., Орецкая Т.С. Ковалентное связывание модифицированных нуклеиновых кислот c белками как метод изучения специфических белково-нуклеиновых взаимодействий. // Успехи химии, 2005, т.74, N1, c.84-103.

Статьи 6. Kubareva E.A., Pein C.-D., Gromova E.S., Kuznetsova S.A., Shabarova Z.A., Tashlitzki V.N., Cech D. The role of modifications in oligonucleotides in sequence recognition by MvaI restriction endonuclease. // Eur. J. Biochem., 1988, v.175, N3, p.615-618.

7. Волков Е.М., Кубарева Е.А., Сергеев В.Н., Орецкая Т.С. Синтез олигодезоксирибону клеотидов, содержащих 1,2-дидезокси-D-рибофуранозу. // Химия природн. соед., 1990, N3, с.417-419.

8. Кубарева Е.А., Громова Е.С., Романова Е.А., Орецкая Т.С., Шабарова З.А.

Особенности расщепления эндонуклеазами рестрикции MvaI и EcoRII субстратов, модифицированных по аминогруппам гетероциклических оснований. // Биоорган. химия, 1990, т.16, N4, с. 501-506.

9. Kubareva E.A., Gromova E.S., Pein C.-D., Krug A., Oretskaya T.S., Cech D., Shabarova Z.A. Oligonucleotide cleavage by restriction endonucleases MvaI and EcoRII: a comprehensive study on the influence of structural parameters on the enzyme-substrate interaction. // Biochim.

Biophys. Acta, 1991, v.1088, p. 395-400.

10. Романова Е.А., Кузнецова Л.Г., Кубарева Е.А., Цытович А.В., Меренкова И.Н., Орецкая Т.С., Громова Е.С., Шабарова З.А. Синтез и свойства ДНК-дуплексов, содержащих 9-[1'-гидрокси-2'-(гидроксиметил)этокси]метилгуанин. // Биоорган. химия, 1991, т.17, N12, с.1640-1648.

11. Gromova E.S., Kubareva E.A., Vinogradova M.N., Oretskaya T.S., Shabarova Z.A.

Peculiarities of recognition of CCA/TGG sequences in DNA by restriction endonucleases MvaI and EcoRII. // J. Mol. Recognit., 1991, v.4, p.133-141.

12. Пятраускене О.В., Кубарева Е.А., Громова Е.С. Спектрофотометрический метод изучения расщепления ДНК-дуплексов эндонуклеазами рестрикции. // Молекулярн.

биология, 1991, т.25, вып.5, с.1424-1426.

13. Кубарева Е.А., Пятраускене О.В., Карягина А.С., Никольская И.И., Громова Е.С.

Изменение места расщепления синтетических субстратов эндонуклеазой рестрикции SsoII при введении ненуклеотидных вставок в участок узнавания. // Биоорган. химия, 1992, т.18, N8, с.1133-1136.

14. Карпова Е.А., Кубарева Е.А., Бурьянов Я.И., Громова Е.С. Образование двух типов фермент-субстратных комплексов при взаимодействии рестриктазы EcoRII c синтетическими ДНК-дуплексами. // Молекулярн. биология, 1992, т.26, вып.5, с.993-998.

15. Petrauskene O.V., Kubareva E.A., Gromova E.S., Shabarova Z.A. Mechanism of the interaction of EcoRII restriction endonuclease with two recognition sites. Probing of modified DNA duplexes as activators of the enzyme. // Eur. J. Biochem., 1992, v.208, N.3, p.617-622.

16. Kubareva E.A., Petrauskene O.V., Karyagina A.S., Tashlitsky V.N., Nikolskaya I.I., Gromova E.S. Cleavage of synthetic substrates containing non-nucleotide inserts by restriction endonucleases. Change in the cleavage specificity of endonuclease SsoII. // Nuclеic Acids Res., 1992, v.20, N17, p.4533-4538.

17. Wyszynski M.W., Gabbara S., Kubareva E.A., Romanova E.A., Oretskaya T.S., Gromova E.S., Shabarova Z.A., Bhagwat A.S. The cysteine conserved among DNA cytosine methylases is required for methyl transfer, but not for specific DNA binding. // Nucleiс Acids Res., 1993, v.21, N2, р.295-301.

18. Karpova E.A., Kubareva E.A., Gromova E.S., Buryanov Ya.I. Peculiarities of the binding of restriction endonuclease EcoRII to synthetic DNA duplexes. // Biochem. Mol. Biol. Int., 1993, v.29, N1, p.113-121.

19. Пятраускене О.В., Кубарева Е.А., Громова Е.С., Пайн К.-Д., Цех Д., Шабарова З.А.

Изучение механизма активации эндонуклеазы рестрикции EcoRII с помощью синтетических ДНК-дуплексов. // Молекулярн. биология, 1993, т.27, вып.3, с.507-518.

20. Шефлян Г.Я., Кубарева Е.А., Ташлицкий В.Н. Взаимодействие эндонуклеазы рестрикции MvaI с синтетическими ДНК-дуплексами: температурный оптимум и энергия активации ферментативной реакции, эффективные константы скорости и энергия активации процесса термоинактивации фермента. // Вест. Моск. У-та. Сер. 2. Химия, 1993, т.34, N5, с.516-520.

21. Brevnov M.G., Kubareva E.A., Romanova E.A., Volkov E.M., Karyagina A.S., Nikolskaya I.I., Gromova E.S. Interaction of the MvaI and SsoII methyltransferases with DNAs altered at the central base pair of recognition sequence. // Gene, 1995, v.157, N1-2, p.149-152.

22. Kubareva E.A., Volkov E.M., Vinogradova N.L., Kanevsky I.A., Oretskaya T.S., Kuznetsova S.A., Brevnov M.G., Gromova E.S., Nevinsky G.A., Shabarova Z.A. Modified substrates as probes for studing uracil-DNA glycosylase. // Gene, 1995, v.157, N1-2, p.167-171.

23. Sheflyan G.Ya., Kubareva E.A., Oretskaya T.S., Gromova E.S, Shabarova Z.A. Chemical cross-linking of MvaI and EcoRII enzymes to DNA duplexes containing monosubstituted pyrophosphate internucleotide bond. // Gene, 1995, v.157, N1-2, p.187-190.

24. Petrauskene O.V., Krynetskaya N.F., Tashlitsky V.N., Belkov V.M., Kubareva E.A., Gromova E.S., Guschlbauer W., Shabarova Z.A. Use of UV spectroscopy for the study of nucleic acid cleavage by E. coli RNase H and restriction endonucleases. // Biochem. Mol. Biol.

Int., 1995, v.37, N6, p.1127-1135.

25. Бревнов М.Г., Кубарева Е.А., Волков Е.М., Романова Е.А., Орецкая Т.С., Громова Е.С., Шабарова З.А. Влияние точечных модификаций углеводофосфатного остова ДНК на функционирование эндонуклеаз рестрикции EcoRII, MvaI и BstNI. // Молекулярн.

биология, 1995, т.29, вып.6, с.1294-1300.

26. Козлов И.А., Ивановская М.Г., Кубарева Е.А., Волков Е.М., Шабарова З.А. Синтез и свойства ковалентно связанного ДНК-дуплекса, содержащего участок узнавания фактора транскрипции NF-B. // Молекулярн. биология, 1996, т.30, вып.4, с.852-863.

27. Kubareva E.A., Fedorova O.A., Gottikh M.B., Tanaka H., Malvy C., Shabarova Z.A. NF B p50 subunit cross-linking to DNA duplexes, containing a monosubstituted pyrophosphate internucleotide bond. // FEBS Lett., 1996, v.390, N1, p.35-38.

28. Sheflyan G.Ya., Kubareva E.A., Kuznetsova S.A., Karyagina A.S., Nikolskaya I.I., Gromova E.S., Shabarova Z.A. Cross-linking of SsoII restriction endonuclease to cognate and non-cognate DNAs. // FEBS Lett., 1996, v.390, N3, p.307-310.

29. Козлов И.А., Кубарева Е.А., Ивановская М.Г., Шабарова З.А. Определение положения контактов фактора транскрипции NF-B методом региоселективного ковалентного связывания. // Молекулярн. биология, 1997, т.31, N1, с.65-75.

30. Kozlov I.A., Kubareva E.A., Ivanovskaya M.G., Shabarova Z.A. Design of new reagents on the base of DNA duplexes for irreversible inhibition of transcription factor NF-B. // Antisense Nucleic Acid Drug Dev., 1997, v.7, N4, p.279-289.

31. Antsypovich S.I., Kubareva E.A., Tashlitsky V.N., Oretskaya T.S., Shabarova Z.A. Cross linked DNA duplexes. Exonuclease stability and interaction with the nucleic transcription factor of the light-chain enhancer (NF-B). // Eur. J. Biochem., 1998, v.255, N2, p.414-421.

32. Shilov I., Tashlitsky V., Khodoun M., Vasil’ev S., Alekseev Ya., Kuzubov A., Kubareva E., Karyagina A. DNA-methyltransferase SsoII interaction with own promoter region binding site.

// Nucleic Acids Res., 1998, v.26, N11, p.2659-2664.

33. Kubareva E.A., Vasilenko N.L., Vorobjeva O.V., Volkov E.M., Oretskaya T.S., Korshunova G.A., Nevinsky G.A. Role of DNA definite structural elements in interaction with repair enzyme uracil-DNA glycosylase. // Biochem. Mol. Biol. Int., 1998, v.46, N3, p.597-606.

34. Sheflyan G.Y., Kubareva E.A., Gromova E.S., Shabarova Z.A. Conformational transition of restriction endonuclease MvaI-substrate complex under the influence of Mg2+ probed by DNA protein cross-linking studies. // Bioconjug. Chem., 1998, v.9, N6, p.703-707.

35. Karpova E.A., Kubareva E.A., Shabarova Z.A. A model of EcoRII restriction endonuclease action: the active complex is most likely formed by one protein subunit and one DNA recognition site. // IUBMB Life, 1999, v.48, N1, p.91-98.

36. Kubareva E.A., Thole H., Karyagina A.S., Oretskaya T.S., Pingoud A., Pingoud V.

Identification of a base-specific contacts between the restriction endonuclease SsoII and its recognition sequences by photocross-linking. // Nucleic Acids Res., 2000, v.28, N5, p.1085 1091.

37. Судьина А.Е., Волков Е.М., Орецкая Т.С., Дегтярев С.Х., Гончар Д.А., Кубарева Е.А.

Экспресс-метод тестирования активности фермента репарации урацил-ДНК гликозилазы. // Биоорган. химия, 2000, т.26, N6, с.442-447.

38. Воробьева О.В., Васильев С.А., Карягина А.С., Орецкая Т.С., Кубарева Е.А. Анализ контактов между ДНК и белком в комплексе метилтрансфераза SsoII - промоторная область генов системы рестрикции-модификации SsoII. // Молекулярн. биология, 2000, т.34, N6, с.1074-1080.

39. Кубарева Е.А., Вальтер Й., Воробьева О.В., Разумихин М.В., Карягина А.С., Лау П.К.К., Траутнер Т. Определение неметилируемого остатка дезоксицитидина в участке узнавания метилтрансфераз. // Биохимия, 2001, т.66, вып.12, с.1676 - 1681.

40. Pingoud V., Kubareva E., Stengel G., Friedhoff P., Bujnicki J.M., Urbanke C., Sudina A., Pingoud A. Evolutionary relationship between different subgroups of restriction endonucleases.

// J. Biol. Chem., 2002, v.277, N16, p.14306-14314.

41. Kubareva E.A., Walter J., Karyagina A.S., Vorob'eva O.V., Lau P.C.K., Trautner T.

Determination of methylation site of DNA-methyltransferase NlaX by a hybrid method. // BioTechniques, 2002, v.33, N3, р.526-531.

42. Воробьева О.В., Карягина А.С., Волков Е.М., Вирясов М.Б., Орецкая Т.С., Кубарева Е.А. Анализ контактов метилтрансферазы SsoII с ДНК в фермент-субстратном комплексе.

// Биоорган. химия, 2002, т.28, N5, с.402-410.

43. Турутин Д.В., Зацепин Т.С., Тимченко М.А., Кубарева Е.А., Орецкая Т.С.

Ковалентное присоединение фактора транскрипции NF-B к ДНК-лиганду, содержащему 2'-альдегидную группу. // Молекулярн. биология, 2002, т.36, N5, с.877-879.

44. Метелев В.Г., Кубарева Е.А., Романова Е.А., Орецкая Т.С. Синтез и свойства олигодезоксирибонуклеотидов с моно- и дифосфорилдисульфидными межнуклеотид ными группировками. // Биоорган. химия, 2003, т.29, N1, с.57-63.

45. Кубарева Е.А., Судьина А.Е. Новый метод тестирования активности ферментов репарации, рестрикции и модификации с помощью олигонуклеотидов, иммобилизованных на полимерном носителе. // Наукоемкие технологии, 2003, N1, с.64 71.

46. Metelev V.G., Kubareva E.A., Vorob'eva O.V., Romanenkov A.S., Oretskaya T.S. Specific conjugation of DNA binding proteins to DNA templates through thiol-disulfide exchange. // FEBS Lett., 2003, v.538, N1, p.48-52.

47. Борисова О.А., Романенков А.С., Метелев В.Г., Кубарева Е.А., Зубин Е.М., Тимченко М.А., Орецкая Т.С. ДНК-дуплексы, содержащие 2'-дезокси-2'-йодацетамидоуридин, как реагенты для аффинной модификации белков. // Молекулярн. биология, 2003, т.37, N3, с.534-543.

48. Романенков А.С., Борисова О.А., Кубарева Е.А., Орецкая Т.С., Метелев В.Г. Синтез и свойства олигодезоксирибонуклеотидов, содержащих фосфорилдисульфидную группировку в заданном положении углеводофосфатного остова. // Вестн. Моск. У-та.

Сер.2. Химия, 2003, т.44, N3, с.208-213.

49. Pingoud V., Conzelmann C., Kinzebach S., Sudina A., Metelev V., Kubareva E., Bujnicki J.M., Lurz R., Lueder G., Xu S.-Y., Pingoud A. PspGI, a type II restriction endonuclease from the extreme thermophile Pyrococcus sp.: structural and functional studies to investigate an evolutionary relationship with several mesophilic restriction enzymes. // J. Mol. Biol., 2003, v.329, N5, p.913-929.

50. Воробьева О.В., Романенков А.С., Метелев В.Г., Карягина А.С., Лаврова Н.В., Орецкая Т.С., Кубарева Е.А. Ковалентное связывание Cys142 метилтрансферазы SsoII с ДНК-дуплексами, содержащими фосфорилдисульфидную межнуклеотидную группу. // Молекулярн. биология, 2003, т.37, N5, с.906-915.

51. Karyagina A.S., Alexeevski A.V., Golovin A.V., Spirin S.A., Vorob’eva O.V., Kubareva E.A. Computer modeling of complex of (C5-cytosine)-DNA methyltransferase SsoII with target and regulatory DNAs. // Biophysics, 2003, v.48, Suppl.1, p.45-55.

52. Sudina A., Volkov E., Oretskaya T., Naryshkin N., Ivanovskaya M., Kubareva E. Detection of glycosylase, endonuclease and methyltransferase enzyme activities using immobilized oligonucleotides. // IUBMB Life, 2004, v.56, N3, p.139-143.

53. Pingoud V., Sudina A., Geyer H., Bujnicki J.M., Lurz R., Luder G., Morgan R., Kubareva E., Pingoud A. Specificity changes in the evolution of type II restriction endonucleases: a biochemical and bioinformatics analysis of restriction enzymes that recognize unrelated sequences. // J. Biol. Chem., 2005, v.280, N6, p.4289-4298.

54. Pingoud V., Geyer H., Geyer R., Kubareva E., Bujnicki J.M., Pingoud A. Identification of base-specific contacts in protein-DNA complexes by photocrosslinking and mass spectrometry:

a case study using the restriction endonuclease SsoII. // Molecular BioSystems, 2005, v.1, p.135-141.

55. Судьина А.Е, Зацепин Т.С., Пингоуд В., Пингоуд А., Орецкая Т.С., Кубарева Е.А.

Аффинная модификация эндонуклеазы рестрикции SsoII ДНК-дуплексами, содержащими 2'-альдегидную группу. // Биохимия, 2005, т.70, вып.8, с.1137-1144.

56. Романенков А.С., Устюгов А.А., Зацепин Т.С., Никулова А.А., Колесников И.В., Метелев В.Г., Орецкая Т.С., Кубарева Е.А. Анализ белково-нуклеиновых контактов в комплексах фактора транскрипции NF-B c ДНК. // Биохимия, 2005, т.70, вып.11, с.1474 1487.

57. Тимченко A.A., Кубарева E.A., Волков E.M., Воронина О.Л., Лунин В.Г., Гончар Д.А., Дегтярев С.Х., Тимченко М.А., Кихара Х., Кимура К. Исследование структуры урацил ДНК-гликозилазы из E. coli и ее комплексов с негидролизуемыми аналогами субстратов в растворе методом синхротронного малоуглового рентгеновского рассеяния. // Биофизика, 2006, т.51, вып.1, с.5-12.

58. Metelev V., Romanenkov A., Kubareva E., Zubin E., Polouchine N., Zatsepin T., Molochkov N., Oretskaya T. Structure-based cross-linking of NF-B p50 homodimer and decoy bearing a novel 2'-disulfide trapping site. // IUBMB Life, 2006, v.58, N11, p.654 – 658.

59. Романенков А.С., Кисиль О.В., Зацепин Т.С., Ямскова О.В., Карягина А.С., Метелев В.Г., Орецкая Т.С., Кубарева Е.А. ДНК-метилтрансфераза SsoII как бифункциональный белок: особенности взаимодействия с промоторной областью генов системы рестрикции модификации SsoII. // Биохимия, 2006, т.71, вып.12, с.1648-1658.

60. Kosinski J., Kubareva E., Bujnicki J.M. A model of restriction endonuclease MvaI in complex with DNA: a template for interpretation of experimental data and a guide for specificity engineering. // Proteins, 2007, v.68, N1, c.324-336.

Автор благодарит Назаренко А.В. (химический факультет МГУ) за помощь в оформлении диссертации и автореферата.



Pages:     | 1 ||
 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.