авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Взаимодействие р130 – белка семейства prb, и -катенина – передатчика сигналов wnt, в ходе дифференцировки и трансформации мезенхимных стволовых клеток мыши

На правах рукописи

ПЕТРОВ

Николай Сергеевич

Взаимодействие р130 – белка семейства pRb,

и -катенина – передатчика сигналов Wnt, в ходе

дифференцировки и трансформации мезенхимных

стволовых клеток мыши

03.03.04 – клеточная биология, цитология, гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Санкт-Петербург 2012

Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт цитологии Российской академии наук (Санкт-Петербург)

Научный руководитель: кандидат медицинских наук, старший научный сотрудник Попов Борис Валентинович Федеральное государственное бюджетное учреждение науки Институт цитологии РАН

Официальные оппоненты: доктор биологических наук, профессор Поспелов Валерий Анатольевич Федеральное государственное бюджетное учреждение науки Институт цитологии РАН доктор биологических наук, профессор Перевозчиков Андрей Петрович Федеральное государственное бюджетное учреждение Научно-исследовательский институт экспериментальной медицины СЗО РАМН

Ведущая организация: Федеральное государственное бюджетное учреждение Научно-исследовательский институт онкологии имени Н.Н. Петрова Минздравсоцразвития России

Защита состоится «22» июня 2012 года в 14 часов на заседании Диссертационного совета Д 002.230.01 при Институте цитологии РАН по адресу:

194064, Санкт-Петербург, Тихорецкий пр., д. 4.

Сайт института: http://www.cytspb.rssi.ru Адрес электронной почты института: cellbio@mail.cytspb.rssi.ru Факс института: (812)297-35-

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН.

Автореферат разослан «» мая 2012 г.

Ученый секретарь Диссертационного совета кандидат биологических наук Е.В. Каминская

Общая характеристика работы

Актуальность проблемы. Исследование возможности замещения клеток и тканей различных органов является актуальной задачей современной клеточной биологии в связи с увеличением продолжительности жизни, возрастанием числа геронтологических заболеваний и необходимостью восстановления органов, утративших свои функции. Мезенхимные стволовые клетки (МСК), являющиеся одним из типов соматических стволовых клеток, привлекают к себе внимание как потенциальный ресурс для регенеративной терапии благодаря относительной простоте их получения и широкому дифференцировочному потенциалу. МСК in vivo могут превращаться в клетки не только исходного мезодермального, но эктодермального и энтодермального происхождения. Свойство МСК приобретать необычный фенотип и несвойственные им в нормальных условиях функции – пластичность – не достаточно хорошо исследовано и является объектом изучения научных лабораторий во всем мире.

В основе пластичности МСК лежит эпигенетическое репрограммирование и трансдифференцировка МСК в клеточные линии, происходящие из различных зародышевых листков. В литературе описаны несколько моделей для изучения трансдифференцировки МСК в клетки энтодермального происхождения различной тканевой специфичности. Однако к настоящему моменту не существует модели, предоставляющей возможность для анализа внутриклеточных событий в отдельных клетках в процессе энтодермальной трансдифференцировки. Специализация СК опосредована взаимодействием молекул множества сигнальных путей. Среди них у зрелых животных ключевую роль играет сигнальный путь Wnt/-катенин. Сигналы этого пути широко используются в закладке и формировании тканей и органов в процессе эмбрионального развития. В организме зрелого животного сигнальный путь Wnt/-катенин играет ключевую роль в поддержании функций СК различных тканей, а конститутивное повышение его активности сопряжено с возникновением опухолей.

Функционирование сигнального пути Wnt/-катенин осуществляется в контексте клеточного цикла, негативным регулятором которого является семейство продукта гена ретинобластомы (pRb). Члены семейства pRb осуществляют эффекторный контроль хода клеточного цикла путем взаимодействия с транскрипционными факторами семейства E2f. В свою очередь, белки E2f регулируют синтез и активность молекул, составляющих машину клеточного цикла. При планировании настоящей работы мы основывались на хорошо известных данных о том, что р130, член семейства pRb, взаимодействует с сигнальными молекулами других регуляторных путей в контрольных точках клеточного цикла.

Взаимодействие р130 с -катенином – основным передатчиком в сигнальном пути Wnt/ катенин, в точке R1 фазы G1 опосредовано Gsk3, которая фосфорилирует как р130, так и катенин. Изучение механизма такого взаимодействия и его функциональной роли может быть важным для понимания механизма пластичности МСК и моделирования их практического использования в регенеративной терапии заболеваний человека.

Цель и задачи исследования Цель работы: исследовать взаимодействие -катенина – передатчика сигналов Wnt, и р130 – члена семейства pRb, в ходе дифференцировки и трансформации мезенхимных стволовых клеток in vitro.

Задачи работы:

Изучить возможность индукции энтодермальной дифференцировки МСК путем их 1.

кокультивирования с клетками линии А-549, происходящими из эпителия легких, и изучить роль экспрессии гена WNT2 в клетках А-549 в механизме индукции такой дифференцировки.

Охарактеризовать состояние р130 и -катенина в МСК в различных фазах клеточного 2.

цикла и при активации сигнального пути Wnt/-катенин.

Изучить механизм формирования комплекса р130 с -катенином, изменения состава 3.

комплекса в ходе клеточного цикла, при активации сигнального пути Wnt/-катенин, а также его потенциальную роль в транскрипционной регуляции генов, содержащих в промоторах сайты связывания факторов семейства LEF/TCF.

Оценить пролиферативную, дифференцировочную, клоногенную, адгезивную и 4.

туморогенную активность МСК, уровень ядерного -катенина и транскрипционных факторов Tcf3,4 в процессе длительного пассирования МСК.

Основные положения, выносимые на защиту МСК, кокультивированные с клетками линии А-549 в условиях разделения клеточно 1.

непроницаемой мембраной, показывают активацию сигнального пути Wnt/-катенин и экспрессию легочных эпителиальных маркеров;

торможение экспрессии гена WNT2 в клетках А-549 с помощью малой интерферирующей РНК отменяет активацию -катенина в кокультивируемых МСК;

совместное культивирование с клетками А-549 можно рассматривать в качестве модели паракринной индукции эпителиальной дифференцировки МСК in vitro.

В асинхронно делящихся или синхронизированных в фазах G0/G1, S, и G2/M 2.

клеточного цикла МСК уровень и рисунок фосфорилирования -катенина и р130 существенно не изменяются;

индукция сигнального пути Wnt/-катенин ведет к активации -катенина, р и E2f4, однако комплекс р130/E2f4 не вызывает торможения деления МСК.

В МСК -катенин, р130 и Gsk3 взаимодействуют между собой и формируют комплекс, 3.

включающий в свой состав факторы E2f4, Tcf3,4, и проявляющий транскрипционную активность при экспрессии экзогенного -катенина и р130.

В ходе длительного культивирования МСК повышается их пролиферативная, снижается 4.

дифференцировочная и адгезивная активность, на 43-47-м пассаже клетки становятся туморогенными и образуют опухоли при введении сингенным животным;

приобретение туморогенности при длительном культивировании МСК сопряжено с накоплением внутриядерного -катенина и транскрипционных факторов Tcf3,4.

Научная новизна полученных результатов. Впервые показано, что при совместном культивировании с клетками линии А-549 в условиях разделения клеточно-непроницаемой мембраной в МСК активируется сигнальный путь Wnt/-катенин и экспрессируются эпителиальные маркеры. Впервые установлено, что активация сигнального пути Wnt/-катенин в кокультивируемых МСК может вызываться фактором Wnt2, секретируемым клетками А-549, поскольку торможение в них экспрессии гена WNT2 с помощью стабильной продукции малой интерферирующей РНК против мРНК WNT2 отменяет активацию -катенина в МСК. Новым является то, что кокультивирование МСК и клеток линии А-549 в условиях их разделения клеточно-непроницаемой мембраной можно рассматривать в качестве модели паракринной индукции эпителиальной дифференцировки МСК. Впервые найдено, что уровень и рисунок фосфорилирования р130 в ходе клеточного цикла в МСК не изменяется в противоположность соматическим дифференцирующимся клеткам линии T98G. Проведенный нами анализ механизма этого феномена впервые позволил выяснить, что индукция в МСК канонического сигнального пути Wnt ведет к активации его основного передатчика – -катенина, а также члена семейства pRb, белка р130, и транскрипционного фактора E2f4, которые формируют комплекс р130/E2f4. Этот комплекс поддерживает некоторые линии соматических дифференцирующихся клеток в состоянии покоя, но в МСК не проявляет супрессорной активности, что, возможно, связано с включением в его состав -катенина. Мы показали, что в МСК -катенин и р130 физически взаимодействуют между собой, формируя с Gsk комплексы, включающие в свой состав различно фосфорилированные формы р130 и транскрипционные факторы семейства LEF/TCF – Tcf3,4. Комплексы р130-Gsk3--катенин Tcf3,4 обладают транскрипционной активностью. Мы установили, что в ходе длительного культивирования значительно возрастает пролиферативная активность МСК, они утрачивают способность к дифференцировке и приобретают туморогенность, формируя опухоли при подкожном или внутримышечном введении сингенным мышам-реципиентам. Новым в изучении механизма туморогенности является то, что ее возникновение в МСК связано с повышением уровня и накоплением в ядре клеток активных форм -катенина и транскрипционных факторов Tcf3,4.

Теоретическое и практическое значение работы. Теоретическое значение работы заключается в разработке новой модели паракринной индукции эпителиальной дифференцировки МСК in vitro путем их совместном культивирования с клетками линии А- эпителиального происхождения в условиях разделения клеточно-непроницаемой мембраной.

Важным результатом работы является получение новых доказательств взаимодействия в МСК сигнальных путей Wnt/-катенин и семейства гена ретинобластомы (pRb) путем формирования комплекса р130-Gsk3--катенин. Мы впервые обнаружили, что комплекс р130-Gsk3- катенин в МСК существует в разных фазах клеточного цикла и обладает транскрипционной активностью по отношению к генам, содержащим сайты связывания белков семейства LEF/TCF. Опухолевая трансформация МСК в ходе их длительного культивирования сочетается с повышением уровня, перераспределением -катенина внутри клетки и его конститутивной активацией. Практическое значение работы заключается в том, что она предоставляет возможность рассматривать комплекс р130-Gsk3--катенин в качестве мишени фармакологической коррекции при разработке подходов и методов регуляции поведения нормальных и опухолевых стволовых клеток в экспериментальных моделях регенеративной терапии и лечения злокачественных заболеваний. Полученные данные используются при чтении курса лекций «Введение в клеточную биологию стволовых клеток» на медицинском и биолого-почвенном факультетах Санкт-Петербургского государственного университета.

Апробация работы. По теме диссертации опубликовано 10 печатных работ (5 статей в рецензируемых научных журналах и 5 тезисов докладов на научных конференциях).

Результаты диссертации представлены на II Съезде Всероссийского общества клеточной биологии (Санкт-Петербург, 2007);

4-й Российской конференции по фундаментальной онкологии (Санкт-Петербург, 2008);

Всероссийской научной школе-конференции «Аутологичные стволовые клетки: экспериментальные и клинические исследования» (Москва, 2009);

II Конференции молодых ученых Института цитологии РАН (Санкт-Петербург, 2010), международной конференции «Stem Cells Update – From Basic Research to the Clinic» (Уппсала, Швеция, 2011).

Финансовая и некоммерческая поддержка работы. Работа выполнена при финансовой поддержке Российского фонда фундаментальных исследований (проекты 06-04 48439, 09-04-00595), Правительства Санкт-Петербурга (грант 2.6107-06.099). Автор выражает глубокую благодарность сотрудникам ИНЦ РАН Н.Н. Никольскому, Е.Н. Толкуновой, А.Н.

Томилину, В.А. Поспелову, В.В. Зенину, Г.И. Штейну, В.М. Михайлову;

д-ру Чангу (LS Chang, Children’s Hospital, Ohio State University, Columbus, США), д-ру Попову (N. Popov, University of Wurzburg, Germany), д-ру Прокопу (D. Prockop, Tulane University, Florida, США) за предоставленные клеточные линии, реактивы, конструкции и антитела (перечислены в разделе «Материалы и методы»), возможность использовать приборы и консультативную помощь в освоении методов.

Вклад автора. Автором лично проведены эксперименты, включающие культивирование клеток, анализ их пролиферативных, дифференцировочных, клоногенных и туморогенных свойств, иммунофлюоресцентное окрашивание, иммуноблотинг, иммунопреципитацию, трансфекцию клеток, люциферазный анализ, торможение экспрессии гена WNT2 методом интерференции РНК, и обработаны экспериментальные данные. Проточно цитометрический анализ проведен В.В. Зениным и Ю.М. Розановым, TaqMan ПЦР выполнена в компании Applied BioSystems (Foster City, Калифорния, США). Материалы, вошедшие в представленную работу, обсуждались и публиковались совместно с соавторами и научным руководителем.

Структура и объем диссертации. Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, результатов, их обсуждения, выводов и списка литературы, включающего 168 ссылок. Работа изложена на 120 страницах машинописного текста и иллюстрирована 3 таблицами и 33 рисунками.

Материалы и методы исследований Клеточные линии и культивирование клеток. Клеточные линии мышиных эмбриональных фибробластов C3H10T1/2 (10T1/2), мышиных миобластов С2С12, нeмелкоклеточной карциномы легкого человека А-549, чешуйчатой клеточной карциномы Calu-3, глиобластомы человека T98G получены из Американской коллекции клеточных культур (ATCC). Клетки эмбриональной почки человека HEK 293T любезно предоставлены д ром А.Н. Томилиным (Институт цитологии РАН). В работе использованы две линии МСК мыши: одна получена ранее в нашей лаборатории, другая любезно предоставлена д-ром Д.

Прокопом (D. Prockop, Tulane University, Флорида, США). Все клетки культивировали в СО2 инкубаторе в газовой смеси, содержащей 95 % воздуха и 5 % СО2, при 37 °С и относительной влажности 100 % в ростовой среде (РС) DMEM, содержащей 10 % фетальной бычьей сыворотки (ФБС), 25 мМ Hepes, 100 ед/мл пенициллина, 100 мкг/мл стрептомицина. Для оценки клоногенности МСК или клетки эксплантатов опухоли (КОЭ) высевали по 400 и клеток в 60 мм пластиковые чашки и культивировали в стандартной РС в течение 3 недель.

Выросшие колонии окрашивали красителем генциан-фиолетовым и подсчитывали визуально.

Пролиферативную активность оценивали по времени удвоения, для определения которого МСК помещали в три ячейки 24-луночного планшета в 0.5 мл РС по 4 104/лунку. Через 48 ч число клеток подсчитывали с трипановым синим, опыт повторяли 5-7 раз. Время удвоения (D) определяли по формуле: D=tlogXf/Xo2, где t – время культивирования, Xf/Xo – число клеток в конце и начале эксперимента, соответственно. Оценку туморогенности проводили при трансплантации МСК 12-15-го или 43-47-го пассажей сингенным мышам-реципиентам. КОЭ получали в стерильных условиях путем измельчения кусочка ткани опухоли, полученной при подкожном введении МСК сингенным мышам. Ткань опухоли помещали в РС в миллиметровую культуральную чашку на 72 ч. Мигрировавшие из ткани клетки отделяли от пластика раствором трипсина и культивировали в тех же условиях, что и МСК.

Разработка модели in vitro для изучения направленной дифференцировки МСК в клетки легочного эпителия. Для индукции дифференцировки МСК в энтодермальном направлении их совместном культивировали с клетками линии А-549. 1 105 клеток A- ресуспендировали в 1 мл РС и помещали в верхний отдел лунки 6-луночной пластины (Costar, США), отделенный от нижнего отдела покрытой коллагеном полунепроницаемой мембраной Transwell с размером пор 0.4 мкм (Corning, США) (Рис. 4). В нижний отдел той же лунки добавляли 3 мл РС и покровные стекла для микроскопии, а через 24 ч помещали 1 105 МСК.

Через 72-96 ч от начала кокультивирования покровные стекла с распластанными клетками использовали для иммунофлюоресцентного анализа, а клетки на пластике – для анализа экспрессии мРНК и белков. Контрольные МСК культивировали без клеток линии А-549.

Для активации -катенина клетки инкубировали в течение 4 ч в РС, содержащей 10-20 мМ LiCl, ингибирующего Gsk3 (Stambolic et al., 1996), а фосфорилированный -катенин определяли в них после добавления в РС на 30 мин ингибитора белковых фосфатаз – каликулина А (Sigma, США).

Трансфекция клеток. Клетки HEK 293T трансфицировали при помощи реактива 293Fectin™ Transfection Reagent (Invitrogen, Великобритания) согласно протоколу производителя. Через 48 ч после трансфекции клетки использовали для анализа экспрессии рекомбинатных белков. Клетки А-549 и МСК трансфицировали при помощи электропорации (X-cell Pulser, BioRad, США).

Метод люциферазного репортера для оценки транскрипционной активации генов, содержащих сайты связывания белков семейства LEF/TCF. Репортерные конструкции, содержащие в регуляторной области перед минимальным промотором c-Fos 7 сайтов связывания белков семейства LEF/TCF (TOPflash) и кодирующую последовательность гена люциферазы, соответствующую контрольную конструкцию с мутацией сайтов связывания LEF/TCF (FOPflash) (Korinek et al., 1997);

экспрессионный вектор, кодирующий -катенин с мутацией Ser33Аla;

плазмиды, содержащие гены р130 и -галактозидазы, вводили в МСК или клетки 293Т в различных комбинациях, позволяющих выявить трансактивирующую роль катенина и транссупрессирующую роль р130. Активность люциферазы определяли по интенсивности свечения после добавления к клеточным экстрактам реактива Glo-lisis (Promega, США). Для нормализации количества люциферазы в разных пробах использовали активность -галактозидазы.

Анализ экспрессии мРНК. Анализ экспрессии мРНК при помощи TaqMan ПЦР в реальном времени был выполнен в Applied BioSystems (Foster City, Калифорния, США). Для этого исследования готовили по 4 отдельные пробы контрольных МСК и МСК, кокультивированных с клетками А-549 в течение 72 ч. Была исследована экспрессия следующих мышиных генов: цитокератинов 5, 8, 14, 18 и 19;

ZO-1 (Zonula Occludens-1), pro SP-c (сурфактант-ассоциированный белок C), HOXC4, CD45, CD31, актина, GAPDH.

Получение РНК, электрофорез РНК в денатурирующем геле и ее количественная оценка. РНК получали из осадков клеток, лизированных в гуанидинтиоцианатном буфере (Chomczynski, Sacchi 1987), пробы РНК подвергали электрофорезу в денатурирующем геле с формальдегидом. После электрофореза РНК в геле визуализировали по свечению полос 18S и 28S, окрашенных бромистым этидием. Выравнивание количества РНК в различных пробах производили после определения интенсивности полосы 28S на соответствующих дорожках с помощью программного продукта TotalLab Quant.

Синтез кДНК на матрице РНК и амплификация фрагментов генов с помощью ревертированной полимеразной цепной реакции (ОТ-ПЦР). Синтез кДНК проводили, используя тотальную РНК, праймер олиго-дТ18 и обратную транскриптазу;

ПЦР амплификацию выполняли на циклере PCR Script (Hybade, Великобритания) при температурном режиме, одинаковом для обеих пар праймеров к WNT2. Праймеры были синтезированы в компании «Бигль» (Россия, Санкт-Петербург) (Таблица 1).

Таблица Последовательности праймеров для амплификации кДНК гена WNT2 и ингибирования его экспрессии Ген Прямой праймер (5’ – 3’) Обратный праймер (5’ – 3’) Размер 279 п.о.

WNT2- 1 GCCCCTCTCGGTGGAATCTGGCTC GCTGTGATCCCTGTCCAGGGTGTT 209 п.о.

WNT2 -2 CATGGTGGTACATGAGAGCTAC GCTGTGATCCCTGTCCAGGGTGTT 238 п.о.

GAPDH GAGTCAACGGATTTGGTCGT TTGATTTTGGAGGGATCTCG 19 нт WNT2-si1 GCAAAGGAAAGGAAAGGAA 19 нт WNT2-si2 GATCCAAAGAAGATGGGAA 19 нт WNT2-siK CATAAGCTGAGATACTTCA Ингибирование экспрессии гена WNT2 с помощью метода интерференции РНК.

Торможение экспрессии WNT2 в клетках А-549 воспроизводили в соответствии с методом, описанным Брюммелькамп и др. (Brummelkamp et al., 2002), используя вектор pSUPER компании OligoEngine (США). Этот вектор содержит промотор H1, распознаваемый РНК полимеразой III, и позволяет экспреcсировать транскрипты siRNA в форме последовательностей, которые вводят в вектор. 60-мерные олигонуклеотиды, содержащие последовательности размером 19 оснований, комплементарные мРНК WNT2 (Таблица 1), вставленные дважды в обратной ориентации, последовательность-шпильку в середине олигонуклеотида, и липкие концы для лигирования в сайт BglII вектора на 5’ конце и сайт XhoI – на 3’ конце кодирующей последовательности, были синтезированы в компании Sigma (Германия) и клонированы в векторе pSUPER.retro.puro. Клетки А-549 трансфицировали полученными векторами и подвергали пуромициновой селекции (1.5 мкг/мл, 3 сут). Для контроля эффективности трансфекции и селекции клетки были котрансфицированы вектором, экспрессирующим Gfp. Эффективность подавления экспрессии гена WNT2 в трансфицированных клетках A-549 оценивали при помощи ОТ-ПЦР. Полученные клетки использовали для кокультивирования с МСК.

Синхронизация клеток в различных фазах клеточного цикла и проточная цитометрия. МСК синхронизировали в фазе G0/G1, культивируя в течение 48 ч в РС, содержащей 0.15 % ФБС. Для синхронизации в фазе S МСК выращивали 24 ч в РС с 5 мМ тимидина с последующей их отмывкой и культивированием в течение 5 ч в нормальной РС.

Для синхронизации в фазах G2/M использовали последовательную обработку клеток тимидином и нокодазолом и рестимуляцию нормальной РС (Петров и др., 2011). Клетки линии T98G синхронизировали при помощи культивирования в течение 72 ч в РС с 0.1 % ФБС и рестимуляции нормальной РС;

в опытах использовали клетки, собранные через 0, 6, 12, 18, и 30 ч после рестимуляции, как описано ранее (Popov et al., 2005). Для анализа распределения клеток по фазам клеточного цикла клетки окрашивали йодистым пропидием и анализировали на проточном цитометре ATC 1000 (Brucker, Germany).

Иммуноцитохимические методы. Клетки, выращенные на покровных стеклах, окрашивали на внутриклеточные белки специфическими антителами и конъюгированными с флюоресцентной меткой видоспецифическими антителами. Ядра клеток окрашивали DAPI.

Препараты анализировали на конфокальных сканирующих микроскопах LSM 5 Pascal или Leica TCS SP5, используя лазеры с длиной волны 405, 488, 543 и 633 нм.

Электрофорез и иммуноблотинг. Разделение белков производили при помощи электрофореза в полиакриламидном геле в присутствии додецилсульфата натрия по стандартному протоколу. Белки переносили из геля на мембрану PVDF (Amersham, США) при помощи полусухого электропереноса и выявляли первыми антигенспецифическими и вторыми видоспецифическими антителами, конъюгированными с пероксидазой хрена, методом хемилюминесценции.

Фракционирование клеточных экстрактов производили при помощи лизиса клеток в гипотоническом буфере, как описано ранее (Popov et al., 2005;

Petrov et al., 2011).

Иммунопреципитация. Для преципитации белков клеточные осадки лизировали при 0 °С 30 мин в буферном растворе, содержащем 50 мМ Hepes рН 7.5, 150 мМ NaCl, 1 мМ ЭДТА, 2.5 мM ЭГТА, 10 % глицерина, 0.1 % Твин-20 и ингибиторы протеаз и фосфатаз (Sigma, США) в разведении 1:100. Затем клетки подвергали обработке ультразвуком на соникаторе.

Клеточные экстракты, содержащие 500 мкг общего белка, обрабатывали специфическими кроличьими антителами, антителами к иммуноглобулинам кролика и протеин-G сефарозой.

Преципитаты отмывали, кипятили в буфере для нанесения на гель, центрифугировали для отделения от сефарозы и анализировали путем электрофореза в полиакриламидном геле.

Статистический анализ. Статистическая обработка результатов была проведена преимущественно с использованием средней арифметической величины, стандартного отклонения и критерия Стьюдента (при p=0.05), программы Microsoft® Office Exel 2003.

Опыты с иммуноблотингом и иммунофлюоресцентным окрашиванием, результаты которых в соответствии с международной практикой не подвергали статистическому анализу, повторяли 3-5 раз. В некоторых случаях для количественной оценки и сравнения содержания белков в полосах на репликах электрофореграмм применяли программу TotalLab (www.totallab.com).

Результаты и обсуждение Характеристика первичной культуры МСК, полученной из костного мозга трансгенных мышей GFP. Полученные нами МСК (MCKc) и подобные клетки (MCKт), любезно предоставленные доктором Д. Прокопом (Dr. D. Prockop, Tulane University, США), были охарактеризованы по экспрессии in vitro тканеспецифических маркеров и способности к дифференцировке в различные тканеспецифические клетки мезодермального происхождения (жировые, костные, мышечные). МСКc, подобно контрольным клеткам МСКт, продуцируют мезенхимальные маркеры CD29, CD44, CD49f, CD105, Gfp, актин и виментин, но не цитокератины или кроветворный маркер CD45 (Рис. 1 и не показано). При культивировании в остеогенной, адипогенной или миогенной ростовой среде МСК накапливают кальциевые преципитаты, жировые вакуоли или десмин – тканеспецифические маркеры соответствующих линий. Полученные результаты показали, что клетки, выделенные нами из костного мозга трансгенных мышей, соответствуют критериям Международного общества по клеточной терапии, разработанным для характеристики МСК.

Рисунок 1. Экспрессия Gfp, клоногенные, адгезивные и дифференцировочные свойства МСК в ходе их пассирования в культуре. А – оценка экспрессии Gfp и катенина в МСК в ходе их пассирования in vitro. Б – клоногенность МСК различных пассажей. В – адгезивные и дифференцировочные свойства МСК в ходе их культивирования. 1 – адгезивные свойства МСК, индуцированных к адипогенной дифференцировке, оценивали как способность распластываться на пластике на следующий день после добавления в культуру клеток дифференцировочной среды;

2-3 – МСК, индуцированные к адипогенной дифференцировке через 3 недели после начала опыта;

2 – фазово-контрастное изображение получено при суправитальной съемке клеток на микроскопе Zeiss Axiovent 40;

3 – изображение получено после фиксации и окраски клеток красителем масляным красным. Об. 10.

Характеристика свойств МСК в ходе их длительного пассирования в культуре. До 25-го пассажа МСК сохраняют параллельную осевую ориентацию и монослойный характер роста даже при предельном насыщении. МСК 43-47-го пассажей показывают значительно более высокую плотность насыщения, в условиях которой соседние клетки ориентированы хаотически по отношению друг к другу, что часто проявляется в перекрестном расположении и частичном наслоении соседних клеток друг на друга. Насыщающая плотность роста МСК от к 16-му пассажу увеличивается в 2 раза, а к 52-му пассажу – в 10 раз (Рис. 2Б). Начиная с 43-го пассажа, МСК показывают значительное снижение экспрессии Gfp, тогда как уровень продукции общеклеточного -катенина на поздних пассажах не изменяется (Рис. 1А). МСК поздних пассажей и КОЭ теряют экспрессию Gfp и способность к адипогенной Рисунок 2. Характеристика пролиферативной активности МСК и КОЕ в процессе пассирования в культуре. А – время удвоения МСК различных пассажей и клеток эксплантатов опухоли, полученной из МСК. Б – характеристика насыщающей плотности роста МСК и КОЭ. Вертикальные линии представляют стандартное отклонение.

дифференцировке (Рис. 1А, В). Уменьшение способности прикрепляться к пластиковой поверхности очевидно в МСК 52-го пассажа, индуцированных к адипогенной дифференцировке (Рис. 1В, 1). Клоногенная активность МСК различных пассажей составляет 5-7 % и в ходе пассирования существенно не изменяется (Рис. 1Б). Скорость деления МСК увеличивается почти в три раза, при оценке с помощью времени удвоения, которое на 9-м пассаже составляет 54.4 ч и сокращается до 19.8 ч к 52-му пассажу (Рис. 2А). На 43–44-м пассаже МСК приобретают туморогенную активность. При подкожном, внутримышечном или внутривенном введении МСК 12–15-го пассажей нормальным сингенным мышам-самкам линии C57BL не наблюдается возникновения опухолей, в тех же условиях у 40 % животных, которым подкожно или внутримышечно вводили МСК 43–47 пассажей, опухоли клеток возникают в течение 1–2 нед после инъекции клеток (Рис. 3А, Б). При внутривенном введении МСК любых использованных нами пассажей макроскопически видимые опухоли не возникают даже при наблюдении в течение 3 мес после введения клеток.

Характеристика клеток эксплантатов опухоли (КОЭ), полученной из МСК. КОЭ по многим свойствам не отличаются от МСК поздних пассажей. Они не экспрессируют Gfp, показывают снижение адгезивности и дифференцировочного потенциала. Клоногенная активность КОЭ снижена по сравнению с таковой МСК в 4-5 раз (Рис.1).

Рисунок 3. Оценка туморогенности МСК в ходе их культивирования путем введения клеток различных пассажей сингенным животным. А – внешний вид опухоли, возникшей при внутримышечном введении МСК 44-го пассажа сингенной мыши линии С57BL. 5 105 МСК 44-го пассажа инъецировали в мышцу бедра, опухоль обнаружили через 1 нед после введения клеток, а через 8 нед она имела в диаметре 2 см и весила более 2 г. Б – частота возникновения опухолей при введении МСК ранних (12–15) и поздних (43–47) пассажей нормальным сингенным реципиентам. При подкожном и внутримышечном введении использовали 5 105 клеток в 50-100 мкл среды, при внутривенном введении – 5 106 клеток в 0. мл среды. МСК вводили 5 мышам каждой группы с последующим наблюдением до 3 мес Разработка модели энтодермальной дифференцировки МСК в опытах in vitro. Для оценки способности МСК дифференцироваться в энтодермальном направлении их культивировали с клетками А-549 в условиях разделения клеточно-непроницаемой мембраной (Рис. 4). Клетки линии А-549 происходят из эпителия легких и секретируют повышенные количества белка Wnt2, который аутокринно поддерживает их пролиферацию. Соматический нокаут гена WNT Рисунок 4. Схема модели трансдифференцировки МСК в энтодермальном направлении.

приводит к остановке пролиферации и активации апоптоза в этих клетках (You et al., 2004).

Поскольку Wnt2 секретируется во внешнюю среду, мы предположили, что при совместном культивировании клеток А-549 и МСК он может проникать через мембрану, связывать специфические рецепторы на поверхности МСК и активировать сигнальный путь Wnt/ катенин. Кокультивирование вызывает в МСК экспрессию мРНК цитокератинов 5, 8, 14, 18, 19;

ZO-1, pro-SP-C. Результаты ОТ-ПЦР показывают, что экспрессия мРНК цитокератинов и ZO-1 увеличивается в 2 раза, а pro-SP-C (маркер альвеолярных эпителиальных клеток типа II) – в 2.3 раза (Рис. 5). Увеличение экспрессии цитокератинов подтверждается при иммунофлюоресцентной окраске МСК антителами к панцитокератину (не показано).

Рисунок 5. Кокультивирование с клетками А- вызывает в МСК экспрессию маркеров легочной эпителиальной дифференцировки. Результаты анализа экспрессии генов в МСК с помощью количественной ОТ-ПЦР, представлены среднее значение увеличения количества мРНК и стандартное отклонение.

Кокультивирование с клетками А-549 вызывает в МСК активацию -катенина.

Кокультивирование с клетками A-549 в течение 72 ч вызывает в МСК активацию -катенина, которая при иммунофлюоресцентном окрашивании проявляется в повышении его цитоплазматического уровня и транслокации в ядро, подобно таковой при обработке клеток ионами лития (Рис. 6А, в3,4 и б3,4, соответственно). Обработка клеток А-549 температурным шоком существенно не влияет на их способность активировать -катенин в кокультивируемых МСК (Рис. 6А, г3,4). В иммуноблотинге МСКс, полученные нами, и контрольные МСКт (Рис.

6Б, дорожки 5-8) также показывают увеличение количества -катенина в указанных выше условиях. Интересно, что повышение уровня -катенина в МСК при их кокультивировании или обработке ионами лития сопровождается увеличением его электрофоретической подвижности Рисунок 6. Кокультивирование с клетками A-549 вызывает в МСК активацию -катенина. A – иммунофлюоресцентный анализ активации -катенина в МСК, кокультивированных с клетками А-549 в течение 72 ч (a – без обработки, б – обработка 20 мМ LiCl в течение 24 ч, в – кокультивирование с необработанными клетками А-549, г – кокультивирование с клетками А-549, обработанными температурным шоком;

1-2 – без первых антител, 3-4 – окраска антителами к -катенину). Б – оценка с помощью иммуноблотинга активации катенина в МСК после краткосрочного кокультивирования с клетками А-549. МСКс и МСКт кокультивировали с клетками A-549 в течение 96 ч. LiCl добавляли в среду в концентрации 20 мМ на 24 ч. A-549 – необработанные клетки, A549ш – клетки, подвергнутые температурному шоку.

Рисунок 7. Кокультивирование МСК с клетками А-549 или культивирование в среде, содержащей LiCl, вызывает трансактивацию репортерной конструкции, содержащей сайты связывания белков МСК, временно LEF/TCF.

трансфицированные репортерными конструкциями TOPflash/FOPflash, культивировали в течение 4 ч в среде с 10 мМ LiCl или кокультивировали с клетками A-549 в течение 72 ч.

(Рис. 6Б, дорожки 2-4 и 1, соответственно), что, вероятно, является важной характеристикой активации -катенина. Функциональным следствием индукции сигнального пути Wnt/ катенин как при обработке МСК ионами лития, так и при их кокультивировании с клетками линии А-549 является активация репортерной конструкции TOPflash, содержащей сайты связывания белков семейства LEF/TCF, взаимодействующих с -катенином (Рис. 7).

Оценка состояния -катенина, р130 и E2f4 в МСК с индуцированным сигнальным путем Wnt/-катенин. Иммунофлюоресцентный анализ показывает, что в нормальных условиях МСК продуцируют небольшое количество E2f4, который распределяется равномерно между Рисунок 8. Индукция сигнального пути Wnt/-катенин в МСК ведет к активации p130 и E2f4. A – иммунофлюоресцентный анализ экспрессии p130, -катенина и E2f4 в МСК, кокультивированных с клетками линии A-549. 1 – DAPI, 2 – специфические антитела, 3 – естественная зеленая флюоресценция, 4 – комбинированное изображение. Б – оценка с помощью иммуноблотинга активации p130 и E2f4 в МСК после индукции сигнального пути Wnt/-катенин. МСК кокультивировали в течение 96 ч с клетками A-549. LiCl добавляли в ростовую среду в концентрации 10 мМ на 4 ч. В – пролиферативная активность МСК, кокультивированных с клетками А-549. Данные представляют собой среднюю величину ± стандартное отклонение. Г. Цитометрическая характеристика МСК, кокультивированных с клетками А-549;

к – контроль, э – эксперимент.

цитоплазмой и ядром, тогда как p130 локализуется преимущественно в ядре (Рис. 8А).

Обработка хлористым литием или кокультивирование с клетками A-549 вызывает накопление -катенина, р130, E2f4 в цитоплазме и их транслокацию в ядро. При использовании иммуноблотинга мы также обнаружили повышение уровня и активацию всех трех названных белков (Рис. 8Б). Белки р130 и E2f4 в первичных культурах и некоторых линиях трансформированных клеток, например в клетках глиобластомы человека T98G, формируют комплекс, тормозящий транскрипцию множества генов, продукты которых необходимы для прогрессии клеточного цикла (Moberg et al., 1996;

Popov et al., 2005). Проделанный нами анализ кривых роста показывает, что скорость деления МСК, кокультивированных с клетками А-549, не уменьшается (Рис. 8В). Цитометрическая оценка пролиферативного статуса кокультивированных МСК свидетельствует, что как в опыте, так и в контроле МСК находятся в стадии активной пролиферации (Рис. 8Г). На основании этих данных мы предположили, что в МСК комплекс р130/E2f4 включает -катенин, что модифицирует его способность супрессировать активность генов, продукты которых необходимы для перехода G1/S и дальнейшего хода клеточного цикла. По данным литературы, дифференцировка одних клеток, например, миобластов и нейробластов, требует предварительной остановки их пролиферации, тогда как лимфоциты и МСК, приобретающие свойства гепатоцитов, активно делятся в ходе дифференцировки (Sprent et al., 2008;

Herencia et al., 2011).

Синхронизация МСК в различных фазах клеточного цикла. Сравнительная характеристика уровня и рисунка фосфорилирования р130, E2f4 и -катенина в асинхронных и синхронизованных в различных фазах клеточного цикла МСК показала, что в этих клетках р130 присутствует во всех трех фосфорилированных формах в каждой фазе клеточного цикла (Рис. 9А). Наоборот, в гепатоцитах мыши и покоящихся клетках линии T98G (Рис. 9Б) р находится только в гипофосфорилированных формах, тогда как гиперфосфорилированная форма p3 появляется в клетках T98G только в переходе G1/S, за чем следует снижение общего уровня р130. Подобным образом в МСК изменяется количество E2f4 и -катенина, которые показывают небольшие колебания уровня и рисунка фосфорилирования в ходе клеточного цикла (Рис. 9А) в противоположность мышиным гепатоцитам и клеткам линии T98G. В последних в состоянии покоя присутствуют гипофосфорилированные формы р130 и гиперфосфорилированные формы E2f4. В противоположность МСК, в ходе клеточного цикла в клетках T98G E2f4 теряет свои активные гиперфосфорилированные формы (Рис. 9В).

Рисунок 9. Сравнительная характеристика уровня и рисунка фосфорилирования р130, E2f4 и катенина в синхронизированных и асинхронно растущих МСК с помощью иммуноблотинга. А – МСК, синхронизированные в фазах S и G2/M клеточного цикла с помощью тимидина и нокодазола;

Аs – асинхронно делящиеся клетки;

S, G2/M – клетки, синхронизированные, соответственно, в фазе S и G2/М;

p1, p2, p3 – формы р130, отличающиеся по электрофоретической подвижности;

Б-В – изменение уровня и рисунка фосфорилирования р130, E2f и -катенина в синхронизированных МСК и контрольных клетках линии T98G.

Полученные нами результаты свидетельствуют о существенных особенностях изменения уровня и активности р130, E2f4 и -катенина в МСК при индукции дифференцировки, связанной с активацией сигнального пути Wnt/-катенин, а также в ходе клеточного цикла. Эти изменения отличаются от таковых в клетках линии T98G. Поскольку р130 и -катенин являются субстратами одной и той же киназы Gsk3, мы в последующих опытах проверяли гипотезу о том, что эти белки могут формировать комплекс, важный для регуляции функций МСК.

Оценка продукции и электрофоретической подвижности неактивного и активного катенина до и после индукции в МСК сигнального пути Wnt/-катенин. Для выявления соответствия между уровнем, электрофоретической подвижностью и рисунком фосфорилирования различных форм -катенина мы использовали антитела, распознающие общеклеточный, неактивный – фосфорилированный по Ser33/37/Thr41, или активный – нефосфорилированный по Ser37/Thr41 -катенин. Известно, что антитела к активному белку распознают -катенин, непосредственно передающий сигналы Wnt внутрь клетки (Staal et al., 2002). Клетки почки человека линии 293Т использовали в качестве положительного контроля продукции фосфо--катенина в соответствии с рекомендацией производителя этих антител компании Cell Signaling, Inc. (США). Клетки обрабатывали ингибитором фосфатаз каликулином A (Sigma) для предотвращения дефосфорилирования -катенина, т.к., по данным компании Cell Signaling, Inc., в нормальных условиях фосфорилированный по Ser33/37/Thr белок в большинстве клеточных линий не выявляется или выявляется в очень небольших количествах. Полученные нами результаты показывают, что нормальные асинхронно делящиеся МСК и клетки линии 293T содержат едва определяемое количество Рисунок 10. Характеристика с помощью иммуноблотинга продукции и электрофоретической подвижности общеклеточного, фосфорилированного и активного -катенина. А – оценка продукции фосфо--катенина в МСК и клетках линии 293Т. Асинхронно растущие МСК и клетки линии 293T культивировали 30 мин в среде с каликулином, клеточные экстракты подвергали электрофорезу и иммуноблотингу для визуализации фосфо- катенина. Б – оценка соответствия уровня и электрофоретической подвижности общеклеточного, фосфо- и активного -катенина в клетках линии 293Т. Клетки линии 293Т, нетрансфицированные (дорожки 1-2, 5-6, 9-10) или трансфицированные плазмидой, экспрессирующей стабилизированный -катенин с мутацией Ser33Аla (дорожки 3-4, 7-8, 11-12), были обработаны каликулином (К) и охарактеризованы по экспрессии фосфо- ( катенин Ф), общеклеточного (-катенин Т) и активного -катенина (-катенин А);

i и ii, соответственно, кратковременная и длительная обработка электрофоретических реплик реагентом, активирующим хемилюминесценцию (ECL). В – схема соответствия между электрофоретической подвижностью общеклеточного, фосфо- и активного -катенина.

фосфорилированного -катенина, присутствие которого становится очевидным в МСК только при длительной обработке электрофоретических реплик реагентом, активирующим хемилюминесценцию (ECL) (Рис. 10А, ii). Антитела к фосфо--катенину не определяют этот белок (Рис. 10Б, дорожки 1-2) при уровне сигнала, достаточном для выявления высокого уровня общеклеточного -катенина антителами, распознающими его С-концевой участок (Рис.

10Б, дорожки 5-6). В этих условиях антитела к активному -катенину связывают в необработанных МСК незначительное количество белка, который движется в полосе с большей электрофоретической подвижностью (Рис. 10Б, дорожки 9-10) относительно мажорной полосы, определяемой в клетках, трансфицированных плазмидой, содержащей ген -катенина с мутацией Ser33Аla (Рис. 10Б, дорожки 11-12). Обработка трансфицированных клеток каликулином сопровождается увеличением уровня фосфо--катенина, определяемого антителами к общему белку (Рис. 10Б, дорожки 7-8), что подтверждается при оценке уровня фосфорилированного по Ser33/37/Thr41 белка, выявляемого специфическими антителами к фосфо--катенину (Рис. 10Б, дорожка 3-4). Необработанные клетки, по всей видимости, содержат незначительное количество активного -катенина, уровень которого понижается после их обработки каликулином (Рис. 10Б, дорожки 9-10). Электрофоретически фосфо- и общеклеточный -катенин характеризуются одинаковой подвижностью, тогда как активный нефосфорилированный по остаткам Ser37/Thr41 -катенин движется немного быстрее, и содержащая его полоса при электрофорезе совпадает с нижней частью полосы, включающей общеклеточный -катенин (Рис. 10В).

Изучение механизма индукции сигнального пути Wnt/-катенин в МСК при их совместном культивировании с клетками линии А-549. Для изучения механизма индукции в МСК, кокультивируемых с клетками А-549, сигнального пути Wnt/-катенин мы получили стабильные клоны клеток А-549, в которых экспрессия WNT2 была ингибирована с помощью системы pSUPER RNAi (Рис. 11). Стабильная экспрессия в клетках А-549 векторов, продуцирующих малую интерферирующую РНК против мРНК WNT2 (si1 и si2), вызывает, соответственно, уменьшение или отмену экспрессии этого гена (Рис. 11Б, ii,iii).

Рисунок 11. Торможение экспрессии гена WNT2 в клетках линии А-549, выполненное с помощью системы pSUPER RNAi (OligoEngine, США). А – электрофорез РНК в денатурирующем геле. Тотальная РНК в клетках А 549, трансфицированных плазмидами, содержащими вектор pSUPER c контрольным олигонуклеотидом (к) или олигонуклеотидами, распознающими специфические последовательности в мРНК гена WNT2 человека (si1, si2).

Трансфицированные клетки были селектированы в течение 3 сут с помощью пуромицина с последующей экстракцией тотальной РНК, ее электрофорезом в денатурирующем геле и определением относительного количества РНК в разных пробах для их выравнивания при последующем получении кДНК. Б – оценка эффективности торможения экспрессии гена WNT2 с помощью ОТ-ПЦР. i, ii, iii – электрофорез ДНК в 1 % (i, ii) и 3 %-ной (iii) агарозе для характеристики продуктов ПЦР-амплификации, соответственно, контрольного гена GAPDH;

фрагментов гена WNT2 размером 279 п. о. и 209 п. о. (М – маркеры молекулярной массы, п. о. – пары оснований).

Для выяснения механизма активации -катенина мы использовали линии A-549 с нормальным или пониженным уровнем экспрессии гена WNT2 и затем с помощью иммуноблотинга оценивали состояние -катенина в МСК (Рис. 12). Результаты этих опытов показали, что контрольные необработанные МСК продуцируют -катенин, который выявляется при иммуноблотинге в форме мажорной и минорной полос, соответственно, с меньшей и большей электрофоретической подвижностью (Рис. 12, дорожка 1). При обработке МСК ионами лития антитела к общеклеточному -катенину в иммуноблотинге выявляют увеличение количества общеклеточного и активного белка (Рис. 12, дорожка 2). При кокультивировании МСК с нормальными или трансфицированными вектором pSUPER с контрольным олигонуклеотидом клетками А-549 уровень общеклеточного -катенина возрастает незначительно, но заметно увеличивается его электрофоретическая подвижность и количество активного белка (Рис. 12, дорожки 3-4, соответственно). Электрофоретическая подвижность активного -катенина соответствует нижней части мажорной полосы, в которой движется общеклеточный белок (Рис. 12, стрелка АВК).

Рисунок 12. Оценка экспрессии активной и общеклеточной фракции -катенина в МСК, кокультивированных с клетками линии А-549 с различным уровнем продукции путем WNT2, иммуноблотинга. Клетки линии А-549 со стабильной экспрессией вектора pSUPER, содержащего комплементарную (si1, si2) или некомплементарную (siK) siРНК против мРНК гена WNT2, контрольные необработанные клетки линии А- кокультивировали с МСК 10-го пассажа в течение 72 ч. МСК, обработанные LiCl, использовали в качестве положительного контроля. После кокультивирования экстракты МСК подвергали электрофорезу и иммуноблотингу, электрофоретические реплики окрашивали антителами к активной или общей фракции -катенина. АВK – активный -катенин, ОВK – общий катенин, стрелкой «АВK» показано положение активного -катенина относительно общеклеточного белка при электрофорезе, остальные сокращения – те же, что и на Рис. 11.

Определение относительного содержания -катенина на разных дорожках показало, что эта величина возрастает в МСК при обработке клеток ионами лития и кокультивировании с нормальными или трансфицированными контрольным вектором (siK) клетками линии А-549.

Соотношение АВК/ОВК, по нашим представлениям, более объективно характеризует активацию -катенина, чем уровень общеклеточного белка. Использование этого соотношения также показывает, что подавление экспрессии гена WNT2 в клетках А-549 отменяет активацию -катенина в кокультивированных МСК (Рис. 12). Наши данные свидетельствуют, что в основе механизма активации сигнального пути Wnt/-катенин в МСК, кокультивированных с клетками А-549, лежит секреция последними фактора Wnt2, который паракринно вызывает в МСК активацию -катенина. Результаты этого и предшествующих опытов показывают, что активация сигнального пути Wnt/-катенин проявляется не столько в увеличении уровня общеклеточного белка, сколько в ускорении его электрофоретической подвижности, связанной с продукцией активного -катенина, электрофоретическая подвижность которого совпадает с таковой нижней части полосы общеклеточного белка. С другой стороны, уровень активного катенина, выявляемого специфическими антителами к нефосфорилированному по остаткам Ser37/Thr41 белку, является наиболее убедительным показателем активации сигнального пути Wnt/-катенин (Staal et al., 2002).

В МСК р130 и -катенин физически взаимодействуют между собой в комплексе с Gsk3. В преципитатах из экстрактов МСК, полученных с помощью антител к р130, выявляется катенин (Рис. 13А). Антитела против E2f4 копреципитируют из экстрактов МСК не только р130, но и -катенин (Рис. 13Б), а антитела к -катенину – р130 (не показано). Физическое A Б Рисунок 13. р130 и -катенин физически взаимодействуют между LiCl - + - + собой в МСК. А – -катенин S As G0/G1 S 1 2 3 копреципитируется антителами к p3 р p p p2 р р130;

HC Ig – тяжелые цепи p1 p иммуноглобулинов кролика, ИП – E2f иммунопреципитация;

Б – р130 и -катенин катенин копреципитируются вместе HC IgG с E2f4. ИП – иммунопреципитация, HC IgG ИБ – иммуноблотинг.

-актин -катенин ИБ ИП E2f ИП p130 - - + + взаимодействие р130 с -катенином и E2f4 определяется в различных фазах клеточного цикла (Рис. 13Б). Известно, что в фазах G0/G1 р130 фосфорилируется Gsk3, одной из основных мишеней которой является -катенин (Litovchick et al., 2004). Преципитация с использованием антител к Gsk3 подтверждает описанные выше результаты, свидетельствующие, что р130 и катенин входят в состав одного и того же комплекса, образование которого происходит с участием Gsk3 (Рис. 14А). Антитела к Gsk3 копреципитируют как -катенин, так и р130 (Рис.

14А). Комплекс р130-Gsk3--катенин формируется в асинхронных и синхронизированных в разных фазах клеточного цикла МСК, причем его характеристики в ходе клеточного цикла существенно не изменяются (Рис. 13Б). Характер фосфорилирования р130, преципитированного из экстрактов МСК в различных фазах клеточного цикла, подобен – эти преципитаты содержат как гипер-, так и гипофосфорилированные формы белка (Рис. 14Б), тогда как в контрольных клетках линии T98G антитела к E2f4 копреципитируют из экстрактов покоящихся клеток только гипофосфорилированные формы р130 (результаты не показаны).

Стимуляция ионами лития сопровождается повышением в МСК уровня -катенина, что сочетается с увеличением количества р130, его гипофосфорилированных форм, и выявляется в иммуноблотинге и иммунопреципитации (Рис. 14А, соответственно, дорожки 1-2 и 3-4).

Повышение уровня и активация р130 в МСК отмечается также при другом способе индукции сигнального пути Wnt/-катенин – кокультивировании МСК с клетками линии A-549 (Рис.

14Б). Структурные компоненты комплекса р130/E2f4-Gsk3--катенин, выявляемые при преципитации различными антителами, существенно различаются. Антитела к р преципитируют р2 и р3 р130 (Рис. 13А), антитела к E2f4 – p1 и р3 (Рис. 13Б), антитела к катенину – р2 (результаты не показаны), а антитела к Gsk3 – все три формы белка (Рис. 14А, Б). Эти данные свидетельствуют о существовании в МСК различных комплексов, содержащих р130 и -катенин, которые могут играть различную функциональную роль.

Рисунок 14. p130, Gsk3 и -катенин формируют комплекс в МСК. А – антитела к Gsk3 преципитируют катенин и p130 из экстрактов МСК. Б – оценка физического взаимодействия между Gsk3, p130 и -катенином в МСК, кокультивированных с клетками Экстракты МСК, A-549.

необработанных, обработанных ионами лития или кокультивированных с клетками линии А-549, преципитировали антителами к Gsk3, а преципитированные белки выявляли в иммуноблотинге. ИП – иммунопреципитация, НС IgG – тяжелая цепь иммуноглобулинов G.

Оценка формирования комплекса p130-Gsk3--катенин в ядерном и цитоплазматическом компартментах МСК. Определение р130 и -катенина в экстрактах МСК из цитозоля и ядра показало, что эти белки локализуются преимущественно в ядерном компартменте клетки и находятся там в активных формах (Рис. 15А). Обработка МСК ионами лития способствует Рисунок 15. Оценка состава комплекса p130-Gsk3--катенин в ядерном и цитоплазматическом компартментах МСК. А – характеристика p130 и -катенина в цитоплазматическом и ядерном компартментах МСК, обработанных LiCl, с помощью иммуноблотинга. Асинхронно растущие МСК культивировали в течение 4 ч в ростовой среде с 10 мМ LiCl, клеточные экстракты разделяли на цитозольную и ядерную фракции, белки визуализировали с помощью иммуноблотинга, как это описано в разделе «Материалы и методы». Б – определение активной фракции -катенина в цитоплазматическом и ядерном компартментах МСК. Реплику электрофореграммы (Рис. 15А) обрабатывали антителами к активному -катенину. В – характеристика p130 и катенина, копреципитированных из ядерных экстрактов МСК антителами к Gsk3. Г. Оценка комплекса p130 Gsk3--катенин в цитозольной фракции МСК, необработанных или обработанных LiCl.

повышению уровня общеклеточного и активного -катенина в ядре (Рис.15А, Б, дорожки 3-4).

Результаты иммунопреципитации показывают, что в ядре присутствуют все три фосфорилированные формы p130, в цитозоле – преимущественно форма p2 (Рис. 15В, Г, дорожки 1-2). Обработка LiCl увеличивает количество форм p1 и p3 p130 в преципитатах из ядерных, но не из цитозольных экстрактов (Рис. 15В, Г, дорожки 3-4). Эти данные позволяют сделать предположение о роли Gsk3 в фосфорилировании р130 и формировании ее функциональных комплексов с р130 и -катенином. Вероятно, Gsk3 способствует физическому взаимодействию -катенина с р130, но фосфорилирование р130 этой киназой носит не функциональный характер, а приводит к формированию неактивной формы р2, которая локализуется преимущественно в цитозоле. Комплекс р130-Gsk3--катенин в ядре содержит активные формы р130 и -катенина и, вероятно, способствует их взаимному привлечению к регуляторным областям генов-мишеней, что может играть важную роль в регуляции функций МСК. Антитела к Tcf3,4 обнаруживают их в иммуноблотинге в ядерных, но не цитозольных экстрактах МСК (Рис. 15В, Г, дорожки 1,2). В условиях иммунопреципитации антитела к Gsk3 выявляют Tcf3,4 как в ядре, так и в цитозоле (Рис. 15В, Г, дорожки 3-4).

Оценка транскрипционной активности р130 с помощью репортерных конструкций, содержащих сайты связывания белков LEF/TCF. Присутствие в комплексе p130-Gsk3- катенин транскрипционных факторов Tcf3,4 давало основание предположить, что этот комплекс способен физически взаимодействовать с регуляторными областями генов-мишеней Wnt/-катенин, содержащих сайты связывания транскрипционных факторов семейства LEF/TCF. С целью проверки этого предположения мы трансфицировали клетки линии 293Т экспрессионными векторами, содержащими люциферазные репортерные конструкции с сайтами связывания белков LEF/TCF. При обработке клеток ионами лития отмечается 4 кратная активация репортерной конструкции TOPflash (Рис. 16А). Экспрессия в клетках 293Т -катенина, нечувствительного к фосфорилированию и инактивации Gsk3 вследствие мутации Ser33Аla, приводит к транскрипционной активации TOPflash. Дополнительная экспрессия в клетках экзогенного р130 уменьшает уровень транскрипционной активации, вызванной введением вектора, содержащего ген -катенина.

Рисунок 16. р130 супрессирует вызванную -катенином транскрипционную активацию репортерной конструкции, содержащей сайты связывания А– LEF/TCF.

обработка ионами лития повышает транскрипционную активность репортера TOPflash в клетках линии 293Т. Б – катенин вызывает транскрипционную активацию репортера TOPflash, а р уменьшает уровень этой активации.

Сравнительная оценка уровня и рисунка фосфорилирования -катенина и Tcf3,4 в МСК в процессе их длительного культивирования. Наши предшествующие опыты показали, что уровень суммарного -катенина в МСК в ходе длительного пассирования, а также в КОЭ не изменяется. Для более точной оценки роли -катенина в процессе злокачественной трансформации МСК в ходе их длительного пассирования мы произвели сравнительный анализ количества и рисунка фосфорилирования -катенина и Tcf3,4 в ядерной фракции МСК ранних и поздних пассажей до и после стимуляции клеток ионами лития. Эти эксперименты выявили повышение уровня обоих белков в ядерной фракции МСК, что сочеталось со снижением чувствительности клеток к действию ионов лития (Рис. 17). Если в клетках 10-го пассажа происходит заметное повышение уровня ядерного -катенина после их стимуляции ионами лития, то в клетках 57-го пассажа и КОЭ возрастание уровня белка регистрируется в необработанных клетках. Существенно, что увеличение количества общеклеточного катенина происходит за счет электрофоретически более подвижной нижней части содержащей его полосы, соответствующей положению активного белка (Рис. 17). Уровень ядерного Tcf3,4, выявляемого в МСК с помощью иммуноблотинга, в ходе пассирования повышается не так значительно, как таковой -катенина, но резко возрастает в КОЭ. При обработке ионами лития уровень Tcf3,4 в ядерной фракции МСК всех исследованных пассажей заметно повышается. В клетках 57-го пассажа при обработке ионами лития повышение уровня Tcf3,4 более выражено, чем таковое -катенина (Рис. 17).

Рисунок 17. Характеристика -катенина и Tcf3,4 в ядерной фракции МСК в ходе их длительного культивирования. Ядерные экстракты клеток подвергали электрофорезу и иммуноблотингу, как это описано в разделе «Материалы и методы». КОЭ – клетки эксплантатов опухоли, полученной из МСК 43-47-го пассажей.

Иммунофлюоресцентная оценка уровня и активации -катенина в МСК. С целью подтверждения результатов о повышении уровня и активации -катенина в ходе длительного пассирования МСК был использован иммунофлюоресцентный анализ (Рис. 18). МСК 10-го пассажа в обычных условиях экспрессируют высокий уровень Gfp, но низкий уровень катенина, продукция которого повышается во всех компартментах клеток: цитоплазме, ядре и цитоплазматической мембране после добавления в РС хлористого лития (Рис. 18). По мере Рисунок 18. Иммунофлюоресцентный анализ экспрессии и локализации -катенина в МСК разных пассажей и КОЭ при обработке клеток ионами лития. Экспоненциально растущие МСК культивировали в среде с 10 мM LiCl и окрашивали антителами к -катенину. 1 – окраска DAPI, 2 – естественная зеленая флюоресценция, – -катенин, 4 – совмещенное изображение.

Красную флюоресценцию выявляли вторыми антителами, конъюгированными с Cy5® 633. Об.

100.

пассирования уровень -катенина в ядерных экстрактах необработанных МСК значительно повышается. МСК 60-го пассажа реагируют на добавление LiCl в ростовую среду незначительным повышением уровня -катенина во всех отделах клетки. КОЭ, как и МСК поздних пассажей, не экспрессируют Gfp, а уровень -катенина и его внутриклеточное распределение в ответ на обработку клеток ионами лития схожи с таковыми в МСК поздних пассажей (Рис. 18). В отличие от них в КОЭ не выявляется мембранный -катенин и не наблюдается его перераспределение между разными компартментами при обработке ионами лития (Рис. 18). Полученные в настоящей работе результаты свидетельствуют о взаимодействии сигнальных путей Wnt/-катенин и pRb в регуляции деления, пролиферации и трансформации МСК. В нормальных условиях в МСК ранних пассажей сигнальный путь Wnt/-катенин может играть важную роль в сопряжении клеточного цикла и дифференцировки, как необходимого компонента механизма самоподдержания СК. В ходе длительного пассирования в МСК происходит увеличение уровня внутриядерного -катенина и его конститутивная активация, что может являться реакцией на стресс, например, повышенную оксигенацию в культуре, и способствует преодолению остановки клеточного цикла и клеточного старения. «Платой» за спасение от клеточного старения является иммортализация и последующая трансформация МСК, в механизме возникновения которой важную роль может играть конститутивная транскрипционная активация генов-мишеней семейства LEF/TCF, например гена с-MYC. Схематично взаимодействие сигнальных путей Wnt/-катенин и pRb в нормальных и трансформированных МСК можно представить в виде схемы на Рис. 19.

Рисунок 19. Сигнальные пути Wnt/ катенин и pRb взаимодействуют в ходе клеточного цикла, что опосредовано образованием комплекса р130--катенин-Gsk3. В этом комплексе р130 является потенциальным супрессором мишеней -катенина, его активность направлена на остановку клеточного цикла и дифференцировку МСК.

Действие -катенина, напротив, активирует прогрессию клеточного цикла и при конститутивной активации способствует возникновению туморогенности.

Выводы При кокультивировании с клетками линии А-549, происходящими из эпителия легких, в 1.

условиях разделения клеточно-непроницаемой мембраной в МСК активируется сигнальный путь Wnt/-катенин, что сопряжено с приобретением белками р130 и E2f активного состояния и экспрессией маркеров легочного эпителия;

торможение в клетках А-549 экспрессии гена WNT2 с помощью метода интерференции РНК отменяет в кокультивируемых МСК активацию -катенина.

В МСК в ходе клеточного цикла не происходит существенных изменений уровня и 2.

рисунка фосфорилирования белков р130 и E2f4, которые в контрольных клетках линии T98G формируют супрессорный комплекс, тормозящий выход из состояния покоя;

диссоциация этого комплекса за счет фосфорилирования и деградации р130 является обязательным условием прогрессии клеточного цикла в клетках T98G, но не происходит в МСК.

В МСК -катенин, р130, Gsk3 и E2f4 формируют в различных фазах клеточного цикла 3.

комплекс, состав которого в ядре и цитозоле различается и изменяется при активации сигнального пути Wnt/-катенин;

в состав этого комплекса входят факторы Tcf3,4, опосредующие его транскрипционную активность, что выявляется при экспрессии экзогенного -катенина или -катенина вместе с р130.

В ходе длительного культивирования МСК происходит повышение скорости их 4.

пролиферации, понижаются дифференцировочная и адгезивная активность, на 43-47-м пассажах клетки образуют опухоли при введении сингенным животным. Приобретение туморогенности МСК в ходе их длительного пассирования сочетается с повышением уровня ядерного -катенина, транскрипционных факторов Tcf3,4 и снижением чувствительности клеток к действию ионов лития, что соответствует состоянию конститутивной активности сигнального пути Wnt/-катенин в МСК поздних пассажей и КОЭ.

Список работ, опубликованных по теме диссертации 1. Popov B.V., Serikov V.B., Petrov N.S., Izusova T.V., Gupta N., Matthay A. 2007. Lung epithelial cells induce epithelial differentiation in mouse mesenchymal bone marrow stem cells by paracrine mechanism. Tissue Engineering. 13(10): 2445-2450.

2. Гринчук Т.М., Иванцов K.M., Алексеенко Л.Л., Кожухарова И.В., Зайчик А.М., Михайлов В.М., Петров Н.С., Попов Б.В. 2008. Характеристика культуры мезенхимных стволовых клеток мыши, экспрессирующих GFP. Цитология. 50(12): 1029-1034.

3. Попов Б.В., Петров Н.С., Михайлов В.М., Томилин А.Н., Алексеенко Л.Л., Гринчук Т.М., Зайчик А.М. 2009. Спонтанная трансформация и иммортализация мезенхимных стволовых клеток в культуре in vitro. Цитология. 51(2): 91-102.

4. Петров Н.С., Жидкова О.В., Зенин В.В., Попов Б.В. 2011. Негативный регулятор клеточного цикла – белок р130 и -катенин формируют комплекс в мезенхимных стволовых клетках. Цитология. 53(2): 107-115.

5. Petrov N., Zhidkova O., Serikov V., Zenin V., Popov B. 2012. Induction of Wnt/-catenin signaling in mouse mesenchymal stem cells is associated with activation of the p130 and E2f and formation of the p130/Gsk3/-catenin complex. Stem Cells Dev. 21(4): 587-597.

6. Петров Н.С., Злобина О.В., Сериков В.Б., Зайчик А.М., Комяков Б.К., Гулиев Б.Г., Алексеев М.Ю., Попов Б.В. 2007. Сравнительная характеристика изменений уровня и рисунка фосфорилирования -катенина, белка p130 и транскрипционного фактора E2F4 в мезенхимных стволовых клетках при их кокультивировании с клетками линии A-549.

Тезисы докладов II Cъезда Общества клеточной биологии совместно с Юбилейной конференцией, посвященной 50-летию Института цитологии РАН. Цитология. 49(9): 782.

7. Попов Б.В., Гринчук Т.М., Иванцов К.М., Петров Н.С., Злобина О.В., Алексенко Л.Л., Скрипкина Н.С., Каминская Е.В, Кузоватов С.Н., Михайлов В.М. 2008. Опухолевая трансформация мезенхимальных стволовых клеток костного мозга мышей C57BL/6, экспрессирующих белок GFP. Тезисы 4-й Российской конференции по фундаментальной онкологии. Вопросы онкологии. 54(2): 22.

8. Петров Н.С., Жидкова О.В., Сериков В.Б., Попов Б.В. 2009. -катенин, p130 и E2F формируют функциональный комплекс в мезенхимальных стволовых клетках.

Материалы Всероссийской научной школы-конференции «Аутологичные стволовые клетки: экспериментальные и клинические исследования». 48.

9. Петров Н.С., Жидкова О.В., Попов Б.В. 2010. -катенин и GSK3 формируют в мезенхимных стволовых клетках комплексы, включающие различные формы р130.

Тезисы докладов и сообщений, представленные на II Конференцию молодых ученых Института цитологии РАН. Цитология. 52(6): 501-502.

10. Petrov N., Zhidkova O., Zenin V., Popov B. 2011. Induction of Wnt/-catenin signaling in mouse mesenchymal stem cells is associated with activation of p130 and E2f4 and transformation of the p130/Gsk3/-catenin complex. Abstracts of «Stem Cells Update – From Basic Research to the Clinic». 50.

Список цитируемой литературы Петров Н.С., Жидкова О.В., Зенин В.В., Розанов Ю.М., Попов Б.В. 2011. Негативный регулятор клеточного цикла – белок р130 и -катенин формируют комплекс в мезенхимных стволовых клетках. Цитология. 53(2): 107-115.

Brummelkamp T.R., Bernards R., Agami R. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science. 296(5567): 550-553.

Chomczynski P., Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162(1): 156-159.

Herencia C., Rodrguez-Ariza A., Canalejo A., Naranjo A., Briceo F.J., Lpez-Cillero P., De la Mata M., Muoz-Castaeda J.R. 2011. Differential bone marrow hematopoietic stem cells mobilization in hepatectomized patients. J Gastrointest Surg. 15(8): 1459-1467.

Korinek V., Barker N., Morin P.J., van Wichen D., de Weger R., Kinzler K.W., Vogelstein B., Clevers H. 1997. Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/ colon carcinoma. Science. 275(5307): 1784-1787.

Litovchick L., Chestukhin A., DeCaprio J.A. 2004. Glycogen synthase kinase phosphorylates RBL2/p130 during quiescence. Mol Cell Biol. 24(20): 8970-8980.

Moberg K., Starz M.A., Lees J.A. 1996. E2F-4 switches from p130 to p107 and pRB in response to cell cycle reentry. Mol Cell Biol. 16(4): 1436-1449.

Petrov N., Zhidkova O., Serikov V., Zenin V., Popov B. 2012. Induction of Wnt/-catenin signaling in mouse mesenchymal stem cells is associated with activation of the p130 and E2f4 and formation of the p130/Gsk3/-catenin complex. Stem Cells Dev. 21(4): 587-597.

Popov B., Chang L.S., Serikov V. 2005. Cell cycle-related transformation of the E2F4-p repressor complex. Biochem Biophys Res Commun. 336(3): 762-769.

Sprent J., Cho J.H., Boyman O., Surh C.D. 2008. T cell homeostasis. Immunol Cell Biol.

86(4): 312-319.

Staal F.J., Noort Mv.M., Strous G.J., Clevers H.C. 2002. Wnt signals are transmitted through N-terminally dephosphorylated beta-catenin. EMBO Rep. 3(1): 63-68.

Stambolic V. Ruel L., Woodgett J.R. 1996. Lithium inhibits glycogеn syntase kinase- activities and mimics Wingless signaling in intact cells. Curr Biol. 6(12): 1664-1668.

You L., He B., Xu Z., Uematsu K., Mazieres J., Mikami I., Reguart N., Moody T.W., Kitajewsky J., McCormick F., Jablons D.M. 2004. Inhibition of Wnt-2-mediated signaling induces programmed cell death in non-small-cell lung cancer cells. Oncogene. 23(26): 6170 6174.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.