авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Исследование онтогенетической и тканеспецифической экспрессии гена grp, геномного гомолога гена gag ретротранспозона gypsy, у drosophila melanogaster

На правах рукописи

КУЗЬМИН ИЛЬЯ ВЛАДИМИРОВИЧ

ИССЛЕДОВАНИЕ ОНТОГЕНЕТИЧЕСКОЙ И

ТКАНЕСПЕЦИФИЧЕСКОЙ ЭКСПРЕССИИ ГЕНА Grp, ГЕНОМНОГО

ГОМОЛОГА ГЕНА gag РЕТРОТРАНСПОЗОНА gypsy, У Drosophila

melanogaster

03.03.05 – биология развития, эмбриология

03.02.07 – генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва 2012

Работа выполнена на кафедре генетики биологического факультета МГУ имени М. В. Ломоносова

Научный руководитель: доктор биологических наук, профессор КИМ Александр Иннокентьевич

Официальные оппоненты: доктор биологических наук, профессор ЖУРАВЛЕВА Галина Анатольевна, Санкт-Петербургский государственный университет доктор биологических наук, профессор ДОРОНИН Юрий Константинович, МГУ имени М.В.Ломоносова

Ведущая организация: Учреждение Российской академии наук Институт молекулярной биологии им.

В. А. Энгельгардта РАН

Защита диссертации состоится «20» марта 2012 г. в 15.30 часов на заседании диссертационного совета Д 501.001.52 при Московском государственном университете имени М.В.Ломоносова по адресу:

119991, Москва, Ленинские горы д.1, стр.12, Биологический факультет МГУ, Ауд. М-1.

С диссертацией и авторефератом можно ознакомиться в библиотеке Биологического факультета МГУ и на сайте Биологического факультета МГУ.

Автореферат разослан «_»_2012 года.

Ученый секретарь диссертационного совета, кандидат биологических наук /Е /Е.Н.Калистратова/

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Мобильные генетические элементы широко представлены в геномах эукариотических организмов. Среди них особое место занимают ретротранспозоны с длинными концевыми повторами, которые в значительной степени сходны с ретровирусами позвоночных: имеют сходную структуру и жизненный цикл. К таким ретротранспозонам относятся ретротранспозоны группы gypsy дрозофилы (Bowen, McDonald, 2001). Они могут содержать все три открытые рамки считывания — gag, pol, env, характерные для ретровирусов, однако рамка env может и отсутствовать.

Известно, что gypsy является инфекционным ретровирусом у дрозофилы, первым ретровирусом, обнаруженным у беспозвоночных (Kim et al., 1994). Показано, что у ретротранспозонов gypsy и ZAM рамка считывания env функциональна, и они образуют вирусные частицы, подобные вирионам ретровирусов, что позволяет считать gypsy и ZAM настоящими ретровирусами (Song et al., 1994;

Teysset et al., 1998;

Leblanc et al., 2000). С другой стороны, ретровирус может стать мобильным генетическим элементом при интеграции в геном клеток зародышевой линии хозяина.

Также существуют ретровирусы (SSV, Ha-MSV, Mo-MSV), которые потеряли часть генов и, подобно многим ретротранспозонам неспособны формировать вирусные частицы и даже самостоятельно реплицироваться. Такие вирусы распространяются при совместной инфекции с близкородственными ретровирусами (Coffin et al., 1997).

Таким образом, между ДКП-ретротранспозонами и ретровирусами четкой границы не существует.

Копии ретроэлементов (ретротранспозонов и ретровирусов), интегрированные в геном, со временем деградируют, однако отдельные гены или их фрагменты могут быть адаптированы на пользу организма-хозяина, то есть могут подвергаться процессу молекулярной доместикации. Так, у млекопитающих в результате молекулярной доместикации гена env появился ген syncytin, участвующий в формировании плаценты, а в результате нескольких случаев доместикации гена gag появились гены, принадлежащие семействам Fv и Mart (Mar), участвующие в ограничении ретровирусной инфекции (Stoye, 1998;

Brandt et al, 2005). У дрозофилы также обнаружены гены, гомологичные генам ретротранспозонов: Iris – гомолог гена env (Malik, Henikoff, 2005) и Grp, идентифицированный в нашей лаборатории, – гомолог гена gag (Нефдова, Ким, 2009).

Ген присутствует во всех секвенированных геномах семейства Grp Drosophilidae. Это означает, что его доместикация произошла до наступления видовой радиации в семействе, то есть 40-50 млн лет назад. Ранее в нашей лаборатории было показано, что Grp в значительной степени консервативен, это говорит о том, что он поддерживается стабилизирующим отбором и выполняет определенные функции в организме D. melanogaster (Нефдова, Ким, 2009).

Доместицированные гены выполняют широкий спектр функций в организме хозяина, и их изучение представляет значительный интерес. Многие из них тесно связаны с процессами эмбрионального развития и выполняют разнообразные функции, начиная с участия в сигнальных путях и регуляции родительского геномного импритинга и заканчивая участием в формировании синцития в трофобласте (Volff 2006;

Volff 2009).

Цели и задачи исследования Цель: Изучить структуру и возможные функции гена Grp, исследовать структуру его белкового продукта и тканеспецифичность экспрессии этого гена на уровне транскрипции и трансляции в онтогенезе у D.melanogaster.

В работе были поставлены следующие задачи:

1. Исследовать транскрипцию гена Grp на разных стадиях индивидуального развития D. melanogaster.

2. Исследовать экспрессию гена Grp на уровне транскрипции в разных органах и тканях D. melanogaster.

3. Клонировать ген Grp, экспрессировать его в условиях in vitro и выделить рекомбинантный белок.

4. Провести исследование структуры белка Grp физико-химическими и биоинформатическими методами.

5. Получить препараты антител (антисыворотки) к рекомбинантному белку Grp.

6. Изучить распределение белка Grp в разных органах и тканях D. melanogaster.

7. Исследовать экспрессию гена Grp на уровне трансляции на разных стадиях онтогенеза у D. melanogaster.

Научная новизна и практическая значимость работы Впервые осуществлено клонирование и исследование экспрессии гена Grp, гомолога гена gag ретротранспозонов. Показано, что ген Grp у D.melanogaster экспрессируется исключительно на стадии имаго, причем его экспрессия имеет тканеспецифичный характер.

Впервые получен рекомбинантный белок, соответствующий белковому продукту гена Grp, получены данные о его вторичной структуре, совпавшие с предсказанием вторичной структуры, полученным с помощью биоинформатических методов.

Впервые белковый продукт гена Grp был обнаружен в условиях in vivo, исследована его экспрессия на разных стадиях развития и в разных тканях у D.melanogaster.

Полученные данные могут быть использованы в дальнейшем для исследования вопросов, связанных с молекулярной доместикацией и ролью ретроэлементов в эволюции, а также для изучения функций доместицированного гена Grp и связи их с онтогенезом D.melanogaster.

Личное участие автора. Работа выполнена непосредственно автором.

Поставленные задачи решены с применением современных методов генетики, эмбриологии, иммунологии. Выводы сделаны на основании собственных оригинальных данных.

Апробация работы. Работа прошла апробацию на Всероссийской конференции посвященной 10-летию кафедры генетики БГПУ им. М.Акмуллы (Уфа, 2009), Международной конференции «Спорт: медицина, генетика, физиология, биохимия, педагогика, психология» (Уфа, 2011), XVII и XVIII Международных конференциях студентов, аспирантов и молодых ученых «Ломоносов-2010» и «Ломоносов-2011»

(Москва), семинарах лаборатории генетики животных и заседаниях кафедры генетики биологического факультета МГУ имени М.В.Ломоносова.

Публикации. По материалам диссертации опубликовано 6 печатных работ, из них статей в журналах, соответствующих Перечню ВАК – 2, тезисов докладов и материалов конференций – 4.

Структура и объем работы. Диссертационная работа изложена на странице, содержит 25 рисунков, 1 таблицу и состоит из следующих разделов:

введения, обзора литературы, материалов и методов, результатов исследования и их обсуждения, заключения, выводов и списка литературы, включающего 83 цитируемых источника.

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ Объект исследования: D.melanogaster, линия SS (Ким и др., 1989).

Штаммы: Escherichia coli JM109 (endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ (lac-proAB) e14- [F' traD36 proAB+ lacIq lacZM15] hsdR17(rK-mK+)), BL21 (E. coli B F dcm ompT hsdS(rB- mB-) gal [malB+]K-12(S)), Rosetta (F- ompT hsdSB(RB- mB-) gal dcm (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) pLysSRARE (CamR)).

Условия культивирования D.melanogaster, получение эмбрионов и личинок третьего возраста Дрозофилу культивировали в стандартных условиях при температуре 25°С на питательной агаризованной среде. Для получения эмбрионов самок и самцов исследуемой линии помещали на чашки Петри при температуре 25°С на ночь.

Эмбрионы собирали и помещали в пробирки объемом 1,5 мл для последующего выделения РНК.

Для получения личинок третьего возраста самцов и самок по 10 штук помещали в пробирки. Через 3 суток отбирали личинок в пробирки объемом 1,5 мл для последующего выделения РНК или подготовки проб для Вестерн-блота.

Выделение органов и тканей проводили у взрослых половозрелых самок.

Анестезированных эфиром мух вскрывали, отделяли яичники, кишечник и голову, оставшиеся ткани (корпус) также собирали.

Клетки E. coli культивировали на агаризованной или в жидкой среде LB производства «Amresco». Для селекции и выращивания (Luria-Bertani) трансформантов использовали канамицин (30мкг/мл в твердой среде, 15 мкг/мл в жидкой среде) и хлорамфеникол (12мкг/мл в твердой среде, 6 мкг/мл в жидкой среде).

Приготовление компетентных клеток и трансформацию E. coli осуществляли по стандартным методикам (Sambrook, Russel, 2001).

Выделение хромосомной и плазмидной ДНК осуществляли с использованием наборов «Genomic DNA Purification Kit» (Fermentas) для выделения хромосомной ДНК и «GeneJET Plasmid Miniprep Kit» (Fermentas) для выделения плазмид по протоколам фирмы-производителя. Плазмидную ДНК также выделяли методом кипячения (Sambrook, Russel, 2001).

Тотальную РНК выделяли с помощью набора «Promega» согласно протоколу.

Перед постановкой обратной транскрипции пробы по 3 мкг тотальной РНК обрабатывали ДНКазой I («Fermentas») для разрушения ДНК.

Обратную транскрипцию (ОТ) проводили с помощью набора для синтеза кДНК «Fermentas». В качестве матрицы использовали тотальную РНК, выделенную из органов или целых мух на разных стадиях развития.

Полимеразная цепная реакция. Приготовление реакционной смеси выполняли по протоколу фирмы «Fermentas». Реакцию проводили в амплификаторе Amply4 («Biokom»). В качестве матрицы использовали хромосомную ДНК и кДНК, полученную на РНК D. melanogaster. Проводили амплификацию фрагментов ДНК и кДНК гена Grp. При ПЦР с кДНК в качестве контроля амплифицировали фрагменты кДНК гена rp49.

ПЦР в реальном времени. Приготовление смеси с использованием набора реагентов «Master Mix (SYBR)» («Fermentas») проводили по протоколу фирмы производителя. Реакцию ставили в амплификаторе MiniOpticon Real-Time PCR System производства «Bio-Rad Laboratories». В опыте анализировали относительную экспрессию гена Grp, нормированную на уровень экспрессии референсного гена rp49.

Одновременно ставили отрицательные контроли для каждого образца - пробы, обработанные ДНКазой I и не прошедшие ОТ.

Праймеры для ПЦР. Для исследования экспрессии Grp c помощью ОТ-ПЦР использовали праймеры CG4680-f (GAACTTCGATGGCAGTGATC) и CG4680-r (GGTTGCCAATGCTCTTGAAC), для ПЦР в реальном времени – праймеры CG4680Q f (AACTTCGATGGCAGTGATCC) и CG4680Q-r (GCTCATTTGTCGCGTGAAGA), для клонирования полноразмерного Grp – праймеры Grp-f (ATACCATGGATCCCGAGTT) и для клонирования фрагмента Grp-r (TTAAGCTTCTTCCAAGCACT), Grp, соответствующего N-концевому участку белка, – праймеры Grp-f и Grp-r (ATGAATTCTGCTGTCCCTTGT), для положительного контроля с геном rp праймеры и rp49-f (CGATCTCGCCGCAGTAAAC) rp49-r – для обычной ПЦР, (ACCATCCGCCCAGCATACA) rp49-f-RT (GTATCGACAACAGAGTGCGT) и rp49-r-RT (GTTCTGCATGAGCAGGACCT) – для ПЦР в реальном времени.

Клонирование в векторе pET30 проводили по сайтам рестрикции NcoI и HindIII для получения полноразмерного Grp, по NcoI и EcoRI – для получения N концевого фрагмента Grp (GrpN). Рестрикцию проводили по протоколам фирмы производителя «Fermentas». Для лигирования с вектором использовали T4 ДНК лигазу («Fermentas») согласно протоколу фирмы.

Секвенирование. Клонированные фрагменты ДНК были секвенированы в фирме «Евроген».

Получение рекомбинантных белков. Для получения рекомбинантных белков штаммы E.coli BL21 и Rosetta трансформировали плазмидой pET30, содержащей открытую рамку гена Grp или е N-концевой фрагмент. В колбу с 200 мл бактериальной культуры, находящейся в логарифмической фазе роста, добавляли IPTG до конечной концентрации 1мМ и инкубировали при комнатной температуре в течение 16 ч. Полученную культуру осаждали центрифугированием при 10000 g в течение 5 мин, осадок ресуспендировали в 10 мл буфера для нанесения на колонку (0,5М NaCl, 5мМ имидазол, 10мМ фосфатный буфер pH 7,4 1мМ PMSF) и разрушали клетки ультразвуковым гомогенизатором УЗГ-0,1/22 («УЗТ»). Полученный лизат центрифугировали 20 мин при 16000 g, белок выделяли из супернатанта с помощью колонки HisTrap FF («GE Healthcare»). В протокол, рекомендованный производителем, была добавлена промывка растворами, содержащими 50 и 150мМ имидазола.

Качество полученного препарата оценивали с помощью электрофореза в полиакриламидном геле.

Электрофорез белков в полиакриламидном геле в присутствии SDS.

Электрофорез проводили в системе двух гелей: концентрирующего и разделяющего по модифицированной методике Лэмли (Laemli, 1970). Концентрирующий гель содержал 5%, разделяющий – 7,5% смеси акриламид/бисакриламид (29:1).

Электрофорез проводили в камере для вертикального электрофореза VE- («Хеликон») 1 ч при напряжении 80 В, затем 2-3 ч при напряжении 150 В. При проведении фореза для последующего иммуноблота концентрацию DTT в буфере для нанесения уменьшали до 5мМ.

Диализ растворов белков проводили в диализных трубках SERVAPOR («Serva»). 1 мл раствора белка в буфере для элюции с колонки HisTrap FF диализовали против 200 мл раствора PBS при 4°С в трех сменах буфера.

Иммунизация крыс. Крыс Вистар иммунизировали рекомбинантными белками Grp и GrpN в три этапа: первичная иммунизация 600 мкг/кг, через месяц поддерживающая иммунизация 250 мкг/кг и вторая поддерживающая иммунизация 250 мкг/кг через месяц после первой, иммуноген вводили подкожно. После первой поддерживающей иммунизации брали кровь для определения титра антител с помощью ИФА, сыворотку крови, которая использовалась для постановки вестерн блот гибридизации, получали после второй поддерживающей иммунизации.

Иммуноферментный анализ. На 96-луночные иммунологические плашки сорбировали рекомбинантный белок GrpN из раствора в буфере PBS с концентрацией 0,5 мкг/мл. Для оценки титра антител использовали серию из 11-ти разведений каждой сыворотки от 1:100 до 1:6000000, вторичные антитела, конъюгированные с пероксидазой хрена (НИИ эпидемиологии и микробиологии имени Н.Ф.Гамалеи) разводили в 5000 раз. Инкубацию с сыворотками и вторичными антителами проводили в течение 1 ч при 37°С, после отмывки от антител добавляли в лунки мкл раствора для детекции (2,6% двухводного цитрата натрия, 0,24% лимонной кислоты, 0,01% тетраметилбензидина, 0,006% пероксида водорода), реакцию останавливали через 15 минут добавлением 50 мкл 1Н серной кислоты и измеряли оптическую плотность раствора в лунках на длине волны 450 нм с помощью планшетного ридера Multiskan EX («Thermo electron corporation»).

Выделение тотального белка из материала, полученного из мух. Для экстракции белков материал растирали пестиком в 50мМ трис-буфере pH 6,8, содержащем 1% SDS, инкубировали при 70° в течение 10 мин, центрифугировали при 15000g 30 мин, супернатант собирали.

Измерение концентрации белка проводили с помощью набора реактивов «Bicinchoninic Acid Kit for Protein Determination» («Sigma») по протоколу фирмы.

Вестерн-блот гибридизация. Белки переносили из полиакриламидного геля на нитроцеллюлозную мембрану Hybond ECL («GE Healthcare») с помощью прибора для полусухого переноса Semi-dry («Хеликон»). Были использованы следующие разведения антител: сыворотка крови от иммунизированной крысы 1:5000, вторичные антитела, конъюгированные с пероксидазой (P-RAQ, «Имтек»), 1:50000. Инкубацию мембраны проводили с 10 мл раствора сыворотки 12 ч в полиэтиленовом пакете при 4°, в растворе вторичных антител инкубировали 1 ч при 37°. Для хемолюминесцентной детекции (ECL) использовали раствор, содержащий 0,1М Tris HCl pH 8,5, 12,5мМ люминол, 2мМ кумаровую кислоту, 0,09% пероксид водорода;

фотопленку Hyperfilm ECL («GE Healthcare»), проявитель Рентген-2, фиксаж БКФ-2.

Для окраски мембран на общий белок после иммуноблота мембрану инкубировали ч в 0,3% растворе амидового черного в 7%-ной уксусной кислоте, затем отмывали 5% ной уксусной кислотой.

Биоинформатические методы. Поиск гомологов гена Grp в секвенированных геномах разных видов Drosophila проводили с использованием программы TBLASTN (http://www.ncbi.nlm.nih.gov/ blast/Blast.cgi). Множественное выравнивание аминокислотных последовательностей проводили с помощью программы ClustalW Анализ вторичной структуры белка Grp (http://www.ebi.ac.uk/ClustalW2/).

осуществляли с применением нескольких биоинформатических программ: ТМНММ (http://www.cbs.dtu.dk/services/TMHMM-2.0/), PSIpred (http://bioinf.cs.

ucl.ac.uk/psipred/), PredictProtein (http://cubic.bioc.columbia.edu/predictprotein/), Jpred и JUFO (http://www.compbio.dundee.ac.uk/~www-jpred/) (http://meilerlab.

org/index.php/servers/show?s_id=8). Предсказание третичной структуры белка было сделано в программах I-Tasser и (zhanglab.ccmb.med.umich.edu/I-TASSER/) HMMSTR/Rosetta (http://www.bioinfo.rpi.edu/bystrc/hmmstr/server.php).

Спектр кругового дихроизма измеряли на спектрополяриметре Jasco- (США) в растворе белка с концентрацией 70 мкг/мл, в 10мМ фосфатном буфере, pH 7,4.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ Сравнительный анализ аминокислотных последовательностей гена Grp у разных видов семейства Drosophilidae Рис. 1. Множественное выравнивание аминокислотных последовательностей продукта гена Grp и его гомологов в геномах разных видах дрозофилы. Обозначения: pse – D.

pseudoobscura, per – D. persimilis, sim – D. simulans, sec – D. sechellia, mel – D. melanogaster, ere – D. erecta, yak – D. yakuba, eug – D. eugracilis, bia – D. biarmipes, rho – D. rhopaloa, ele – D. elegans, ana – D. ananassae, kik – D. kikkawai, vir – D. virilis, gri – D. grimshawi, wil – D.

willistoni.

Ранее в нашей лаборатории был идентифицирован ген-гомолог гена gag ДКП ретротранспозонов группы gypsy. Ген был обозначен Grp (Gag related protein).

Сравнительный анализ гомологов Grp из геномов разных видов дрозофилы, секвенированных к 2008 году, показал, что последовательность исследуемого гена высоко консервативна и находится под действием стабилизирующего отбора (Нефдова, Ким, 2009).

В настоящей работе нами проведен более широкий сравнительный анализ с использованием последовательностей 15 гомологов гена Grp из доступных на сегодняшний день секвенированных геномов разных видов дрозофилы (http://flybase.org). Результат выравнивания аминокислотных последовательностей представлен на рис. 1. Черным цветом выделены аминокислотные остатки, идентичные/высоко консервативные у всех выравниваемых последовательностей, серым – идентичные/высоко консервативные аминокислотные остатки у большинства выравниваемых последовательностей. Под выравниванием приведена консенсусная последовательность.

Результаты множественного выравнивания подтверждают сделанные ранее на небольшой выборке выводы о действии на исследуемый ген стабилизирующего отбора. Наиболее консервативны участки последовательности, заимствованные у gag, вариабельные участки не имеют отношения к последовательности gag, по всей видимости, они появились уже после доместикации.

Исследование экспрессии гена Grp на уровне транскрипции на разных стадиях развития D.melanogaster Нами была исследована экспрессия гена Grp на уровне транскрипции на разных стадиях развития дрозофилы. Уровень экспрессии оценивали с помощью метода ОТ ПЦР с праймерами к гену Grp. Для исследования были взяты эмбрионы, личинки и взрослые мухи. В качестве положительного контроля был взят ген рРНК rp49.

Результаты ПЦР представлены на рис. 2. Мы обнаружили экспрессию гена Grp у самцов и самок на стадии имаго, экспрессию гена Grp у эмбрионов и личинок третьего возраста обнаружить не удалось.

Различия в экспрессии на разных стадиях развития показывают, что ген Grp подвержен онтогенетической регуляции. По-видимому, его функция необходима только на имагинальной стадии, но не стадии эмбрионов и личинок. Принимая во внимание, что дрозофила – насекомое с полным превращением, можно предполагать, что ген Grp функционирует только во взрослых тканях, развивающихся из имагинальных дисков, а не в эмбриональных или личиночных тканях.

М М 1 2 3 4 1 2 3 ~850 пн ~300 пн Рис. 2. Сравнение экспрессии гена Grp на уровне транскрипции на разных стадиях развития D.melanogaster. Слева приведена электрофореграмма продуктов ПЦР с праймерами к гену Grp, справа – результат контрольной амплификации кДНК гена rp49. 1- эмбрионы, 2 личинки 3-го возраста, 3- самки, 4-самцы, М-маркер (GeneRuler™ 1 kb DNA Ladder, Fermentas). Стрелками указаны размеры продуктов ПЦР Сравнение экспрессии гена Grp на уровне транскрипции в тканях разных органов D.melanogaster Мы исследовали уровень транскрипции гена Grp в тканях кишечника, головы, яичников и корпуса (ткани которые остаются после выделения органов) выделенных из взрослых половозрелых самок D.melanogaster линии SS. Уровень экспрессии оценивали с помощью метода ОТ-ПЦР с праймерами к гену Grp (рис. 3). Обнаружено, что экспрессия гена Grp на уровне РНК обнаруживается в тканях кишечника, головы и каркаса, но практически не обнаруживается в тканях яичников.

Эксперимент с исследованием экспрессии в органах и тканях был повторен с использованием ПЦР в реальном времени (рис. 4.). Результаты показали, что уровень экспрессии гена Grp в яичниках оказался примерно в 500 раз ниже, чем в остальных исследованных органах.

М М 1 2 3 4 1 2 3 ~850 пн ~300 пн Рис. 3. Сравнение экспрессии гена Grp на уровне транскрипции в разных органах D.melanogaster. Слева приведена электрофореграмма продуктов ПЦР с праймерами к гену Grp, справа – результаты контрольной амплификации кДНК гена rp49. Обозначения:1 кишечник, 2- голова, 3- яичники, 4-корпус, М-маркер(GeneRuler™ 1 kb DNA Ladder, Fermentas). Стрелками указаны размеры продуктов ПЦР.

0, 0, кишка яичники корпус+голова Рис.4. Относительный уровень экспрессии гена Grp в разных органах (логарифмическая шкала) Таким образом, мы показали, что ген Grp специфически экспрессируется только в соматических тканях дрозофилы. Различия в экспрессии на разных стадиях развития и в разных органах предполагают наличие механизма регуляции экспрессии гена Grp. Тканеспецифическая регуляция экспрессия гена Grp у имаго дрозофилы осуществляется на стадии транскрипции.

Биоинформатический анализ структуры продукта гена Grp Биоинформатический анализ аминокислотной последовательности продукта гена Grp с помощью нескольких программ, позволяющих предсказывать вторичную и третичную структуру белка и возможность связывания с коферментами. Известно, что точность предсказания вторичной структуры современными методами достаточно высока, точность предсказания третичной структуры сильно зависит от наличия близких белков с уже известной третичной структурой. В нашем случае достоверно лишь предсказание вторичной структуры. Несколько программ дали сходные результаты: оказалось, что примерно половина последовательности белка образует альфа-спиральные структуры, а половина находится в виде неупорядоченных петель.

Бета-слоев практически не обнаружено. Программой PSIpred было предсказано наличие у белка трансмембранного домена. Сайтов связывания Grp низкомолекулярных лигандов и коферментов выявлено не было. Такая вторичная структура характерна для многих глобулярных белков с различными функциями.

Клонирование гена Grp в составе экспрессионного вектора pET Для исследования белкового продукта гена Grp мы клонировали этот ген в плазмиде pET30, и трансформировали полученной конструкцией клетки E.coli штамма BL21. Плазмида pET30 в своем составе несет промотор, индуцируемый IPTG, позволяющий получать рекомбинантный белок со встроенного в плазмиду гена и последовательность ДНК, кодирующую шесть идущих подряд гистидинов для очистки белка с помощью His-Tag колонки. Полученный нами рекомбинантный белок экспрессировался у E.coli преимущественно в нерастворимой форме в виде телец включения. При снижении ионной силы, которое происходит при диализе белка, растворенного буфере для элюции, против буфера PBS значительная часть белка выпадала в осадок, в растворе оставался рекомбинантный белок в концентрации 0,1 0,3 мг/мл.

По-видимому, гидрофобная последовательность трансмембранного домена, существование которого было предсказано биоинформатическими методами, может способствовать агрегации рекомбинантного белка и/или препятствовать его сворачиванию в структуру, близкую к нативной. Было принято решение клонировать тем же способом N-концевой фрагмент белка Grp до границы с предсказанным трансмембранным доменом. Полученный рекомбинантный белок GrpN также образовывал тельца включения и частично выпадал в осадок при диализе, но выделялся в растворимой форме в большем количестве, при диализе против PBS концентрация белка в препарате также была выше, чем в случае полноразмерного Grp (0,5-1,5 мг/мл).

Поскольку для удалось получить препараты с более высокой GrpN концентрацией белка, чем в случае полноразмерного Grp, мы использовали его в ряде экспериментов, не требующих присутствия полноразмерного белка, например в ИФА.

Исследование вторичной структуры рекомбинантного белка Grp c помощью измерения спектра кругового дихроизма Для того чтобы проверить предсказание вторичной структуры белка Grp, мы проанализировали спектр кругового дихроизма рекомбинантного белка Grp на спектрополяриметре Jasco-815. Метод заключается в измерении разницы в поглощении раствором белка лево- и правополяризованного света при разной длине его волны. Исследование спектра кругового дихроизма позволяет установить наличие у изучаемого белка различных элементов вторичной структуры (альфа-спиралей, бета-слоев и неупорядоченных структур) и количественно оценить, какая доля аминокислотной последовательности образует тот или иной тип вторичной структуры. Анализ показал, что около половины аминокислотной последовательности рекомбинантного Grp представлено альфа-спиральными участками, вторая половина имеет конформацию неупорядоченных петель. Таким образом, экспериментальные данные совпали с биоинформатическим предсказанием вторичной структуры. По видимому, альфа-спирали образуют один или несколько глобулярных доменов со строением, похожим на строение белка gag или белка капсида вируса табачной мозаики (ВТМ).

Иммунизация крыс рекомбинантными белками Grp и GrpN и получение препарата антител Полученные рекомбинантные белки были использованы для иммунизации крыс Вистар. Четверо животных были иммунизированы полноразмерным рекомбинантным белком Grp, четверо – его N-концевым фрагментом (GrpN). После первой поддерживающей иммунизации было проверено наличие у крыс антител к рекомбинантному белку Grp с помощью иммуноферментного анализа. На рис. 5.

представлены графики зависимости величины сигнала в ИФА в зависимости от разведения сывороток.

Самый высокий титр антител оказался у крысы № 11, которую иммунизировали полноразмерным рекомбинантным белком Сыворотку этого животного Grp.

использовали для постановки вестерн-блот гибридизации с экстрактом из мух.

1, 1, 1, 0, OD 0, 0, 0, 0, уровень фона Разведение сыворотки Рис. 5. Проверка сывороток иммунизированных крыс с помощью ИФА. Справа указаны индивидуальные номера животных.

Вестерн-блот гибридизация с экстрактами имаго D.melanogaster Для поиска белкового продукта гена Grp in vivo была поставлена вестерн гибридизация тотального экстракта белков, выделенных из взрослых особей D.melanogaster с сывороткой крысы № 11. Анализировали серию из пяти разведений экстракта. На каждую дорожку геля наносили от 0,08 до 20 мкг тотального белка.

Фотографии иммуноблота и нитроцеллюлозной мембраны, окрашенной на общий белок представлены на рис. 6.

На иммуноблоте обнаруживается полоса, интенсивность которой уменьшается в серии разведений, причем другие полосы, которые обнаруживаются в пробах, содержащих большое количество белка (5 мкг и более), способное вызвать неспецифическое связывание антител, исчезают в серии разведений значительно раньше. При окраске мембраны на белок амидовым черным не обнаруживается полос, содержащих большое количество белка на фоне рассматриваемой полосы. Это свидетельствует о специфическом связывании антител с одним из белков из экстракта мух.

кДа 20 5 1,25 0,31 0,08 M 20 5 1,25 0,31 0, мкг мкг мкг мкг мкг мкг мкг мкг мкг мкг ~ кДа Рис. 6. Иммуноблот с экстрактом из имаго D.melanogaster. Слева окраска мембраны на белок красителем амидовый черный, справа сигнал от окраски антителами. М-маркер (Prestained Protein Molecular Weight Marker, Fermentas).

Таким образом, показано, что ген Grp экспрессируется не только на уровне транскрипции, но и на уровне трансляции у имаго D.melanogaster.

Вестерн-блот гибридизация с экстрактами, выделенными из различных органов и тканей D.melanogaster на разных стадиях развития Для того чтобы убедиться в том, что обнаруженная на иммуноблотах полоса является белковым продуктом гена Grp, мы поставили вестерн-блот гибридизацию с белковыми экстрактами из разных тканей, выделенных на разных стадиях развития дрозофилы. Анализу подвергали экстракты белка, выделенные из самок, самцов, органов самок (голова, кишечник, яичники, корпус), а также эмбрионов, личинок третьего возраста и куколок) (рис. 7 и 8).

кишечник голова яичники корпус самки самцы целиком целиком Рис. 7. Результаты вестерн-блот гибридизации белковых экстрактов из различных органов и тканей D.melanogaster. Наблюдаемые полосы соответствуют полосе 50 кДа на рис. 6.

эмбрионы личинки куколки имаго самки имаго самцы Рис. 8. Результаты вестерн-блот гибридизации белковых экстрактов, выделенных из разных стадий развития D.melanogaster. Наблюдаемые полосы соответствуют полосе 50 кДа на рис. 6.

Концентрация тотального белка в экстрактах была выровнена, наносили по 1, мкг тотального белка на дорожку – это разведение экстракта, для которого отсутствует неспецифическое связывание антител с белками на блоте. Показано, что положительный результат вестерн-блот гибридизации совпадает с профилями экспрессии гена Grp на уровне РНК. Это свидетельствует о том, что обнаруженный белок действительно является продуктом гена Grp.

Однако обнаруженный белок несколько не соответствует предсказанному по размеру (50 кДа вместо 40 кДа). Это расхождение может быть вызвано несколькими причинами. Во-первых, в условиях денатурирующего электрофореза можно определить молекулярную массу белка весьма приблизительно, некоторые белки могут иметь подвижность, сильно отличающуюся от предсказанной на основе их молекулярного веса. Во-вторых, изменение подвижности может быть связано с различными видами посттрансляционной модификации, например гликозилированием или фосфорилированием. Такая посттрансляционная модификация характерна для эукариотических белков, в том числе для белков, выполняющих сигнальную функцию. По приблизительной оценке, содержание белка Grp в тотальном белковом экстракте составляет 1 мкг на мг общего белка, т.е. около 1/1000 от общего содержания белка в клетках имаго дрозофилы.

ЗАКЛЮЧЕНИЕ В данной работе проведено комплексное исследование гена Grp, геномного структурного гомолога гена gag ретротранспозонов/ретровирусов группы gypsy D.melanogaster. Было установлено, что ген Grp активно экспрессируется in vivo, однако его экспрессия на уровне транскрипции наблюдается только на имагинальной стадии развития D.melanogaster и выявляется только в соматических тканях, демонстрируя тканеспецифический характер экспрессии. В клетках имаго был обнаружен и белковый продукт гена По-видимому, он обладает Grp.

трансмембранным доменом и имеет глобулярную структуру, преимущественно состоящую из альфа-спиралей и неупорядоченных петель. Так же, как и на уровне транскрипции, он экспрессируется в соматических тканях. Таким образом, установлено, что Grp, локализованный в хозяйском геноме дрозофилы, – это реально функционирующий ген. По-видимому, он появился в геноме D.melanogaster в результате доместикации гена gag ретротранспозона, принадлежащего к группе gypsy.

Можно предполагать, что ген Grp является одним из компонентов иммунитета дрозофилы. Об этом свидетельствуют факты о повышении экспрессии гена Grp в ответ на липополисахариды грамотрицательных бактерий (Silverman et.al., 2003).

Возможно его участие и в защите от вирусной инфекции. Известны случаи доместикации гена ретротранспозонов млекопитающих, когда gag доместицированные гены стали участвовать в противовирусной защите. Такой иммунитет, вероятно, осуществляется только в соматических тканях дрозофилы, происходящих из клеток имагинальных дисков, а не эмбриональных и личиночных.

Можно предполагать, что защита генеративных клеток, а также эмбриональных и личиночных клеток вовлекает иной механизм. Возможная модификация белка Grp и наличие в его структуре трансмембранного домена позволяют предполагать, что белок Grp, локализован в мембране клеток имаго дрозофилы и выполняет сигнальную и/или рецепторную функцию.

ВЫВОДЫ 1. Исследование транскрипции на разных стадиях развития D.melanogaster показало, что ген Grp экспрессируется на имагинальной стадии онтогенеза, тогда как у эмбрионов и личинок РНК Grp не обнаружена. По-видимому, функция гена Grp необходима для обеспечения процессов, осуществляющихся на взрослой стадии онтогенеза.

2. Исследование экспрессии гена Grp на уровне транскрипции в разных органах и тканях D.melanogaster показало, что РНК Grp выявляется в соматических тканях (головы, кишечника, корпуса), а в гонадах – лишь в следовых количествах (~ в 500 раз меньше). Вероятно, тканеспецифичность экспрессии гена Grp свидетельствует о том, что он функционирует в тканях, контактирующих с окружающей средой.

3. Ген Grp клонирован, получен рекомбинантный белок Grp и его N-концевой фрагмент, которые были использованы для получения препаратов антител.

4. Обнаружена экспрессия гена Grp на уровне трансляции, причем профили распределения белка и РНК на разных стадиях онтогенеза и в различных органах и тканях совпадают. По-видимому, экспрессия гена Grp на этапе трансляции не репрессируется и не имеет специфического механизма регуляции.

5. Биоинформатический анализ аминокислотной последовательности белка Grp и исследование спектра кругового дихроизма показало, что белок имеет трансмембранный домен и альфа-спиральные участки, чередующиеся с неупорядоченными петлями. Предположительно белок Grp имеет глобулярную структуру, напоминающую структуру белка Gag ретровирусов.

6. На основании аномальной электрофоретической подвижности можно предполагать, что белок Grp подвергается посттрансляционной модификации.

По-видимому, белок Grp может локализоваться в мембране соматических клеток имаго дрозофилы и может выполнять сигнальную и/или рецепторную функцию.

Список работ опубликованных по теме диссертации Статьи в журналах, соответствующих Перечню ВАК:

1. Нефедова Л.Н., Кузьмин И.В., Бурмистрова Д.А., Резазадех С., Ким А.И.

Анализ транскрипции гена Grp, геномного гомолога гена gag ретротранспозона gypsy, у Drosophila melanogaster // Генетика. 2011. Т. 47. № 8. С. 1032-1036.

2. Кузьмин И.В., Шнырева А.А., Нефедова Л.Н., Ким А.И. Анализ экспрессии гена Grp, геномного гомолога гена gag ретротранспозона gypsy Drosophila melanogaster, на уровне трансляции // Генетика. 2011. Т. 47. № 9. С. 1275-1277.

Материалы и тезисы конференций:

1. Кузьмин И.В., Бурмистрова Д.А., Урусов Ф.А., Нефедова Л.Н., Ким А.И.

Исследование экспрессии гомолога гена gag ДКП-ретротранспозона gypsy у Drosophila melanogaster. В кн.: Инновационные и молекулярно-генетические исследования живых систем. Труды Всероссийской конф., посвященной 10 летию кафедры генетики БГПУ им. М.Акмуллы. Уфа: Изд-во БГПУ. 2009. С.

92-94.

2. Кузьмин И.В., Нефедова Л.Н., Ким А.И. Изучение экспрессии гена Grp, гомолога ОРС gag ретротранспозона gypsy у Drosophila melanogaster. В кн.:

Спорт: медицина, генетика, физиология, биохимия, педагогика, психология.

Материалы Международной конференции. Уфа, 21-25 ноября 2011 г. Изд-во БГПУ. С. 83-87.

3. Кузьмин И.В. Бурмистрова Д.А. Исследование экспрессии гомологов генов эррантивирусов международная научная Drosophila melanogaster. XVII конференция студентов, аспирантов и молодых ученых Ломоносов – секция «биология» тезисы докладов. С. 86.

4. Кузьмин И.В. Шнырева А.А. Исследование экспрессии и функции гена Grp, гомолога гена gag ретротранспозона gypsy у Drosophila melanogaster. XVIII международная научная конференция студентов, аспирантов и молодых ученых Ломоносов – 2011 секция «биология» тезисы докладов. С. 80.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.