авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Адгезионная и транскрипционная функции -катенина в самообновлении эмбриональных стволовых клеток мыши

На правах рукописи

СИНЕВА

Галина Сергеевна

АДГЕЗИОННАЯ И ТРАНСКРИПЦИОННАЯ ФУНКЦИИ

-КАТЕНИНА В САМООБНОВЛЕНИИ ЭМБРИОНАЛЬНЫХ

СТВОЛОВЫХ КЛЕТОК МЫШИ

03.03.04 - Клеточная биология, цитология, гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Санкт-Петербург 2012

Работа вь1полнена в лаборатории молекулярньтх основ дифференцировки клеток Федерального государственного бходжетного учреждения науки Анститута цитологии РАн, €анкт-|1етербур| доктор биологических наук, профессор Ёаунньтй руководитель :

|[оспелов Балерий Анатольевич Анститут цитологии РАн (орнилова 8лена €ергеевна оппоненть Фф :

'цис[г{ьнь1е доктор биологических наук, профессор 14нститут цитологии РАн |орлеева Фльга Федоровна канди дат биологических наук Анотитут биологии развития им. н.к. (ольцова РАн Бедущая оргаъти3ация: едеральное государственно е Ф бтодхетное образовательное учре)кдение вь1с1шего профессионсш1ьного образования ) й у нив € анкт-|1етерб сударств ер ситет ургский го ен н к ь иуоня20]д2 годав 12 часов !атт1ита состоится РАЁ по на 3аседании диссертационного с0вета д.002.2з0.01 на 6азеАнотитута цитологии 1ихорецкийпр., д' адресу: |94064, €анкт-|[етербург, €айт института| тт'цп'цм.су{зр6.гзз|.гц Адрес электронной почтьт института: се11Б1о@гпа11.су1зрБ.гвз|.гш Факс институа: (8|2) 297-з5-4| € диссертацией можно ознакомиться в библиотеке Р1нститща цитологии РАЁ ((-))

Автореферат разослан мая 2012 г.

}чень1й секретарь диссертационного сове |4, в.в. 1{аминская кандидат биологических наук

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Эмбриональные стволовые клетки (ЭСК) представляют собой объект активно развивающейся области клеточной биологии. ЭСК интересны тем, что, с одной стороны, обладают плюрипотентностью, т.е. способностью дифференцироваться в клеточные производные всех трех зародышевых листков;

с другой стороны, они обладают свойством самообновления, т.е. активно пролиферируют в недифференцированном состоянии и при этом сохраняют плюрипотентность (Smith, 2001). Эти принципиальные особенности делают ЭСК привлекательной и доступной моделью для исследования молекулярных механизмов раннего эмбрионального развития, пролиферации, дифференцировки. Благодаря способности дифференцироваться и образовывать все типы клеток взрослого организма ЭСК человека являются перспективным инструментом для клеточной терапии.

Способность ЭСК мыши включаться в бластоцисту и формировать ткани химерного зародыша, в том числе половые клетки, используется для получения нокаутных мышей и исследования функций генов in vivo. Получение индуцированных плюрипотентных стволовых (иПС) клеток продемонстрировало, что возможен и обратный переход из дифференцированного состояния в плюрипотентное, иными словами, возможно репрограммирование соматических клеток в плюрипотентные (Takahashi, Yamanaka, 2006). Изучение механизмов, регулирующих процессы самообновления, дифференцировки и репрограммирования, имеет важное фундаментальное значение. Кроме того, понимание этих механизмов необходимо в будущем для безопасного применения ЭСК и других плюрипотентных клеток в клинике.

Самообновление ЭСК обеспечивается координированной работой набора транскрипционных факторов и сигнальных путей, активность которых направлена на подавление дифференцировки и поддержание высокого пролиферативного потенциала клеток (Do, Scholer, 2009). Известно, что для самообновляющихся ЭСК мыши (мЭСК) необходима активация LIF/STAT3- и BMP4/Smad-сигнальных каскадов (Smith et al., 1988;

Ying et al., 2003). Cреди факторов, которые позитивно регулируют процессы самообновления ЭСК, получение новых линий ЭСК и репрограммирование соматических клеток мыши и человека, значительную роль играет активация Wnt сигнального пути или ингибирование его негативного регулятора, киназы GSK (Marson et al., 2008;

Umehara et al., 2007;

Wray et al., 2011). Центральным эффектором Wnt пути является белок -катенин, который в отсутствие сигнала от Wnt фосфорилируется киназой GSK3, что маркирует его для протеасомной деградации.

Активация канонического Wnt каскада приводит к подавлению активности GSK3, стабилизации -катенина, его транспорту в ядро и активации совместно с факторами семейства Tcf транскрипции Wnt-зависимых генов. К -катенин/Tcf-зависимым генам относятся некоторые ключевые регуляторы дифференцировки, гены, отвечающие за эпителиально-мезенхимальный переход (ЭМП) и регуляцию клеточного цикла (Klaus, Birchmeier, 2008). Кроме того, -катенин выполняет в клетке важную адгезионную функцию, участвуя в формировании межклеточных контактов совместно с мембранными белками семейства кадгеринов и обеспечивая их связывание с актиновым цитоскелетом (Nelson, Nusse, 2004).

Ингибиторы GSK3 способствуют становлению и поддержанию плюрипотентности, и их положительное влияние на самообновление в значительной степени опосредовано -катенином (Wray et al., 2011). Известно также, что инактивация GSK3 наиболее эффективно способствует поддержанию плюрипотентности в сочетании с применением ингибиторов MEK/ERK каскада, тогда как само по себе ингибирование GSK3 не полностью препятствует запуску дифференцировки в мЭСК (Ying et al., 2008). Остается не вполне понятным, с какими именно функциями -катенина (или других мишеней GSK3) связан положительный эффект ингибиторов GSK3 в ЭСК и как модулируют его другие сигнальные пути, обслуживающие самообновление, в частности, MEK/ERK путь.

Таким образом, непосредственные эффекты инактивации GSK3 в контексте поддержания самообновления и плюрипотентности ЭСК не вполне изучены.

Информация о механизмах воздействия ингибиторов этой киназы поможет глубже понять феномен плюрипотентности, а в перспективе – пользоваться этими знаниями для применения ЭСК и иПС клеток в трансплантологии.

Цели и задачи исследования Целью данной работы было выяснить функциональный статус -катенина и его роль в самообновлении и ранней дифференцировке ЭСК мыши (мЭСК). Были сформулированы следующие задачи:

Исследовать уровень экспрессии -катенина, а также уровень -катенин-зависимой 1.

транскрипции генов-мишеней в недифференцированных и дифференцированных мЭСК;

Изучить изменения транскрипционной и адгезионной функций -катенина в норме и 2.

при обработке мЭСК ингибиторами GSK3;

Исследовать влияние ингибиторов GSK3 на пролиферацию, выживаемость и 3.

экспрессию маркеров недифференцированного состояния мЭСК;

Выяснить, в какой степени MEK/ERK-сигнальный путь модулирует уровень 4.

экспрессии -катенина и его адгезионные и сигнальные функции в мЭСК.

Основные положения, выносимые на защиту 1. Ингибирование активности киназы GSK3 в недифференцированных мЭСК приводит к накоплению Е-кадгерин-связанного -катенина и усилению межклеточной адгезии.

2. В недифференцированных мЭСК трансактиваторная активность -катенина низка, но она заметно возрастает при действии ингибиторов GSK3. При этом не усиливается транскрипция генов-мишеней Wnt-сигнального пути, регулирующих клеточный цикл (циклин D1, e2f1, c-myc), и слабо активируется экспрессия генов-маркеров эпителиально-мезенхимального перехода (snail и, в одной из клеточных линий – виментина).

3. Активность -катенин/Tcf-комплексов возрастает при дифференцировке мЭСК, что сопровождается значительным усилением экспрессии генов-мишеней Wnt, регулирующих ЭМП (snail, виментина) и мезодермальную дифференцировку (T/Brachyury);

ингибиторы GSK3 ослабляют экспрессию этих генов при индукции дифференцировки в монослое.

4. Инактивация MEK/ERK-сигнального каскада модулирует действие ингибиторов GSK3 в мЭСК, дополнительно усиливая степень связывания -катенина с Е-кадгерином и подавляя экспрессию -катенин/Tcf-зависимого регулятора мезодермальной дифференцировки T/Brachyury.

Научная новизна работы Впервые показано, что инактивация GSK3 в недифференцированных мЭСК приводит к накоплению как «адгезионного» (Е-кадгерин-связанного или способного к такому связыванию), так и «сигнального» (способного участвовать в транскрипции) пулов -катенина. Показано также, что усиление -катенин/Tcf-зависимой транскрипции при ингибировании GSK3 в мЭСК на самом деле не приводит к активации транскрипции значительной части генов-мишеней Wnt-сигнального пути.

Более того, экспрессия c-myc была подавлена в условиях инактивации GSK3, что опровергает предположение о том, что активация транскрипции этого фактора опосредует эффекты ингибиторов GSK3 в ЭСК. Впервые отмечено, что при инактивации GSK3 происходит подавление экспрессии другого фактора, связанного с регуляцией плюрипотентности – rest/nrsf (RE1-silencing transcription factor/neuron restrictive silencer factor).

Положительное влияние на самообновление сочетания ингибиторов GSK3 и MEK/ERK-сигнального каскада стало известно относительно недавно (Ying et al., 2008), и данных о том, как эти сигнальные пути дополняют друг друга, немного. В настоящей работе мы впервые показали, что ингибитор MEK1/2 модулирует действие ингибиторов GSK3 на функции -катенина в мЭСК, а именно, дополнительно усиливает его связывание с Е-кадгерином и снижает его транскрипционную активность по отношению к маркеру дифференцировки T/Brachyury.

Личный вклад автора Все экспериментальные процедуры, описанные в работе, были проведены автором лично. Анализ подготовленных автором проб на проточном цитофлуориметре осуществлял Н.Д. Аксенов. Материалы, вошедшие в представленную работу, обсуждались и публиковались совместно с соавторами и научным руководителем.

Научно-практическое значение работы Проведенное исследование вносит вклад в понимание функций -катенина в мЭСК и баланса сигнальных путей при самообновлении этих клеток. На полученные данные можно опираться при дальнейшем исследовании механизмов поддержания плюрипотентности и интеграции сигнальных путей с транскрипционным аппаратом мЭСК. Полученные результаты могут использоваться в материалах курсов по внутриклеточной сигнализации.

Апробация работы Данные, представленные в настоящей работе, опубликованы в 1 статье в международном журнале Biology of the Cell. Основные положения доложены и обсуждены на 6 международных и Российских конференциях: школе-конференции для молодых ученых «Методы культивирования клеток» (Санкт-Петербург, 2008 г.), международной конференции 6th ISSCR (International Society for Stem Cell Research) Annual Meeting 2008 (Филадельфия, США, 2008 г.), VII Международной конференции "Молекулярная генетика соматических клеток" (Звенигород, 2009 г.), международной конференции "Modern Microscopy Techniques in Biology and Medicine" (Санкт Петербург, 2009 г.), II Конференции молодых ученых Института цитологии РАН (Санкт-Петербург, 2010 г.), международной конференции «EMBO Meeting 2010»

(Барселона, Испания, 2010 г.).

Объем и структура диссертации Диссертация построена по общепринятому плану и состоит из введения, обзора литературы, описания материалов и методов, результатов исследования, их обсуждения, заключения, выводов и списка цитированной литературы, включающего 147 названий. Материалы диссертации изложены на 106 страницах машинописного текста, она содержит 3 схемы и 22 рисунка.

МАТЕРИАЛЫ И МЕТОДЫ Культивирование клеток. Работу проводили на двух линиях мЭСК, IOUD2 и E14TV2, любезно предоставленных P. Savatier (Лион, Франция) и A. Smith (Кембридж, Великобритания). Клетки культивировали при 37 °С в 5 % CO на пластиковых чашках Петри (Corning), покрытых 0.2 %-ным раствором желатина (Sigma), в среде DMEM/F12 (Биолот) с 0.1 мМ 2-меркаптоэтанола, 0.1 мМ заменимых аминокислот и 1 мМ пирувата (Gibco), содержащей, соответственно для IOUD2 и E14TV2: 10 или 15 % сыворотки (Hyclone), 50 ед/мл фактора LIF (Sigma) или эквивалент 1000 ед/мл очищенного рекомбинантного LIF, экспрессированного с конструкции pGEX-2Т-hLIF (конструкция любезно предоставлена А.Н. Томилиным, Институт цитологии РАН). Для инактивации GSK3 использовали ингибиторы BIO Acetoxime (GSK-3 Inhibitor X, Calbiochem) или CHIR99021 (Axon), для инактивации MEK1/2 – ингибитор PD0325901 (Axon). Дифференцировку клеток IOUD2 проводили в течение 6 сут, рассевали клетки в среде без LIF, в плотности 2000 клеток/см2.

Со второго по пятый день включительно добавляли в среду ретиноевую кислоту в концентрации 1 мкМ (All-trans retinoic acid, Sigma). Общий вид клеточных колоний исследовали под световым микроскопом (Zeiss Axiovert) в фазовом контрасте.

МТТ-тест и кривые роста. Оценку жизнеспособности клеток для построения кривых роста производили колориметрическим методом с использованием метилтиазолилдифенил-тетразолиум бромида (МТТ) (Sigma). Клетки инкубировали в растворе МТТ (0.5 мг/мл в PBS) 1 ч при 37 °С в атмосфере 5 % CO2. Образовавшийся осадок формазана растворяли в ДМСО (Sigma). Оптическую плотность измеряли при длине волны 570 нм против раствора МТТ с ДМСО на спектрофотометре Multiskan EX (Thermo Electron).

Временная трансфекция и анализ люциферазной активности. Плазмиды TopFlash или FopFlash котрансфецировали в мЭСК с плазмидой, кодирующей ген люциферазы Renilla. Временную трансфекцию проводили с помощью липофектамина 2000 (Invitrogen), в среде OPTIMEM (Invitrogen). Спустя 48 ч последовательно определяли активность люциферазы Firefly (экспрессирующейся с TopFlash и FopFlash) и Renilla в клеточных экстрактах с помощью набора для двойного люциферазного анализа (Е1910, Promega), на люминометре TD-20 (Turner Design).

Активность Firefly нормализовали относительно активности Renilla. Среднее и его стандартную ошибку подсчитывали для двух независимых повторений.

Проточная цитофлуориметрия на содержание ДНК. Клетки промывали и снимали с чашек раствором Версена (Биолот), содержащим 0.03 % эмбриональной сыворотки, пермеабилизовали в 0.01 %-ном растворе сапонина (Sigma) 30 мин при комнатной температуре, затем добавляли РНКазу А (100 мкг/мл) и иодид пропидия (40 мкг/мл), и инкубировали 15 мин при 37 °С. Пробы анализировали на проточном цитофлуориметре ATC300 (Brucker). Полученные результаты обрабатывали с помощью программы Modfit.

Анализ активности каспаз in vitro. Клетки лизировали в буфере, содержащем 50 мМ HEPES (ICN) pH 7.4, 0.1 % CHAPS (Sigma), 0.5 % IGEPAL-100 (ICN), 5 мМ DTT (Sigma), 30 мин при 4 °С. В реакционную смесь (40 мМ HEPES pH 7.4, 0.1 % CHAPS, 1 мМ DTT и 40 мкМ флуорогенного субстрата AcDEVD-AMC, Sigma) добавляли 40 мкг белка из лизатов, инкубировали 1 ч при 37 °С. Для подтверждения специфической активации каспаз применялся ингибитор каспаз ZVAD (50 мкМ, Biomol). Флуоресценцию измеряли на флуориметре (Туроверов и др., 1998) в лаборатории структурной динамики, стабильности и фолдинга белков Института цитологии РАН. Подсчет среднего и его стандартной ошибки производили по трем независимым повторениям.

Иммунофлуоресценция. Клетки фиксировали в 4%-ном параформальдегиде на PBS 10 мин, обрабатывали 0.5 %-ным раствором Triton-X-100 в PBS 25 мин, инкубировали с 5 %-ным раствором бычьего сывороточного альбумина (БСА) в PBS 1 ч. Далее окрашивали препараты антителами к E-кадгерину (#4065, Cell SignalingTechnology) или(и) -катенину (sc-7963, Santa Cruz Biotechnology).

В качестве вторых антител использовали Fab-фрагменты козьих антител к иммуноглобулинам мыши или кролика, конъюгированные с флуорохромами Alexa Fluor®-488 и Alexa Fluor®-568 (Invitrogen). Окраску ядер производили DAPI (4’,6-diamidino-2-phenylindole) или Topro-3 (Invitrogen). Препараты исследовали на конфокальных микроскопах Leica TCS SL и Leica TCS SP5.

Экстракция тотального белка в денатурирующих условиях и Вестерн блоттинг. Для экстракции тотального белка использовали буфер на основе PBS, содержащий 1 % NP-40, 0.5 % дезоксихолата натрия, 0.1 % SDS и ингибиторы протеаз (CompleteTM protease inhibitor cocktail, Roche) и фосфатаз (1 мМ ортованадата натрия, 5 мМ EGTA, 10 мМ NaF). Количество белка в пробах измеряли по методу Брэдфорд.

С 25-40 мкг белка проводили форез в ПААГ в денатурирующих условиях, переносили белки на нитроцеллюлозную мембрану (Amersham) и окрашивали антителами к -катенину, E-кадгерину (см. раздел Иммунофлуоресценция), фосфотирозину (9411, Cell Signaling Technology), Oct3/4 (sc-5279, Santa Cruz Biotechnology) или GAPDH (глицеральдегид-3-фосфатдегидрогеназа, Abcam), следуя протоколам производителя.

В качестве вторых антител использовали козьи антитела против иммуноглобулинов кролика и мыши, конъюгированные с пероксидазой хрена (Pierce), и визуализировали бэнды методом усиленной хемилюминесценции (ECL, Amersham). Для ре-блоттинга мембрану инкубировали в буфере, содержащем 62.5 мM Tris/HCl, pH 6.8, 2 % SDS и 100 мM 2-меркаптоэтанола (Sigma), 30 мин при 56 C.

Экстракция белка для иммунопреципитации и осаждения GST-Е кадгерином. Экстракцию белков для иммунопреципитации проводили в буфере, содержащем 10 мM Tris/HCl (pH 7.4), 150 мM NaCl, 0.5 % Igepal, 1 % Triton X-100, 50 мM NaF и ингибиторы протеаз и фосфатаз, 30 мин при 4 °С. Лизаты для осаждения (pull-down) GST-Е-кадгерином готовили, используя 50 мМ Tris-HCl (pH 7.4), содержащий 1 % NP-40, 150 мМ NaCl и ингибиторы протеаз и фосфатаз, в течение 20 мин при 4 °С. Иммунопреципитацию проводили с 400-600 мкг белка/мкг антител к -катенину или E-кадгерину, 18 ч при 4° С. Для осаждения GST-Е-кадгерином 600 мкг белка из каждой пробы инкубировали 1.5 ч при комнатной температуре с цитоплазматическим доменом Е-кадгерина человека, слитым с GST (глутатион-S трансферазой) и осажденным на глутатион-сефарозе (любезно предоставлен Г.Ф. Решетниковой, Институт цитологии РАН). После осаждения сефарозных шариков центрифугированием надосадок собирали и проводили из него иммунопреципитацию антителами против -катенина. Образовавшиеся комплексы осаждали на шариках протеин А-сефарозы и анализировали электрофорезом в ПААГ с последующим иммуноблоттингом.

Экстракция РНК и ОТ-ПЦР. Тотальную РНК выделяли в TRIzol® (Invitrogen) согласно протоколу производителя. Обратную транскрипцию проводили, используя ревертазу MMLV (Moloney-murine leukaemia virus), следуя инструкциям производителя (Fermentas), со случайными гексапраймерами (Promega), в реакцию брали 2 мкг РНК.

Количественная ОТ-ПЦР проводилась с помощью набора для ПЦР в реальном времени с красителем SYBR Green и референсным красителем ROX (Синтол), на приборе 7500 Real-Time PCR System (Applied Biosystems) в лаборатории стабильности хромосом и клеточной инженерии Института цитологии РАН. Параметры реакции задавали в соответствии с рекомендациями Синтол. Были подобраны и использованы следующие праймеры: N-кадгерин-F, AACCTTTCCCTGAGATACAGC;

N-кадгерин R, CCATTGATGTCCACTGCATG;

E-кадгерин-F, GGAGGAGAACGGTGGTCAAA;

E кадгерин-R, GCCACATCATTTCGAGTCAC;

snail-F, ACCCACACTGGTGAGAAGCC;

TTGTGGAGCAAGGACATGCG;

виментин-F, snail-R, TCAGCTCACCAACGACAAGGC;

виментин-R, AGGGTGCTTTCGGCTTCCTCTC;

axin2-F, CAGTCAGCAGAGGGACAG;

axin2-R, AAGTAGGTGACAACCAGCTC;

oct 3/4-F, CAAGTTGGCGTGGAGACT;

oct-3/4-R, TTCATGTCCTGGGACTCCTC;

nanog F, GATGCAAGAACTCTCCTCCA;

nanog-R, CAATGGATGCTGGGATACTC;

c-myc-F, TTCTCTCCTTCCTCGGACTC;

c-myc-R, GTTTGCCTCTTCTCCACAG;

циклин D1-F, TGCACAGACCTTTGTGGC;

циклин D1-R, TCTGGAAAGAAAGTGCGTTG;

e2f1-F, ATCTGACCACCAAACGCTTC;

e2f1-R, GCTGCCTAGCCACTGGATATG;

gapdh-F, TGTGTCCGTCGTGGATCTGA;

gapdh-R, TTGCTGTTGAAGTCGCAGGAG. Уровень экспрессии генов нормализовали относительно gapdh. Для каждой экспериментальной точки проводили 3 технических повторения, для которых рассчитывали стандартную ошибку среднего. Результаты повторяли в независимых экспериментах с использованием обычной ПЦР.

Для обычной ПЦР использовали Taq-полимеразу (Fermentas), следовали предлагаемому производителем протоколу. Концентрация MgCl2 в реакционном буфере составляла 1.2 мМ, температура отжига 58 °С. Использовали следующие праймеры: tcf3-F, CATCACATGCACCCGCTGAC;

tcf3-R, GGGTAAGGATGCCGGAAACC;

tcf4-F, TGTTCTCCGGAACCACGCAG;

tcf4-R, TCTCATCGCCCTCGTCATCG;

bcl9-2-F, CCCAGCACCAGAATGTGAACC;

bcl9-2-R, CAATGGGCTTGTCGTCCTCC;

T/Brachyury-F, TGACCAAGAACGGCAGGAGG;

T/Brachyury-R, TGGGTCTCGGGAAAGCAGTG;

rest/nrsf–F, ACGTACACGACGGTCAGCGAGT;

rest/nrsf-R, ACGGGCGTTCTCCTGTGTGAGTT.

Праймеры для остальных генов использовались те же, что для количественной ПЦР.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ Общая характеристика активности -катенина и экспрессия его 1.

коактиваторов в недифференцированных мЭСК и при дифференцировке.

Ранее в нашей лаборатории было показано, что для недифференцированных мЭСК характерна примембранная локализация -катенина и отсутствие его в ядрах клеток (Чуйкин и др., 2006). В соответствии с этим наблюдением, в мЭСК двух исследованных нами линий, IOUD2 и E14TV2, -катенин обнаруживается преимущественно при мембранах клеток, где он ко-локализуется с Е-кадгерином;

при этом он практически отсутствует в ядре и слабо выявляется в цитоплазме (Рис. 1).

Рис. 1. -катенин ко-локализуется с Е-кадгерином при мембране и отсутствует в ядрах недифферен цированных мЭСК.

Иммунофлуоресцентное окрашивание мЭСК линии E14TV на -катенин (зеленый), Е-кадгерин (красный) и ДНК (DAPI, синий).

Масштабная линейка – 20 мкм.

Перераспределение -катенина в клетке и его появление в ядре происходило при дифференцировке, индуцированной ретиноевой кислотой (РК) в монослое клеток (Рис. 7В). В соответствии с этими данными, в недифференцированных мЭСК наблюдался низкий уровень экспрессии ядерных партнеров -катенина, факторов tcf и tcf4 и bcl9-2, по сравнению с дифференцированными клетками (Рис. 2Б). -катенин образует комплексы с факторами семейства Tcf/Lef на промоторах Wnt-регулируемых генов, отменяя опосредованную ими репрессию транскрипции. Продукт гена bcl9- работает как ко-активатор -катенина и способен также усиливать импорт -катенина в ядро (Brembeck et al., 2004). Кроме того, при индуцированной РК дифференцировке увеличивается общее содержание -катенина в клетке на уровне как белка, так и мРНК (Рис. 2А и Б).

Чтобы оценить транскрипционную активность -катенина в недифференцированных мЭСК, мы использовали репортерную конструкцию, несущую ген люциферазы под контролем Tсf-связывающих элементов (TopFlash).

Негативным контролем служила аналогичная плазмида с мутированными (нефункциональными) сайтами связывания Tcf (FopFlash). Данные анализа активности люциферазы в клеточных лизатах после временной трансфекции в мЭСК вышеописанных конструкций свидетельствуют о том, что в недифференцированных мЭСК -катенин/Tcf-зависимая транскрипция низка, но она возрастает при дифференцировке (рис. 2В).

Таким образом, в недифференцированных мЭСК экспрессия регулирующих -катенин факторов не благоприятствует его ядерной локализации и сигнальной функции, а при дифференцировке происходят изменения, облегчающие транспорт катенина в ядро и активацию транскрипции.

Рис. 2. Транскрипционная активность -катенина и экспрессия его ядерных партнеров низка в недифференцированных мЭСК и повышается при дифференцировке.

А – Вестерн-блот лизатов клеток линии IOUD2, окраска на -катенин. Б – ОТ-ПЦР на указанные гены – ко-активаторы -катенина, gapdh – контроль нагрузки. В – Результаты анализа люциферазной активности после временной трансфекции в мЭСК линии IOUD репортерной -катенин/Tcf-Luc конструкции TopFlash или ее нефункционального аналога FopFlash. Указаны стандартные ошибки среднего.

Уровень экспрессии, локализация и транскрипционная активность 2.

-катенина при инактивации GSK3 в недифференцированных мЭСК.

Итак, в недифференцированных мЭСК, культивируемых в присутствии сыворотки и фактора LIF, транскрипционная активность -катенина незначительна.

Известно, что для выполнения адгезионной функции на ранних этапах развития и в мЭСК его может заменять плакоглобин (Lyashenko et al., 2011). Строго говоря, -катенин не является абсолютно необходимым для поддержания самообновления и плюрипотентности, однако инактивация его негативного регулятора, киназы GSK3, имеет выраженное положительное действие на самообновление. GSK3 имеет множество других мишеней, но эти эффекты по крайней мере частично опосредованы -катенином, так как не проявляются в полной мере в клетках, лишенных -катенина (Wray et al., 2011). Мы пытались выяснить, какие изменения функциональной активности -катенина происходят при инактивации GSK3 и могут быть важны для самообновления мЭСК.

Для того, чтобы инактивировать GSK3, мы использовали ингибиторы BIO Acetoxime и CHIR99021. Эти ингибиторы блокируют АТФ-связывающие карманы обеих взаимозаменяющих друг друга изоформ киназы GSK3 ( и ), подавляя их киназную активность, но CHIR99021 (далее СНIR) отличается от BIO-Acetoxime (далее BIO) большей специфичностью действия.

Обработка мЭСК линии IOUD2 BIO в концентрации 2.5 мкМ повышала белковый уровень -катенина до 3.6 раз. При обработке СНIR этот эффект также наблюдался, но был выражен слабее (Рис. 3А).

Рис. 3. При инактивации GSK3 в мЭСК -катенин накапливается, и возрастает -катенин/Tcf-зависимая транскрипция. А – Вестерн-блот клеточных лизатов, окраска на -катенин. Приведены относительные значения содержания -катенина в лизатах, нормализованные относительно содержания GAPDH. Б – результаты анализа люциферазной активности после временной трансфекции в мЭСК репортеров TopFlash или FopFlash. Указаны стандартные ошибки среднего по двум повторениям. Обработка мЭСК линии IOUD2 ингибиторами в указанных концентрациях производилась в течение 2 сут.

При этом примембранная локализация -катенина и Е-кадгерина сохранялась, но происходило частичное перераспределение -катенина в цитоплазму и ядро клетки, как видно на Рис. 4.

Риc. 4. -катенин частично перераспределяется в ядро при действии ингибиторов GSK в мЭСК. Иммунофлуоресцентное окрашивание мЭСК линии IOUD2 на -катенин (зеленый), Е-кадгерин (красный) и ДНК (DAPI, синий). Обработка мЭСК ингибиторами в указанных концентрациях проводилась в течение 2 сут. Масштабная линейка – 15 мкм (А) и 10 мкм (Б).

Мы оценили, сопровождается ли ядерная транслокация -катенина активацией -катенин/Tcf-зависимой транскрипции, с помощью временной трансфекции в клетки конструкции TopFlash. При обработке мЭСК обеих линий ингибиторами GSK -катенин/Tcf-зависимая транскрипция возрастает (Рис. 3Б). Как и при анализе накопления -катенина, активация репортера TopFlash при действии СНIR была ниже, чем при действии BIO.

Таким образом, инактивация GSK3 в недифференцированных мЭСК, с одной стороны, приводит к ядерной локализации -катенина и усилению зависимой от него транскрипции, с другой стороны – к сохранению примембранной ко-локализации -катенина и Е-кадгерина. Транскрипционная и адгезионная активности -катенина обычно носят антагонистический характер, поэтому мы более детально исследовали каждую из этих активностей, чтобы понять, какая из них имеет большее функциональное значение при инактивации GSK3 в мЭСК.

Влияние инактивации GSK3 на -катенин-зависимую адгезию в 3.

недифференцированных мЭСК.

Чтобы определить функциональный статус накапливающегося при действии BIO -катенина и оценить его способность связывать Е-кадгерин, мы провели осаждение (pull-down) -катенина из клеточных лизатов, полученных в неденатурирующих условиях, цитоплазматическим доменом Е-кадгерина, слитого с GST (глутатион-S трансферазой, далее – GST-Е-кадгерин) и предварительно инкубированного с глутатион-сефарозой. Результат Вестерн блоттинга комплексов, осажденных таким образом на глутатион-сефарозу, представлен на Рис. 5Б_1. Супернатант после осаждения комплексов также собирали и проводили из него иммунопреципитацию антителами против -катенина, чтобы выявить не связавшийся с GST-Е-кадгерином -катенин. Результаты Вестерн блоттинга этого пула -катенина представлены на Рис. 5Б_2. Также проводилась прямая иммунопреципитация -катенина из тотальных лизатов мЭСК (Рис. 5Б_3). Видно, что при действии BIO накапливаются оба пула -катенина, которые мы условно назвали «адгезионным» (способный связываться с Е-кадгерином, 1) и «сигнальным» (не способный к такому связыванию, 2). Мы также исследовали степень тирозинового фосфорилирования -катенина в обоих пулах, так как известно, что взаимодействие Е-кадгерина с -катенином регулируется фосфорилированием последнего по нескольким тирозиновым остаткам (Lilien, Balsamo, 2005). Эта модификация препятствует связыванию -катенина с компонентами адгезионного комплекса, но благоприятствует его транспорту в ядро.

В соответствии с этим, в «адгезионном» пуле -катенина фосфорилирование по тирозину не выявлялось, но фосфо--катенин присутствовал в «сигнальном» пуле.

Рис. 5. При действии BIO в мЭСК накапливаются «адгезионный» и «сигнальный» пулы -катенина. Результаты осаждения (pull-down) GST-Е-кадгерином из клеточных лизатов после обработки мЭСК линии IOUD2 BIO в течение 2 суток. А – Вестерн-блот, окраска на фосфо-тирозин;

Б – реблот после А, окраска на -катенин. 1 – осажденные на глутатион сефарозу комплексы после инкубации лизата с GST-Е-кадгерином, 2 – иммунопреципитация из надосадка (после осаждения на глутатион-сефарозу) антителами против -катенина;

3 - иммунопреципитация тотального лизата антителами против -катенина.

Степень фосфорилирования -катенина по тирозину при действии BIO увеличивалась пропорционально накоплению этого белка в клетке (Рис. 5).

Таким образом, при действии BIO в мЭСК накапливается, с одной стороны, свободный не фосфорилированный по тирозину -катенин, способный связывать цитоплазматический домен Е-кадгерина, с другой стороны – фосфорилированный по тирозину -катенин, не способный к такому связыванию, но, по-видимому, имеющий ядерную локализацию и участвующий в активации транскрипции (см. рис. 4 и 3Б).

«Адгезионный» пул, очевидно, вносит вклад в усиление межклеточной адгезии.

Чтобы оценить реальную степень вовлечения -катенина в Е-кадгерин-содержащие комплексы, мы провели иммунопреципитацию лизатов клеток линии IOUD антителами против -катенина и показали, что инактивация GSK3 обоими ингибиторами приводит к повышенному связыванию -катенина с Е-кадгерином. На рис. 6А представлены результаты Вестерн блоттинга таких преципитатов, окрашенные на Е-кадгерин. Реципрокные иммунопреципитация и Вестерн блоттинг подтвердили этот результат (Рис. 6Б). Важно отметить, что общее содержание Е-кадгерина существенно не изменялось под действием ингибиторов (Рис. 6В).

Известно, что -катенин выполняет регуляторную функцию в сборке Е-кадгерин-опосредованных контактов, и связывание его с Е-кадгерином может Рис. 6. Инактивация GSK3 сопровождается повышенным связыванием -катенина с Е-кадгерином и усилением межклеточной адгезии. А, Б – Вестерн блот клеточных лизатов после иммунопреципитации антителами к -катенину (А) или Е-кадгерину (Б). В – Вестерн блот тотальных лизатов, окраска на Е-кадгерин и GAPDH. Приведены относительные значения содержания Е-кадгерина, нормализованные относительно уровня GAPDH. Г – Общий вид колоний мЭСК, фазовый контраст. Обработка мЭСК линии IOUD2 ингибиторами в указанных концентрациях проводилась в течение 2 сут.

защищать последний от деградации и способствовать его транспорту к мембране клетки (Chen et al., 1999;

Daugherty, Gottardi, 2007). Вероятно, усиление связывания -катенина и Е-кадгерина отвечает за характерное изменение фенотипа колоний мЭСК после обработки ингибиторами GSK3. В присутствии LIF и сыворотки мЭСК обеих линий растут довольно компактными группами округлой или неправильной формы, с клетками, «разбегающимися» от более плотного центра колонии (Рис. 6Г, контроль). При действии ингибиторов GSK3 колонии становились компактными и многослойными и приобретали более цельную и правильную форму и гладкие края (Рис. 6Г). Таким образом, можно заключить, что функциональное значение возрастания адгезионной активности -катенина при инактивации GSK3 заключается в усилении адгезии клеток внутри колоний недифференцированных мЭСК.

Регуляция маркеров ЭМП при инактивации GSK3 в 4.

недифференцированных мЭСК и при дифференцировке.

Транскрипционная и адгезионная активности -катенина зачастую носят разнонаправленный характер. В частности, некоторые гены-мишени Wnt-сигнального пути являются положительными регуляторами (Snail) или маркерами (виментин) эпителиально-мезенхимального перехода (ЭМП), в то время как сохранение Е-кадгерин-связанного -катенина препятствует ЭМП (Gilles et al., 2003). Чтобы оценить, приводит ли повышенная -катенин/Tcf-зависимая транскрипция в мЭСК к запуску генов-регуляторов ЭМП, мы исследовали уровень мРНК некоторых из них с помощью ОТ-ПЦР в реальном времени. В качестве положительного контроля использовались мЭСК, индуцированные к дифференцировке ретиноевой кислотой в монослое клеток, поскольку было показано, что такая дифференцировка сопровождается запуском ЭМП (Чуйкин, 2006). Мы также исследовали, как присутствие BIO влияет на запуск ЭМП при индукции дифференцировки. В опыт были включены следующие точки: контрольные недифференцированные мЭСК линии IOUD2 («контроль»), мЭСК, культивировавшиеся в присутствии BIO 5 сут («BIO»), дифференцированные клетки («РК», см. Материалы и методы) и клетки, дифференцированные в присутствии BIO («РК+BIO»). Экспрессия snail и виментина, а также другого (Wnt-независимого) положительного регулятора ЭМП, N-кадгерина, существенно повышалась при дифференцировке (примерно в 5, 15 и 55 раз соответственно) (Рис. 7А, ср. «контроль» и «РК»). В недифференцированных клетках, обработанных BIO, уровень мРНК snail и N-кадгерина также повышался, хотя не так сильно, как при дифференцировке (в 2 и 5 раз соответственно). Напротив, уровень мРНК виментина снижался, а Е-кадгерина повышался в этих условиях (Рис. 7А, ср.

«контроль» и «BIO»). Таким образом, не все гены-мишени Wnt, отвечающие за запуск ЭМП, активируются в ответ на BIO-зависимые накопление и повышенную транскрипционную активность -катенина в недифференцированных мЭСК. Кроме того, фенотип клеточных колоний свидетельствует о том, что ЭМП не происходит в большинстве клеток, несмотря на запуск экспрессии snail и N-кадгерина.

Более того, мы обнаружили, что обработка дифференцирующихся мЭСК линии IOUD2 ингибитором BIO в определенной степени ослабляет запуск экспрессии положительных регуляторов ЭМП и усиливает экспрессию Е-кадгерина (Рис. 7А, ср.

РК» и «РК+BIO»). В соответствии с этим, в мЭСК, дифференцирующихся в присутствии BIO, значительная часть -катенина сохранялась в области протяженных межклеточных контактов, в то время как дифференцировка в обычных условиях приводила к существенной потере -катенина из примембранных участков клеток и его уходу в цитоплазму и ядро, а также к утрате клетками тесных контактов друг с другом (Рис. 7В). В клетках Е14TV2, культивируемых 6 сут в отсутствие LIF, обработка ингибитором GSK3 также приводила к снижению экспрессии виментина и snail по сравнению с контролем (Рис. 12В, ср. «контроль» и «СНIR») и сохранению компактной морфологии колоний мЭСК. «Мезенхимальный» фенотип можно было наблюдать только у небольшой части клеток в популяции после обработки BIO, как в клетках линии Е14TV2 и IOUD2, так и в ЭСК человека, и они характеризовались более выраженной ядерной локализацией -катенина. Возможно, именно эти популяции обуславливают усиление экспрессии snail, N-кадгерина и виментина.

В целом, эти данные позволяют предполагать, что при инактивации GSK3 в мЭСК в большинстве клеток адгезионная функция -катенина преобладает над транскрипционной, по крайней мере, в случае маркеров ЭМП.

Следует отметить, что ядерная локализация -катенина также усиливалась при индуцированной РК дифференцировке мЭСК, и особенно при дифференцировке в присутствии BIO (Рис. 7В, «РК+BIO»), что сопровождалось активацией катенин/Tcf-зависимой транскрипции на репортере TopFlash (Рис. 7Б). Таким образом, снижение экспрессии маркеров ЭМП при инактивации GSK3 обусловлено не подавлением -катенин/Tcf-зависимой транскрипции в целом, а какими-то дополнительными факторами. Это также не было связано с подавлением дифференцировки, так как уровень мРНК nanog и oct3/4 снижался еще значительнее при действии BIO (Рис. 7А, «РК+BIO»).

Влияние ингибиторов GSK3 на выживаемость, пролиферацию и 5.

экспрессию регуляторов клеточного цикла в мЭСК.

Мы обратили внимание, что BIO снижает скорость прироста клеточной популяции (Рис. 8А). Этот эффект мог быть вызван усилением гибели клеток, задержкой или остановкой клеток в клеточном цикле. Мы оценили уровень апоптотической гибели с помощью анализа активности каспазы 3 в клеточных лизатах. Как видно на рис. 8Б, BIO не усиливал активность каспазы в течение первых 18 ч обработки даже в концентрации 5 мкМ. Положительным контролем в данном случае служили мЭСК, обработанные ингибитором PI3 киназы LY294002, который вызывает апоптоз в этих клетках. Данные проточной цитофлуориметрии показали, что обработка BIO приводит к накоплению мЭСК в G1 фазе клеточного цикла и соответствующему снижению доли клеток, находящихся в фазе синтеза ДНК (Рис.

8В). Однако влияние на клеточный цикл не удалось воспроизвести с использованием более специфичного ингибитора GSK3: СНIR вызывал стабильное, но очень слабое накопление клеток в G1 фазе (Рис. 8В). Эти различия, возможно, объясняются тем, что BIO в высоких концентрациях частично ингибирует циклин-зависимые киназы.

Рис. 7. Инактивация GSK3 модулирует экспрессию генов-маркеров ЭМП в недифференцированных мЭСК и при запуске дифференцировки. А - Относительная экспрессия мРНК в контрольных (контроль) и дифференцированных (РК) мЭСК IOUD2 и в мЭСК, обработанных BIO в концентрации 2.5 мкМ (BIO). Результаты получены с помощью количественной ОТ-ПЦР, значения нормализованы относительно экспрессии gapdh. Указаны ошибки среднего по трем техническим повторениям. Б – Результаты анализа люциферазной активности после временной трансфекции в клетки репортеров TopFlash или FopFlash. В – Иммунофлуоресцентное окрашивание мЭСК на -катенин (зеленый) и ДНК (ToPro3, синий псевдоцвет). Масштабная линейка – 8 мкм.

Показано, что ингибиторы GSK3 могут подавлять экспрессию некоторых регуляторов клеточного цикла, таких, как циклин А, циклин Е, cdc25c, e2f1 (Sun et al., 2007). С другой стороны, -катенин регулирует Tcf-зависимую транскрипцию e2f1, циклина D1 и c-myc (Abramova et al., 2010). Мы проверили, как изменяется уровень мРНК этих факторов при инактивации GSK3 в мЭСК. Оказалось, что BIO не вызывает существенных изменений в экспрессии циклина D1 и e2f1. Однако и BIO, и, в меньшей степени, СНIR снижали содержание мРНК c-myc (Рис. 9А). Возможно, этот факт отвечает за наблюдаемое накопление мЭСК в G1 фазе, так как c-myc вносит вклад в экспрессию циклина E и cdc25a и регуляцию G1/S перехода в мЭСК.

Влияние инактивации GSK3 на экспрессию фактора REST в мЭСК.

6.

Белок REST/NRSF (RE1-silencing transcription factor/neuron-restrictive silencer factor) представляет собой репрессор транскрипции, одна из функций которого заключается в подавлении экспрессии нейральных факторов в тканях за пределами нервной системы (Gopalakrishnan, 2009). Было также показано участие REST в самообновлении (Singh et al., 2008) и дифференцировке мЭСК в направлении примитивной энтодермы (Yamada et al., 2010). В экзоне 1а гена rest/nrsf обнаружен сайт связывания для факторов Tcf, и показано, что активация Wnt-сигнального пути позитивно регулирует его транскрипцию (Nishihara et al., 2003). Мы исследовали, находится ли транскрипция фактора REST под контролем со стороны ингибиторов GSK3 в мЭСК. В недифференцированных мЭСК экспрессия этого фактора была высока и снижалась в различных индуцирующих дифференцировку условиях, в частности при культивировании мЭСК в бессывороточной среде N2B27 (без LIF), способствующей дифференцировке в нейральные производные (Рис. 9Б). BIO и СНIR Рис. 8. Снижение ингибитором BIO прироста клеточной популяции вызвано накоплением клеток в G1 фазе, но не запуском апоптоза. А – Кривые роста контрольных и обработанных BIO мЭСК линии IOUD2, построенные с помощью МТТ эссея. Указаны стандартные ошибки среднего по 6 повторениям. Б – Результаты анализа активности каспазы 3 in vitro при обработке мЭСК BIO (5 мкМ) или LY294002 (LY, 40 мкМ) в качестве положительного контроля. Негативный контроль – каспазная активность при добавлении в реакцию ингибитора ZVAD. В – Распределение мЭСК по фазам клеточного цикла, полученное методом проточной цитофлуориметрии. Обработка мЭСК ингибиторами в указанных концентрациях проводилась в течение 2 сут.

в наших экспериментах снижали уровень мРНК rest/nrsf во всех условиях. Однако инактивация GSK3 не способствовала, а, напротив, подавляла нейральную дифференцировку на ее ранних этапах, судя по отсутствию экспрессии в обработанных клетках нейрального маркера sox1.

Рис. 9. Инактивация GSK3 подавляет экспрессию генов c-myc и rest/nrsf в мЭСК.

А – Результаты количественной ОТ-ПЦР на гены-регуляторы клеточного цикла в мЭСК линии IOUD2, обработанных ингибиторами GSK3 в указанных концентрациях в течение 2 сут. Значения нормализованы относительно экспрессии gapdh. Указаны ошибки среднего по трем повторениям. Б – Результаты ОТ-ПЦР на продукт гена rest/nrsf в мЭСК линии E14TV2, обработанных 2.5 мкМ BIO или 2.5 мкМ CHIR в обозначенных условиях.

«Контроль» - недифференцированные мЭСК, «N2B27» - мЭСК, культивированные в среде без сыворотки и LIF, поддерживающей нейральную дифференцировку. Уровень экспрессии gapdh использовался как внутренний контроль.

Модуляция уровня экспрессии и активности -катенина ингибитором 7.

MEK/ERK каскада.

Известно, что ингибиторы GSK3 эффективно поддерживают самообновление мЭСК только в сочетании с другими факторами. Инактивация только киназы GSK не способна предотвращать дифференцировку (Ying et al., 2008). В частности, оказалось, что совместное действие СНIR и ингибитора MEK1/2 PD обеспечивает стабильное самообновление, эффективно ингибирует дифференцировку и способствует репрограммированию (Silva et al., 2008). Мы предположили, что PD0325901 (далее PD) модулирует какие-то эффекты инактивации GSK3, значимые для самообновления. Чтобы прояснить этот вопрос, мы исследовали, влияет ли инактивация MEK1/2 на экспрессию и активность -катенина в мЭСК линии Е14TV2.

Оказалось, что PD в концентрации 1 мкМ приводит к увеличению содержания -катенина на уровне белка. Совместное действие PD и BIO имело аддитивный эффект (Рис. 10А). Регуляция уровня -катенина происходила на посттранскрипционном уровне, так как экспрессия мРНК -катенина не изменялась при воздействии PD (Рис. 10Б). Как свидетельствуют данные иммунофлуоресценции, в сочетании с BIO или СНIR ингибитор MEK1/2 не препятствовал появлению Рис. 10. Ингибитор MEK1/2 вызывает накопление -катенина на уровне белка и не препятствует его ядерной локализации. А – Вестерн блот клеточных лизатов после обработки мЭСК линии E14TV2 ингибитором MEK1/2 PD0325901 (PD), CHIR (CH), или двумя ингибиторами (CH+PD) в течение 2 сут. Б – ОТ-ПЦР на мРНК -катенина в мЭСК, обработанных указанными ингибиторами в течение 2 сут;

gapdh использован в качестве внутреннего контроля. В - Иммунофлуоресцентное окрашивание мЭСК, обработанных указанными ингибиторами в течение 2 сут, на -катенин (зеленый) и ДНК (DAPI, синий).

Масштабная линейка – 25 мкм.

-катенина в ядре, однако при обработке только PD не наблюдалось перераспределения -катенина в цитоплазму и ядро, и он сохранялся при мембране, очевидно, участвуя в межклеточной адгезии (Рис. 10В).

Действительно, иммунопреципитация выявила повышенную степень связывания -катенина с Е-кадгерином при обработке клеток PD в течение 2 сут (Рис. 11А). При совместном действии PD и BIO эффект был более выражен, чем в присутствии только BIO. Общий уровень Е-кадгерина не менялся (Рис.11А). Интересно, что PD, как и ингибиторы GSK3, приводил к уплотнению колоний клеток, однако при этом сохранялась их монослойность, и клетки формировали более протяженные пласты (Рис. 11Б). Таким образом, один из эффектов инактивации MEK/ERK заключается в усилении взаимодействия -катенина с Е-кадгерином.

Как уже было отмечено, инактивация MEK1/2 принципиально не отменяла BIO и СНIR-зависимый транспорт -катенина в ядро, и его ядерная локализация наблюдалась в мЭСК, обработанных двумя ингибиторами. В соответствии с данными по локализации, ко-активаторная функция -катенина на конструкции TopFlash под действием PD не изменялась в контрольных клетках, но дополнительно возрастала в клетках, обработанных ингибиторами GSK3 (Рис. 12А). Когда же мы подробнее исследовали экспрессию некоторых -катенин/Tcf-зависимых генов в этих условиях с помощью ОТ-ПЦР, оказалось, что PD в разной степени модулирует их транскрипцию.

В частности, уровень мРНК аxin2, snail и виментина в обрабатываемых BIO мЭСК не изменялся или слабо возрастал в присутствии ингибитора MEK1/2, тогда как экспрессия раннего маркера мезодермы, T/Brachyury, подавлялась (Рис. 12Б, ср.

«BIO» и «BIO+PD»). Мы проверили, справедлива ли такая модуляция транскрипции для клеток, культивируемых в отсутствие LIF, но в присутствии СНIR и PD, в течение 6 сут в концентрациях, которые были заявлены как оптимальные для поддержания самообновления (Ying et al., 2008) (Рис. 12В). При удалении LIF из среды экспрессия всех перечисленных выше мишеней -катенина усиливалась. PD в значительной степени отменял запуск экспрессии этих генов, однако, как ни парадоксально, присутствие CHIR в среде без LIF имело такой же эффект. Присутствие PD в дополнение к CHIR не изменяло или незначительно снижало уровень мРНК рассматриваемых генов (Рис. 12В, «CHIR» и «CHIR+PD»). Экспрессия T/Brachyury в присутствии PD была подавлена во всех условиях. Таким образом, ингибитор MEK/ERK может отменять про-дифференцировочные эффекты инактивации GSK3 в мЭСК за счет подавления транскрипции этого мезодермального регулятора.

Рис. 11. Инактивация MEK1/2 в мЭСК сопровождается накоплением Е-кадгерин связанного -катенина и усилением межклеточной адгезии. А – Вестерн блот клеточных лизатов после иммунопреципитации антителами против -катенина (ИП:

-катенин) и тотальных клеточных лизатов (тотальный лизат). Окрашивание антителами к Е-кадгерину, -катенину и -тубулину как контролю нагрузки. Б – общий вид колоний мЭСК, фазовый контраст. Обработка мЭСК линии E14TV2 ингибиторами (BIO 2.5 мкМ, PD 1 мкМ) проводилась в течение 2 сут.

Рис. 12. Ингибитор MEK1/2 модулирует -катенин/Tcf-зависимую транскрипцию при инактивации GSK3. А – Результаты анализа люциферазной активности после временной трансфекции в мЭСК линии Е14TV2 TopFlash или FopFlash. Обработка ингибиторами производилась в течение 2 сут. Указаны стандартные ошибки среднего по двум повторениям. Б, В – Данные ОТ-ПЦР на гены-мишени -катенина/Tcf и gapdh в качестве внутреннего контроля. мЭСК обрабатывали ингибиторами (BIO 2.5 мкМ, PD 1 мкМ, CHIR 3 мкМ) в указанных условиях. T/Bra - T/Brachyury.

Известно, что в промоторе гена nanog имеется сайт связывания с фактором Tcf3, и в недифференцированных мЭСК Tcf3 связан с ним, в некоторой степени подавляя экспрессию nanog (Yi et al., 2008). Таким образом, этот регулятор плюрипотентности также является мишенью Wnt/-катенин-сигнального пути. В соответствии с этим, мРНК этого фактора накапливалась при ингибировании GSK3 в недифференцированных мЭСК (Рис. 12Б). Инактивация MEK1/2 усиливала этот эффект. Необходимо отметить, что PD сам по себе вызывал более сильное накопление мРНК nanog, чем BIO или CHIR (Рис. 12Б). Однако в отсутствие LIF CHIR несколько эффективнее поддерживал транскрипцию этого фактора, чем PD или даже сочетание обоих ингибиторов, и она сохранялась на таком же или даже более высоком уровне, чем в контроле в присутствии LIF (Рис. 12В).

Заключение Итак, согласно полученным в работе данным, в недифференцированных мЭСК -катенин в основном выполняет адгезионную функцию, а инактивация киназы GSK3 приводит к накоплению и активации -катенина в его обоих функциональных состояниях: как участника и регулятора Е-кадгерин-опосредованной межклеточной адгезии и как ко-активатора транскрипции Wnt/-катенин-зависимых генов. Мы показали, что связывание -катенина и Е-кадгерина усиливается при обработке мЭСК ингибиторами GSK3;

еще более эта тенденция выражена при совместной инактивации GSK3 и MEK1/2, то есть в условиях, эффективно поддерживающих самообновление мЭСК. Вероятно, привлечение -катенина в Е-кадгерин содержащие комплексы обуславливает более плотное контактирование клеток друг с другом внутри колоний недифференцированных мЭСК, наблюдающееся при воздействии ингибиторами GSK3 и MEK1/2.

Несмотря на то, что -катенин/Tcf-зависимая транскрипция с репортерной конструкции TopFlash усиливалась при инактивации GSK3 в недифференцированных мЭСК, мы наблюдали накопление мРНК лишь некоторых из исследованных генов мишеней -катенина в этих условиях. Транскрипция аxin2, известной мишени -катенина/Tcf и отрицательного регулятора Wnt-сигнального пути, запускалась при инактивации GSK3 во всех условиях. Слабая активация экспрессии snail и T/Brachyury наблюдалась в обеих линиях мЭСК, а виментина – только в клетках линии E14TV2. Уровень мРНК регуляторов клеточного цикла циклина D1 и e2f1 не повышался, а c-myc и фактора rest/nrsf – снижался при инактивации GSK3. То, что транскрипция этих генов не активируется, может быть связано с особым состоянием хроматина в мЭСК (Niwa, 2007), а также с балансом ко-активаторов и ко-репрессоров, взаимодействующих с -катенином. Такое предположение подтверждается тем, что в недифференцированных мЭСК наблюдается относительно низкий уровень экспрессии ядерных партнеров -катенина. Интересно также, что многие гены мишени -катенина (T/Brachyury, snail, виментин) при удалении LIF из среды культивирования активировались значительно сильнее, чем в тех же клетках в присутствии CHIR или BIO. Вероятно, ингибиторы GSK3 каким-то образом поддерживают непермиссивное для -катенин-зависимой транскрипции состояние, характерное для самообновляющихся мЭСК, даже на ранних этапах дифференцировки. Эта проблема требует дополнительных исследований, на основе же наших данных можно заключить, что в условиях, поддерживающих самообновление, а также на ранних этапах дифференцировки, адгезионная функция -катенина доминирует над транскрипционной, и накопление -катенина в этих условиях приводит к усилению Е-кадгерин-опосредованной межклеточной адгезии, но лишь избирательной транскрипции генов-мишеней Wnt-сигнального пути.

Выводы 1. В недифференцированных мЭСК -катенин локализуется преимущественно примембранно, образуя комплексы с Е-кадгерином;

трансактиваторная функция -катенина очень низка. При индукции дифференцировки в монослое клеток увеличивается содержание -катенина в ядре, возрастает экспрессия транскрипционных партнеров -катенина и его трансактиваторная способность, что приводит к значительной активации транскрипции -катенин/Tcf-зависимых генов маркеров ЭМП (snail, виментин) и мезодермальной дифференцировки (T/Brachyury).

2. Ингибирование киназы GSK3 в недифференцированных мЭСК вызывает значительное усиление трансактиваторной способности -катенина, что однако не сопровождается существенным увеличением экспрессии -катенин/Tcf-зависимых генов, регулирующих ЭМП. Более того, ингибирование GSK3 в клетках, индуцированных к дифференцировке, ослабляет экспрессию генов-маркеров ЭМП и приводит к сохранению более тесных адгезионных контактов между клетками.

3. Инактивация киназы GSK3 в недифференцированных мЭСК сопровождается накоплением Е-кадгерин-связанного пула -катенина и образованием дополнительных межклеточных контактов, т.е. усиливает адгезионную функцию катенина.

4. GSK3 ингибитор BIO, но не CHIR99021, вызывает снижение скорости прироста популяции мЭСК за счет накопления клеток в G1 фазе клеточного цикла. При этом оба ингибитора подавляют экспрессию c-myc, но не изменяют степень экспрессии других Wnt-зависимых генов - регуляторов клеточного цикла e2f1 и циклина D1.

5. Ингибирование MEK/ERK сигнального каскада приводит к накоплению -катенина, но транскрипция самого гена не активируется. MEK/ERK ингибиторы модулируют действие ингибиторов GSK3: дополнительно усиливается степень связывания -катенина с Е-кадгерином и подавляется экспрессия -катенин/Tcf зависимого гена T/Brachyury – регулятора мезодермальной дифференцировки, что ослабляет про-дифференцировочные эффекты инактивации GSK3.

Список работ, опубликованных по теме диссертации 1. Sineva G.S., Pospelov V.A. Inhibition of GSK3 enhances both adhesive and signalling activities of -catenin in mouse embryonic stem cells// Biology of the Cell. 2010.

V. 102. P. 549–560.

2. Синева Г.С., Лянгузова М.С., Поспелов В.А. Транскрипционная активность -катенина низка в пролиферирующих эмбриональных стволовых клетках мыши и повышается при дифференцировке // Материалы школы-конференция для молодых ученых «Методы культивирования клеток». Санкт-Петербург, 6-10 октября 2008 г.

Цитология. 2008. Т.50. №9. С. 821-822.

3. Sineva G., Lianguzova M., Pospelov V. Beta-catenin transcriptional activity is low in proliferating mouse embryonic stem cells and increases upon differentiation// Материалы 6th ISSCR (International Society for Stem Cell Research) Annual Meeting 2008, Филадельфия, США, 11-14 июня 2008 г.

Abstract

book. Р. 410.

4. Синева Г.С., Поспелов В.А. Инактивация киназы GSK3 в эмбриональных стволовых клетках мыши приводит к замедлению их пролиферации и усилению межклеточной адгезии// Материалы VII Международной конференции "Молекулярная генетика соматических клеток", Звенигород, 22-25 октября 2009 г.

Программа и тезисы. С. 81.

5. Sineva G.S., Pospelov V.A. Inhibition of GSK3 enhances E-cadherin/-catenin mediated intercellular adhesion in mouse embryonic stem cell// Материалы международной конференции "Modern Microscopy Тechniques in Biology and Medicine", Санкт-Петербург, 9-10 ноября 2009 г. Program book. Р. 27.

6. Синева Г.С., Поспелов В.А. Инактивация киназы GSK3 усиливает адгезионную и транскрипционную активность -катенина в эмбриональных стволовых клетках мыши// Материалы II Конференции молодых ученых Института цитологии РАН, Санкт-Петербург, 15-16 февраля 2010 г., Цитология. 2010. Т. 52. №6.

С. 505-506.

7. Sineva G.S., Pospelov V.A. Inhibition of GSK3 enhances both adhesive and signalling activities of -catenin in mouse embryonic stem cells // Материалы международной конференции EMBO Meeting 2010, 4-7 сентября 2010 г. Abstracts. Р.

189.

Список цитированной литературы.

Чуйкин И. А., Лянгузова М. С., Поспелов В. А. Бета-катенин не локализуется в ядре недифференцированных эмбриональных стволовых клеток мыши // Доклады Академии наук. 2006. Т. 41. №1. С. 1-4.

Туроверов К.К., Бикташев А.Г., Дорофеюк А.В., Кузнецова И.М. Комплекс аппаратных и программных средств для измерения спектральных, поляризационных и кинетических характеристик флуоресценции в растворе// Цитология. 1998. Т.40. № 8/9. С. 806-817.

Abramova M.V., Zatulovskiy E.A., Svetlikova S.B., Kukushkin A.N. and Pospelov V.A. e2f1 gene is a new member of Wnt/-catenin/Tcf-regulated genes //Biochem Biophys Res Commun. 2010.

V. 391. № 1. P. 142-146.

Brembeck F.H., Schwarz-Romond T., Bakkers J., Wilhelm S., Hammerschmidt M. and Birchmeier W. Essential role of BCL9-2 in the switch between beta-catenin's adhesive and transcriptional functions //Genes Dev. 2004. V. 18. № 18. P. 2225-2230.

Chen Y.T., Stewart D.B. and Nelson W.J. Coupling assembly of the E-cadherin/beta-catenin complex to efficient endoplasmic reticulum exit and basal-lateral membrane targeting of E cadherin in polarized MDCK cells //J Cell Biol. 1999. V. 144. № 4. P. 687-699.

Daugherty R.L. and Gottardi C.J. Phospho-regulation of Beta-catenin adhesion and signaling functions //Physiology (Bethesda). 2007. V. 22. № P. 303-309.

Do J.T. and Scholer H.R. Regulatory circuits underlying pluripotency and reprogramming //Trends Pharmacol Sci. 2009. V. 30. № 6. P. 296-302.

Gilles C., Polette M., Mestdagt M., Nawrocki-Raby B., Ruggeri P., Birembaut P. and Foidart J.M.

Transactivation of vimentin by beta-catenin in human breast cancer cells //Cancer Res. 2003. V.

63. № 10. P. 2658-2664.

Gopalakrishnan V. REST and the RESTless: in stem cells and beyond //Future Neurol. 2009. V. 4.

№ 3. P. 317-329.

Klaus A. and Birchmeier W. Wnt signalling and its impact on development and cancer //Nat Rev Cancer. 2008. V. 8. № 5. P. 387-398.

Lilien J. and Balsamo J. The regulation of cadherin-mediated adhesion by tyrosine phosphorylation/dephosphorylation of beta-catenin //Curr Opin Cell Biol. 2005. V. 17. № 5. P.

459-465.

Lyashenko N., Winter M., Migliorini D., Biechele T., Moon R.T. and Hartmann C. Differential requirement for the dual functions of beta-catenin in embryonic stem cell self-renewal and germ layer formation //Nat Cell Biol. 2011. V. 13. № 7. P. 753-761.

Marson A., Foreman R., Chevalier B., Bilodeau S., Kahn M., Young R.A. and Jaenisch R. Wnt signaling promotes reprogramming of somatic cells to pluripotency //Cell Stem Cell. 2008. V. 3.

№ 2. P. 132-135.

Nelson W.J. and Nusse R. Convergence of Wnt, beta-catenin, and cadherin pathways //Science.

2004. V. 303. № 5663. P. 1483-1487.

Nishihara S., Tsuda L. and Ogura T. The canonical Wnt pathway directly regulates NRSF/REST expression in chick spinal cord //Biochem Biophys Res Commun. 2003. V. 311. № 1. P. 55-63.

Niwa H. Open conformation chromatin and pluripotency //Genes Dev. 2007. V. 21. № 21. P. 2671 2676.

Silva J., Barrandon O., Nichols J., Kawaguchi J., Theunissen T.W. and Smith A. Promotion of reprogramming to ground state pluripotency by signal inhibition //PLoS Biol. 2008. V. 6. № 10. P.

e253.

Singh S.K., Kagalwala M.N., Parker-Thornburg J., Adams H. and Majumder S. REST maintains self-renewal and pluripotency of embryonic stem cells //Nature. 2008. V. 453. № 7192. P. 223 227.

Smith A.G. Embryo-derived stem cells: of mice and men //Annu Rev Cell Dev Biol. 2001. V. 17.

№ P. 435-462.

Smith A.G., Heath J.K., Donaldson D.D., Wong G.G., Moreau J., Stahl M. and Rogers D. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides //Nature. 1988. V.

336. № 6200. P. 688-690.

Sun A., Shanmugam I., Song J., Terranova P.F., Thrasher J.B. and Li B. Lithium suppresses cell proliferation by interrupting E2F-DNA interaction and subsequently reducing S-phase gene expression in prostate cancer //Prostate. 2007. V. 67. № 9. P. 976-988.

Takahashi K. and Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors //Cell. 2006. V. 126. № 4. P. 663-676.

Umehara H., Kimura T., Ohtsuka S., Nakamura T., Kitajima K., Ikawa M., Okabe M., Niwa H. and Nakano T. Efficient derivation of embryonic stem cells by inhibition of glycogen synthase kinase 3 //Stem Cells. 2007. V. 25. № 11. P. 2705-2711.

Wray J., Kalkan T., Gomez-Lopez S., Eckardt D., Cook A., Kemler R. and Smith A. Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency network and increases embryonic stem cell resistance to differentiation //Nat Cell Biol. 2011. V. 13. № 7. P. 838-845.

Yamada Y., Aoki H., Kunisada T. and Hara A. Rest promotes the early differentiation of mouse ESCs but is not required for their maintenance //Cell Stem Cell. 2010. V. 6. № 1. P. 10-15.

Yi F., Pereira L. and Merrill B.J. Tcf3 functions as a steady-state limiter of transcriptional programs of mouse embryonic stem cell self-renewal //Stem Cells. 2008. V. 26. № 8. P. 1951-1960.

Ying Q.L., Nichols J., Chambers I. and Smith A. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3 //Cell.

2003. V. 115. № 3. P. 281-292.

Ying Q.L., Wray J., Nichols J., Batlle-Morera L., Doble B., Woodgett J., Cohen P. and Smith A.

The ground state of embryonic stem cell self-renewal //Nature. 2008. V. 453. № 7194. P. 519-523.

Автор выражает искреннюю благодарность научному руководителю В.А. Поспелову, М.С. Лянгузовой, И.А. Чуйкину и сотрудникам лаборатории молекулярных основ дифференцировки клеток за всестороннюю поддержку при подготовке представленной работы, а также Н.Д. Аксенову, Г.Ф. Решетниковой, И.М. Кузнецовой и К.К. Туроверову, А.В. Кропотову, А.Н. Томилину и сотрудникам лаборатории молекулярной биологии стволовых клеток за помощь и ценные советы при осуществлении работы.

.

.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.