авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА



Морфо-анатомический и генетический анализ криптических видов морских гастропод рода littorina комплекса saxatilis (littorinidae: caenogastropoda)

На правах рукописи

ГРАЧЕВА Юлия Александровна

Морфо-анатомический и генетический анализ криптических

видов морских гастропод рода Littorina комплекса «saxatilis»

(Littorinidae: Caenogastropoda)

03.02.04 - зоология

03.03.04 – клеточная биология, цитология, гистология

Автореферат диссертации на соискание ученой степени

кандидата биологических наук

Санкт-Петербург 2010

Работа выполнена на кафедре зоологии беспозвоночных Санкт Петербургского государственного университета и в Отделе клеточных культур Института цитологии Российской Академии Наук Научные руководители:

кандидат биологических наук, доцент Наталья Аркадьевна Михайлова доктор биологических наук, доцент Андрей Игоревич Гранович

Официальные оппоненты:

доктор биологических наук Владимир Александрович Лухтанов доктор биологических наук, профессор Евгений Иванович Чумасов Ведущее учреждение:

Российский государственный педагогический университет им.


Защита диссертации состоится 22 апреля 2010 года в 17 часов 30 минут на заседании совета Д 212.232.08 по защите докторских и кандидатских диссертаций при Санкт-Петербургском государственном университете по адресу: 199034, Санкт-Петербург, Университетская наб., д. 7/9, ауд.

С диссертацией можно ознакомиться в научной библиотеке СПбГУ.

Автореферат разослан марта 2010 года.

Ученый секретарь диссертационного совета, /С.И.Сухарева/ кандидат биологических наук e-mail: s_sukhareva@mail.ru


Актуальность темы. Проблема вида до сих пор остается одной из централь ных в биологии (Shlutter, 2001;

Hey, 2001;

Hoekstra, Coyne, 2007;

Mallet, 2008;

Saikia et al., 2008 и др.). Наиболее распространенная, биологическая концепция, рассматривает виды как генетически замкнутые системы (Майр, 1968). С этой точки зрения, степень морфологических различий перестает считаться решаю щим критерием, а основная роль в определении видов отводится репродуктив ной изоляции. Значимость репродуктивной изоляции особенно важна при опре делении криптических видов (видов-двойников) (Майр, 1968). Комплексы сим патричных популяций видов-двойников представляют собой модель для иссле дования микроэволюционных процессов. С одной стороны их можно рассмат ривать как популяции «молодых» видов, недавно достигших репродуктивной изоляции в условиях симпатрии, с другой стороны - широкое распространение таких симпатричных популяций по ареалу видов свидетельствует о возможном вторичном контакте после аллопатрического видообразования.

Моллюски рода Littorina - перспективная модель для исследования как структуры вида, так и микроэволюционных процессов, поскольку представлены несколькими группами криптических видов. Моллюски относительно хорошо исследованы. Среди представителей рода Littorina наибольший интерес с точки зрения анализа микроэволюционных процессов вызывает комплекс видов «saxatilis». Это - три чрезвычайно пластичных криптических вида - Littorina saxatilis (Olivi, 1792), L.arcana Hannaford Ellis, 1978 и L.compressa Jeffreys, 1865.

Несмотря на широкое распространение видов комплекса «saxatilis» на литорали морей Северной Атлантики, имеющиеся данные по их межвидовому сравнению весьма противоречивы, что связано со сложностью их видовой диагностики. С точки зрения формулировки гипотезы о микроэволюционных процессах внутри данной группы видов необходимо проведение комплексного исследования, включающего морфо-анатомический и молекулярно-генетический анализ осо бей из совместных и раздельных поселений. Исходя из этого формулируется цель предлагаемой работы.

Цель и задачи исследования.

Цель работы: сопоставление степени морфо-анатомических различий, экологи ческой подразделенности и генетической дивергенции криптических видов на примере совместно обитающих видов морских гастропод рода Littorina ком плекса «saxatilis».


1. Описать видовой состав моллюсков рода Littorina комплекса «saxatilis» в рай онах исследований (Белое, Баренцево и Норвежское моря).

2. Провести анализ видоспецифичных признаков строения раковины и репро дуктивной системы самцов и самок видов комплекса «saxatilis».

3. Оценить распределение на литорали популяций трех видов комплекса «saxa tilis» - L. saxatilis, L.arcana, L.compressa.

4. Провести поиск видоспецифичных ДНК фрагментов для диагностики крипти ческих видов.

5. Оценить возможность межвидовой гибридизации видов комплекса «saxatilis»

при помощи анализа копулирующих пар и амплификации видо-специфичных ДНК фрагментов.

6. Оценить генетическую близость криптических видов литторин комплекса «saxatilis» по результатам амплификации со случайными и специфическими для L.arcana праймерами и по результатам микросателлитного анализа.

Научная новизна работы. Впервые сделано детальное описание видов Lit torina arcana и L.compressa фауны гастропод Баренцева моря. Впервые получе ны видоспецифичные RAPD паттерны для пяти видов литторин, и показана статистическая значимость межвидовых генетических различий. Для Littorina arcana клонированы и секвенированы видоспецифичные RAPD-фрагменты.

Синтезированные к фрагменту А2.8 праймеры использованы в качестве инст румента для идентификации L. arcana. Для криптических видов комплекса «saxatilis» получены новые, уточненные данные о структуре симпатричных по пуляций, морфо-анатомических особенностях самцов и самок. На основании морфо-генетического анализа партнеров из копулирующих пар показана воз можность спаривания представителей разных криптических видов в природных популяциях, проведена его количественная оценка и выдвинута обоснованная гипотеза о возможности межвидовой гибридизации.

Теоретическое и практическое значение работы. В работе сделано описание трех видов литторин группы «saxatilis» на побережье Баренцева моря, ранее считавшихся одним видом – Littorina saxatilis. Практическая значимость иссле дования состоит в том, что получены данные, уточняющие фауну гастропод Ба ренцева моря, и разработан методический подход, использованный для диагно стики видов-двойников. Этот подход можно считать универсальным и приме нимым для решения аналогичных проблем на криптических видах из любых других таксономических групп животных. Полученные в работе молекулярно генетические данные, в сочетании с морфологическими, расширяют и углубля ют представления о криптических видах и «виде» в целом и важны для реше ния теоретических проблем эволюционной биологии. Результаты исследования могут быть использованы в курсах лекций по зоологии, популяционной биоло гии, теории эволюции.

Апробация работы и публикации. Основные положения доложены и обсуж дены на следующих конференциях: 2nd Leonard Euler Workshop “Molecular Approaches to Cell Function and Differentiation” (Санкт-Петербург, 2003), Вторая Всероссийская школа по морской биологии (Мурманск, 2003), V Научная сес сия МБС СПбГУ (С.-Петербург, 2004)., международная конференция «Сохра нение генетических ресурсов» (Санкт-Петербург, 2004), IX Научная сессия МБС СПбГУ (С.-Петербург, 2008), IX International Symposium on Littorinind Biology and Evolution (Oia, Spain, 2008), а также на научном семинаре кафедры Зоологии беспозвоночных СПбГУ (С.-Петербург, 2008, 2010).

По теме диссертации опубликовано 14 печатных работ, в том числе 6 статей в изданиях, рекомендованных ВАК.

Финансовая поддержка работы. Работа была поддержана грантами РФФИ (07-04-01376-а), РФФИ (07-04-10164-к), РФФИ (08-04-08433-з), РФФИ (08-04 10090-к), РФФИ (09-04-01728-а), грантом DAAD (Leonard Euler Fellowship Program), грантами Научной Программы Президиума Санкт-Петербургского Научного центра РАН (2007, 2008).

Объем и структура диссертации. Диссертация состоит из введения, глав «Об зор литературы», «Материалы и методы», «Результаты», «Обсуждение», выво дов и списка цитируемой литературы, включающего 212 источников. Работа изложена на 194 страницах машинописного текста и иллюстрирована 22 табли цами и 41 рисунком.



Обосновывается актуальность темы и выбор моллюсков рода Littorina в качестве модельных объектов исследования. Сформулированы цель и задачи исследования.

Глава 1. Обзор литературы На основании анализа литературных источников обсуждается проблема криптических видов в контексте концепции «биологического вида». Криптиче ские виды широко распространены в различных таксономических группах, что указывает на общебиологическое значение этого феномена. Исследования сим патрических популяций криптических видов позволяют анализировать меха низмы микроэволюции. С этой точки зрения проведен обзор данных, иллюст рирующих различные аспекты дивергенции таких видов (морфо-анатомические, экологические, кариотипические, биохимические и молекулярные различия).

Подробно рассматривается становление представлений о видах комплекса «saxatilis», учитывая высокую степень их внутривидовой пластичности. Де тально обсуждаются работы, посвященные филогенетическим отношениям ви дов комплекса «saxatilis» и выполненные с использованием молекулярных ме тодов.

Глава 2. Материал и методы Материал собран на побережье Баренцева моря (район пос. Дальние Зелен цы) и Кандалакшского залива Белого моря. Всего собрано 5 видов моллюсков Littorina saxatilis, L. arcana, L. compressa, L. obtusata и L. fabalis из 7 популяций.

Дополнительно использованы сборы из Тюва-губы (Кольский залив), о. Вайгач, г.Тромсе (Норвегия), пролива Каттегат, Ховс Халлар (Швеция), предоставлен ные Е.В.Козминским, М.В.Фокиным, Н.А.Михайловой, А.И. Грановичем, М.В.Пановой и Kerstin Johannesson. Всего проанализировано более 5000 мол люсков, молекулярная часть работы выполнена с использованием 606 особей.

Определение видов проводили на основании морфологических особенностей строения половой системы в соответствии с описанием Д. Рида (Reid, 1996).

Для оценки фенотипического состава использовали ранее разработанную сис тему фенотипов (Сергиевский и др., 1995). Оценку распределения особей на ли торали проводили методами гидробиологического разреза и сбора со стандарт ной площади 1/20 м2.

Половозрелых особей (диаметр раковины 8-12 мм), использовали для вы деления ДНК. Экстракцию ДНК проводили индивидуально из тканей головы и ноги каждой особи, фиксированной в 70% этаноле методом CTAB (Mikhailova, Johannesson, 1998). Полученные образцы ДНК растворяли, доводя концентра цию ДНК до 10нгмкл-1. RAPD анализ проводили методом амплификации ДНК со случайными праймерами. Протестировано 18 праймеров (Operon Tech. Inc.), один из них - OPG-17 (5’-ACGACCGACA-3’) использован для анализа видос пецифичных RAPD паттернов (Mikhailova et al., 2009). Для статистической об работки RAPD паттернов использовали кластерный анализ (Statistica 6.0). Ви доспецифичные RAPD фрагменты использовали для клонирования.

Фрагменты выделяли из геля с использованием Chelex 100 (Sigma), реам плифицировали и лигировали в вектор (pGEM-T Easy Vector, Promega Systems).

Плазмиды трансформировали в компетентные клетки E.coli методом электро порации. Секвенирование фрагментов проводили с использованием набора (Pharmacia-Biotech T7 sequencing kit). К концевым последовательностям фраг ментов синтезированы праймеры (MWG Oligo Synthese). Полученную, специ фическую для L.arcana, пару праймеров А2.8, использовали для тестовых ам плификаций.

Реакцию амплификации ДНК со специфическими праймерами (А2.8) про водили, используя 20 нг геномной ДНК особи (Mikhailova et al., 2009). Продук ты амплификации разделяли в 1.5% агарозном геле, окрашенном бромистым этидием, а также в 6% и 12% полиакриламидных гелях (ПААГ), окрашенных серебром.

Для микросателлитного анализа использовали праймеры к шести микроса теллитным локусам – Lsub8, Lsub16, Lsub32, Lsub62, Lsax6 и Lsax20 (Tie et al, 2000;

Sokolov et al, 2001). Реакции амплификации проводили по протоколу: нг ДНК, по 0.125 мкМ каждого праймера (F+R), 800 мкМ смеси нуклеотидов (dNTP, по 200 мкМ каждого), 1.3, 1.5 или 2.0 мM MgCl2, 0,5 ед Тaq-полимеразы (MBI Pharmacia), 1х ПЦР-буфер (10 мМ Tris-HCl, pH 8.0;

50 мM KCl) с исполь зованием программы: начальная денатурация 950С – 5 мин, затем 30 циклов – 950С – 30 сек;

570С – 30 сек;

720С – 45 сек;

конечная элонгация 720С – 5 мин.

Образцы анализировали методом капиллярного гель-электрофореза (Beckman Coulter CEQ800 Genetic Analysis;

программное обеспечение CEQ Fragment Analysis).

Расчет степени генетических различий между популяциями, соответствия распределению Харди-Вайнберга, коэффициента инбридинга популяции (FST), наличия нулевых аллелей, а также расчет и визуализация филогенетической ги потезы выполнены при помощи программных пакетов (Genepop, Microcheсker, FreeNA, PHYLIP (Felsenstein, 1997), Geneclass 2 version 2.0, Seqboot, Gendist).

Глава 3. Результаты Морфо-анатомический анализ видов литторин показал, что на побережье Восточного Мурмана (Баренцево море) и Норвежского моря обитают 6 видов Littorina littorea, L. saxatilis, L. arcana, L. compressa, L. obtusata и L. fabalis. В этих районах 3 вида моллюсков комплекса «saxatilis» встречаются в совместно обитающих популяциях. В сборах из популяций Белого моря, пролива Катте гат, а также из популяций Тюва губы и о. Вайгач Баренцева моря обнаружен только один вид комплекса – L. saxatilis.

Половозрелые самки литторин комплекса «saxatilis» хорошо различаются по строению половой системы: L. arcana характеризуются копулятивной бур сой, достигающей более половины длины хорошо развитой слизистой железы (яйцекладущий вид) (Рис.1). Слизистая железа самок L. saxatilis преобразована в выводковую сумку с развивающимися эмбрионами (яйцеживородящий вид).

Самки L.compressa характеризуются наличием слизистой железы и особым со отношением размера желез паллиальной части яйцевода (яйцекладущий вид).

Указанные видовые признаки четко воспроизводятся в разных популяциях лит торин и, таким образом, служат хорошим анатомическим видовым «маркером».

Соответствующий анатомический набор признаков у самцов обнаружен только для L.compressa: небольшое число крупных пениальных желез, расположенных дистально, строго в один ряд. Анализ главных компонент не выявил разделения признаков в строении копулятивного органа самцов L. saxatilis - L. arcana на две группы, которые можно было бы трактовать как видовые.

Рис.1. Раковины половозрелых особей (верхний ряд), строение паллиальной части половой системы самок (средний ряд) и строение копулятивного органа самцов представителей комплекса «saxatilis»: L. arcana (А), L. compressa (Б), L. saxatilis (В).

кб – копулятивная бурса, сж – слизи стая железа, кж – капсульная железа, бж – белковая железа, ф – филамент, пж – пениальные железы. По материалам сборов из бухты Оскара и губы Ярныш ной, Восточный Мурман.

Это касается как исследования меристических (число пениальных желез, ряд ность их расположения), так и размерных признаков. Важно отметить, что в тех точках, где обитает только L. saxatilis, 99% самцов характеризуется одноряд ным расположением пениальных желез;

в местах совместного обитания L. saxa tilis - L. arcana таких особей оказалось 60%. В совместных поселениях L. saxa tilis - L. arcana обнаружено большое количество самцов с резекцией (автото мия) пениса после периода размножения. Поскольку в одновидовых популяци ях L. saxatilis такие самцы не обнаружены, сделано предположение об их при надлежности к L. arcana. Анализ размерных распределений раковины с учетом межпопуляционной изменчивости показал, что средний размер раковины L.compressa меньше, чем у L. saxatilis и L. arcana и не различается у последних.

Оценка распределения фенотипических вариантов окраски раковины в популя циях свидетельствует об отсутствии различий между L. saxatilis и L. arcana по набору и частотам цветовых морф, в то время как L.compressa характеризуется иными частотами фенотипов при сходном их наборе.

Популяции L. saxatilis как в одновидовых, так и в совместных поселениях трех видов комплекса «saxatilis», занимают всю ширину литоральной зоны (от верхней части сублиторали до зоны заплеска). Популяции L. arcana приуроче ны к верхней части литоральной зоны (от верхней границы пояса макрофитов до зоны заплеска). L.compressa обитает лишь в пределах пояса макрофитов. Та ким образом, обнаружены видоспецифичные особенности в пространственном распределении видовых популяций но, в то же время, широкое перекрывание занимаемых биотопов в местах совместного обитания.

Амплификация геномной ДНК пяти видов литторин со случайными праймерами (метод RAPD) использована для молекулярно-генетического ана лиза видов. При помощи одного из 18 протестированных праймеров (OPG-17) выявлены видоспецифичные RAPD паттерны (Рис. 2).

250 пн Рис. 2. Результаты RAPD-анализа для 5 видов литторин из бухты Оскара (Барен цево море) с использованием случайного праймера OPG-17. Отмеченный стрелками фрагмент был в дальнейшем клонирован и секвенирован.

Амплификация геномной ДНК с праймерами к фрагменту А2.8. Для L.

arcana выбраны предположительно 3 видоспецифичных фрагмента, они были клонированы и секвенированы, к их концевым последовательностям были син тезированы праймеры. Видоспецифичность праймеров протестирована на ДНК L. arcana, L. compressa и L. saxatilis. Пара праймеров A2.8 к фрагменту разме ром около 280 п.н. специфично аплифицировала ДНК L. arcanа и не амплифи цировала ДНК L. saxatilis и L. compressa (пример см. Рис.3).

1 2 3 4 5 6 7 8 9 10 М 300 п.н.

250 п.н.

Рис. 3. Продукты амплификации ДНК моллюсков с использованием пары прай меров А2.8 у 5 особей L. arcana (дорожки 1,3,5,7,9) и 5 особей L. saxatilis (дорожки 2,4,6,8,10). М – маркер 50 п.н.

Нуклеотидная последовательность фрагмента А2.8 (271 п.н.):

- 5’ – acgacgacaaagaatgactggtgttttaacaaacaatcaggacgattcagagtaaaacaacatcagcttgactaaatatact atagatatacgtaaatacaacttttcttactcagaagacaaatgaacaaaagctgtttctgatcactggaaatctttttcgacga cacaaattagttgttttggcaagtgcattcattttgctgactgcaaacccatgccaataaataaatttaatcgtgctgtgaatca tgttgtgtcggtcgt–3’. Тестирование пары праймеров к фрагменту А2.8 - А2.8F (5’ ggtgttttaacaaacaatcaggac-3’) и A2.8R (5’-caacatgattcacagcacgatta-3’) выполнено на препаратах ДНК, выделенных из самок трех видов моллюсков (L. saxatilis, L.

arcana, L. compressa), идентифицированных морфологически.

Использование данной пары праймеров в реакции амплификации с ДНК литторинид из симпатричных популяций показало следующий результат: из 171 проанализированных моллюсков L. arcana 147 (около 86%) показывали по ложительный результат амплификации, а ДНК оставшихся особей не амплифи цировалась. В то же время, среди 151 особи L. saxatilis у 132 особей (около 87%) не наблюдалось амплификации фрагмента А2.8, в то время как ДНК ос тавшихся моллюсков амплифицировала данный фрагмент. Фрагмент А2.8. не амплифицировался ни у одной особи L. compressa. ДНК особей L. saxatilis из аллопатричных популяций разных географических регионов (Тюва-губа и о.

Вайгач (Баренцево море), Белое море и Ховс Халлар, Каттегат, Северное море) не амплифицировала специфичный для L. arcanа фрагмент в 100% случаев (Табл.1).

Таблица 1. Результаты тестирования пары праймеров А2.8 (F+R).

Всего про верено, месторасположение вид пол ПЦР + ПЦР шт.

Баренцево море (р-н пос. Дальние Зе 111 95 ленцы - б. Оскара, б. Плохие Чевры) Сборы 2002, 2003, 2007 г.г.

F L. arcana Норвежское море (р-н г. Тромсе) 60 52 Сборы 2003, 2007 г. г.) 171 147 Всего в смешанных популяциях 85.9 14. Суммарно для L. arcana в % Баренцево море (р-н пос. Дальние Зе 95 18 ленцы - б. Оскара, б. Плохие Чевры) Сборы 2002, 2003, 2007 г.г. Femb L. saxatilis Норвежское море (р-н г. Тромсе) 56 1 Сборы 2003, 2007 г. г.) 151 19 Всего в смешанных популяциях 12.6 87. Суммарно для L. saxatilis в % Белое море (Кандалакшский з-в) 42 0 Сбор 2003 г.

Баренцево море (Тюва-губа, Кольский 30 0 залив – сбор 2003 г.;

арх. Новая Земля F, M L. saxatilis – сбор 2008 г.) Северное море (Ховс Халлар, Катте- 30 0 гат, Швеция) Сбор 2008 г.

102 0 Всего в однородных популяциях Суммарно для L. saxatilis (однородные популяции) в % 0% 100% Баренцево море (р-н пос. Дальние Зе- 39 0 ленцы, б. Оскара). Сбор 2002 г.

F, M L. compressa Северное море (р-н г. Тромсе). Сбор 15 0 2007 г.

Суммарно для L. compressa в % 54 0% 100% Анализ видовых признаков самцов L. saxatilis и L. arcana с использо ванием молекулярного маркера А2.8. Морфометрический анализ копулятив ного органа самцов L. saxatilis - L. arcana проведен для представителей совме стно обитающих популяций двух видов с использованием полученного молеку лярного маркера. Показано, что самцы ПЦР+ и ПЦР- не характеризуются каки ми-либо качественными или существенными количественными различиями (Рис. 4). Имеется лишь статистически выявляемая связь наличия фрагмента (ПЦР+) с признаками «оттянутость пениального филамента» и «рядность рас положения пениальных желез». По-видимому, эти признаки в большей степени характеризуют самцов L. arcana в совместных с L. saxatilis поселениях. Тести рование ДНК самцов, характеризующихся резекцией пениса, показало, что они амплифицируют А2.8 ДНК фрагмент (ПЦР+). Это подтверждает наше предпо ложение об их принадлежности к L. arcana.

Рисунок 4. Ординация признаков осо бей в пространстве главных компо нент: - самцы ПЦР-;

- самцы ПЦР+;

- самцы Littorina compressa.

Анализ частоты межвидовых копуляций. Для оценки возможности меж видовой гибридизации между видами комплекса «saxatilis» проанализирован состав 64 копулирующих пар, в которых партнеры были идентифицированы морфологически (самки) и молекулярно-генетически (самки и самцы). Обнару жено 14 межвидовых спариваний: 5 пар L. arcana (ПЦР+) L. saxatilis (ПЦР-) и 9 пар L. saxatilis (ПЦР+) L. arcana (ПЦР-). Это - 21.8% от общего числа изу ченных пар. Ни одного случая спаривания L.compressa с особями других видов комплекса не зафиксировано.

Микросателлитный анализ популяций видов комплекса «saxatilis».

Исследование проведено с использованием 6 микросателлитных локусов (Lsub8, Lsub16, Lsub32, Lsub62, Lsax6 и Lsax20). Показан дефицит гетерозигот в ряде популяций всех трех видов (по двум локусам для L. saxatilis и L. arcana и по трем локусам для L.compressa). Специальный анализ выявил специфичное для отдельных популяций всех трех видов наличие «нулевых» аллелей. Расчет генетического расстояния (Fst) свидетельствует о большей степени дифферен цировки L.compressa от двух других видов комплекса (средние Fst = 0,253 и 0,231 для L. arcana и L. saxatilis соответственно). Напротив, L. saxatilis и L.

arcana очень близки (среднее Fst = 0,085). Внутивидовые различия существенно меньше (среднее Fst не превышает 0,048). Позиционирование популяций иссле дованных видов приведено на Рис. 5.

Рисунок 5. Дендрограмма попарных ге нетических расстояний по Нею, полу ченная методом «ближайшего соседа», для видов L. arcana, L. compressa and L.

saxatilis в трех местообитаниях.

a - L. arcana, Тромсе, Норвегия;

c - L.

compressa, Тромсе, Норвегия;

s - L. Saxa tilis, Тромсе, Норвегия;

AC - L. arcana, б.

Плохие Чевры, Россия;

AO - L. arcana, б.

Оскара, Россия;

CC - L. compressa, б.

Плохие Чевры, Россия;

CO - L.

compressa, б. Оскара, Россия;

SC - L.

saxatilis, б. Плохие Чевры, Россия;

SO L. saxatilis, б. Оскара, Россия.

Глава 4. Обсуждение Морфо-анатомические исследования подтвердили наличие трех криптиче ских видов литорин комплекса «saxatilis» на побережье Баренцева моря. Пара видов-двойников L. saxatilis и L. arcana характеризуется минимальными гене тическими отличиями, отсутствием выраженных конхологических и анатоми ческих различий. Значительное сходство в строении копулятивного органа ви дов-двойников косвенно свидетельствует о возможности межвидовых спарива ний, и экспериментальные данные по скрещиванию (Warwick et al., 1990) под тверждают этот факт. Мы предполагаем, что L. saxatilis и L. arcana - эволюци онно молодые, относительно недавно дивергировавшие виды, сохранившие способность к межвидовой гибридизации. В пользу такого объяснения говорит характер распределения в геномной ДНК особей криптических видов (симпат рических и аллопатрических популяций) молекулярного маркера А2.8: ампли фикация специфичного для L. arcana фрагмента наблюдалась у L. saxatilis в по пуляциях, совместно обитающих с L. arcana, и не обнаружена в аллопатриче ских популяциях L. saxatilis. Выдвинуты и обсуждаются две гипотезы для объ яснения феномена: 1. Популяции L. saxatilis и L. arcana до сих пор сохранили предковый полиморфизм по фрагменту А2.8. После эволюционного разделения двух видов частота встречаемости маркера А2.8 дивергировала, оставаясь не изменной у L. arcana и снижаясь у L. saxatilis. 2. Фрагмент ДНК А2.8 является видоспецифичным для L. arcana, а присутствие его в геномной ДНК особей L.

saxatilis объясняется межвидовой гибридизацией в природных популяциях. По лученные нами данные по наличию в природе межвидовых копулирующих пар L. saxatilis - L. arcana свидетельствуют в пользу второй гипотезы. Если гибри дизация двух видов будет окончательно доказана, можно будет говорить об уникальной ситуации: системе из двух видов-двойников, характеризующихся интенсивным генетическим обменом и обладающих различными репродуктив ными стратегиями.

Выводы 1. На литорали Восточного Мурмана (Баренцево море, Россия) и г. Тромсе (Норвежское море, Норвегия) обитает 6 видов моллюсков рода Littorina: L.

littorea, два вида комплекса «obtusata» – L. obtusata, L. fabalis и три вида комплекса «saxatilis» – L. saxatilis, L. arcana, L. compressa.

2. Сравнение конхологических признаков у представителей видового комплек са «saxatilis» свидетельствует о высокой степени их внутри- и межпопуляци онной изменчивости. L. compressa отличается меньшими размерами ракови ны, в паре криптических видов L. saxatilis – L. arcana конхологических ви довых различий не выявлено.

3. Для самок видового комплекса «saxatilis» обнаружены хорошо выраженные различия строения половой системы, связанные с размером копулятивной бурсы и соотношением размеров добавочных желез паллиальной части яй цевода. Самцы L. compressa характеризуются выраженными отличиями в строении копулятивного органа. Различия в строении копулятивного органа самцов L. saxatilis и L. arcana проявляются лишь на количественном, стати стическом уровне.

4. Анализ популяционной структуры видов (на основании морфо анатомических характеристик) показал неравномерное распределение видо вых популяций по горизонтам приливно-отливной зоны: L. compressa при урочена к зоне макрофитов, L.arcana населяет верхние горизонты литорали, L. saxatilis распространена по всей ширине литоральной зоны. При этом на блюдается значительное перекрывание популяционных ареалов (симпатрия).

5. Генетические различия видов обнаружены методом амплификации геномной ДНК со случайными праймерами (метод RAPD). Получены идентичные ви доспецифичные ДНК паттерны для морфологически типированных самок L.saxatilis, L.arcana и L.compressa из разных географических популяций.

6. При помощи молекулярного маркера А2.8 (клонированный видоспецифич ный для L.arcana ДНК-RAPD фрагмент) показано, что в симпатричных по селениях моллюсков 86% особей L.arcana амплифицирует фрагмент А2.8, однако 100% особей L.compressa и 87% особей L.saxatilis фрагмент А2.8 не амплифицирует. Ни одного случая амплификации фрагмента А.2.8 у особей L.saxatilis из аллопатричных популяций не обнаружено.

7. Показана возможность межвидового спаривания видов-двойников L.saxatilis и L.arcana в результате анализа партнеров в копулирующих парах при по мощи морфологического описания партнеров и амплификации ДНК с прай мерами к фрагменту А2.8. L.compressa в составе копулирующих пар не об наружена.

8. Микросателлитный анализ выявил четкие генетические различия между близкими видами литторинид группы «saxatilis» и показал, что виды L.arcana и L. saxatilis генетически более близки друг другу, чем виды L. ar cana и L. compressa.

9. Криптические виды L. arcana и L. saxatilis – эволюционно молодые виды, характеризующиеся неполной генетической изоляцией, что, по-видимому, определяет их морфологическое сходство.

Список работ, опубликованных по теме диссертации в изданиях, рекомендованных ВАК:

1. Mikhailova N.A., Petrova (Gracheva) Y.A. 2004. Molecular markers for identifica tion of the sibling species of marine gastropods of the genus Littorina // Материалы международной конференции «Сохранение генетических ресурсов», Санкт Петербург, Цитология: Т.46, №9, с. 823-824.

2. Гранович А.И., Михайлова Н.А., Знаменская О., Петрова (Грачева) Ю.А.

2004. Видовой состав моллюсков рода Littorina (Gastropoda, Prosobranchia) Восточного Мурмана // Зоологический журнал. Т.83. № 11. С.1305-1317.

3. Ганжа Е.В., Гранович А.И., Петрова (Грачева) Ю.А., Михайлова Н.А. 2006.

Анализ гистологических особенностей строения пениальных желез моллюсков рода Littorina Северной Атлантики // Вестн. С.-Петерб. ун-та. Сер.3. Вып.4. С.


4. Гранович А.И., Лоскутова З.И., Грачева Ю.А., Михайлова Н.А. 2008. Морфо метрический анализ копулятивного органа моллюсков видового комплекса «saxatilis» (Gastropoda: Coenogastropoda, Littorinidae): проблемы идентификации и статуса видов // Зоологический журнал. Т.87, вып.12, С.1425-1436.

5. Михайлова Н.А., Грачева Ю.А., Гранович А.И. 2008. Анализ частоты межви довых спариваний в копулирующих парах морских гастропод рода Littorina комплекса «saxatilis» // Вестник С.-Петерб. ун-та. Сер. 3. Вып. 4. С. 5-9.

6. Mikhailova N.A., Gracheva Y.A., Backeljau T., Granovitch A.I. 2009. A potential species-specific molecular marker suggests interspecific hybridization between sib ling species Littorina arcana and L.saxatilis (Mollusca, Caenogastropoda) in natural populations // Genetica. V.137. N3. P.333-340.

в других изданиях:

7. Гранович А.И, Михайлова Н.А., Знаменская О.С., Петрова (Грачева) Ю.А.

2003. Многолетняя динамика зараженности трематодами совместно обитающих популяций литторин: опыт двадцатилетнего анализа в модельной точке губы Чупа Белого моря // Тез. докл. IV науч. сессия МБС СПбГУ. СПб. С.

53 - 54.

8. Петрова (Грачева) Ю.А., А.И. Гранович, Н.А.Михайлова. 2004. Молекуляр ные маркеры для идентификации близких видов литторинид Баренцева моря. // В кн.: «Морская флора и фауна северных широт. Механизмы адаптации и регу ляции роста организмов» Апатиты: Изд. КНЦ РАН. С. 149-156.

9. (Petrova (Gracheva) Yu.A., Granovitch A.I., Mikhailova N.A. 2004. Molecular markers for the identification of close Barents Sea littorinid species // In: Marine flora and fauna of the Nordic latitudes: mechanisms of adaptation and growth regula tion of organisms. Apatity: Print. Kola Science Centre RAS. P. 326-333).

10. Петрова (Грачева) Ю.А., Михайлова Н.А., Гранович А.И. 2005. Морфологи ческие особенности и изменчивость копулятивного аппарата самцов беломор ских моллюсков Littorina saxatilis (Olivi) // Тез. докл. VI науч. сессии МБС СПбГУ. СПб. С. 55 - 56.

11. Петрова (Грачева) Ю.А., Гранович А.И., Михайлова Н.А. 2007. Идентифика ция кладок литорального моллюска Littorina arcana с использованием молеку лярно-генетических методов // Материалы 2 Международной конференции «Экологические исследования беломорских организмов» СПб. ЗИН РАН. 18 22.07.2007. с.92.

12. Грачева Ю.А., Гранович А.И., Михайлова Н.А. 2008. Анализ частоты межви довых спариваний в копулирующих парах морских гастропод рода Littorina комплекса «saxatilis» // IX Научная сессия МБС СПбГУ. 2008. С. 47-48.

13. Loskutova Z.I., Mikhailova N.A., Granovitch A.I., Gracheva Y.A. 2008. Mor phometrical analysis of three rough periwinkles copulatory organ // Abstracts of Int.Symp. on Littorinid Biol. 2-7 Sept.2008. Oia, Spain. P.29.

14. Gracheva Yu. A., A.I. Granovitch & N.A. Mikhailova. 2008. Analysis of the inter specific crosses frequency in copulating pairs of littorinids of «saxatilis» species complex // Abstracts of the IX International symposium on Littorinind Biology and Evolution. 2-7 Aug, Oia, Spain. P. 20.


Похожие работы:

2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.