авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Натриевые каналы в клетках лейкемии человека к562 и лимфомы u937: идентификация и особенности регуляции

На правах рукописи

СУДАРИКОВА

Анастасия Владимировна

НАТРИЕВЫЕ КАНАЛЫ В КЛЕТКАХ ЛЕЙКЕМИИ ЧЕЛОВЕКА К562 И

ЛИМФОМЫ U937: ИДЕНТИФИКАЦИЯ И ОСОБЕННОСТИ РЕГУЛЯЦИИ

03.03.04 – Клеточная биология, цитология, гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

САНКТ-ПЕТЕРБУРГ 2011

Работа выполнена в Учреждении Российской академии наук Институт цитологии РАН

Научный руководитель: доктор биологических наук Юрий Алексеевич Негуляев Институт цитологии РАН, Санкт-Петербург

Официальные оппоненты: доктор биологических наук, профессор Зоя Иринарховна Крутецкая Санкт-Петербургский государственный университет доктор биологических наук Ирина Ильинична Марахова Институт цитологии РАН, Санкт-Петербург

Ведущая организация: Институт физиологии им. И.П.Павлова РАН, Санкт-Петербург

Защита состоится «28» октября 2011 года в 13 часов на заседании Диссертационного совета Д.002.230.01 при Институте цитологии РАН по адресу:

194064, Санкт-Петербург, Тихорецкий пр., д. Сайт института: www.cytspb.rssi.ru Адрес электронной почты института: cellbio@mail.cytspb.rssi.ru Факс института (812) 297-03-

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН Реферат разослан «_» сентября 2011 г.

Ученый секретарь Диссертационного совета, кандидат биологических наук Е.В. Каминская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследования.

Транспорт ионов через плазматическую мембрану представляет необходимое условие жизнедеятельности всех клеток. Быстрые изменения входного потока катионов (Na+, Ca+2, Mg+2) связаны, в первую очередь, с функционированием ионных каналов. До недавнего времени ионные каналы принято было разделять на лиганд- и потенциал-управляемые. В настоящее время такая трактовка является весьма упрощенной. В последние десятилетия сформировались представления о семействах потенциал-независимых (non-voltage-gated) ионных каналов клеточных мембран. Актуальной задачей становится молекулярная и функциональная идентификация таких каналов в различных типах клеток. Как вероятные молекулярные корреляты потенциал-независимых катионных каналов рассматриваются белки суперсемейств TRP (transient receptor potential) и DEG/ENaC (дегенерины/эпителиальные натриевые каналы).

Катионные каналы, характеризующиеся натриевой селективностью и отсутствием потенциал-управляемого воротного (gating) механизма, были обнаружены в клетках различного происхождения и специализации. Потенциал независимые натриевые каналы были описаны в транспортных эпителиях, а также в гладкомышечных клетках [1], перитонеальных макрофагах [2], клетках карциномы А431 [3] и миелоидной лейкемии К562 [4, 5]. Кроме того, клетки К562, имеющие свойства мультипотентного предшественника клеток крови, оказались удобной моделью для изучения путей активации каналов в электроневозбудимых клетках [6, 7]. В то же время молекулярная природа данных каналов до сих пор не установлена.

Судя по биофизическим характеристикам, Na-селективные каналы в различных электроневозбудимых клетках, в том числе в клетках К562, близки к каналам семейства DEG/ENaC [8], за исключением чувствительности к диуретику амилориду. Ингибирование ионных токов и каналов амилоридом или его производными традиционно рассматривается как главный критерий, доказывающий их принадлежность к этому семейству. Однако недавно появились сведения о каналах, гомологичных но имеющих пониженную ENaC, чувствительность к амилориду [9, 10]. В отличие от каналов почечного эпителия идентификация натриевых каналов, обнаруженных в других специализированных тканях и клетках, остается нерешенной проблемой.

Транспорт натрия и регуляция каналов в реабсорбирующем эпителии почки исследуются достаточно давно, однако внутриклеточные механизмы модуляции активности ENaC по-прежнему вызывают много вопросов. Многочисленные дискуссии касаются возможного участия цитоскелета в функционировании эпителиальных каналов ENaC. В связи с этим интересно отметить, что, как ранее было показано, активность натриевых каналов в клетках К562 критически зависит от состояния примембранного актинового цитоскелета Согласно [4–7].

современным представлениям, для связи плазматической мембраны и актинового цитоскелета существенны богатые холестерином липидные микродомены (рафты).

Ряд данных свидетельствует, что ассоциация с микродоменами может быть решающим фактором, определяющим активность интегральных мембранных белков, в том числе ионных каналов [11]. Появились работы, посвященные исследованию возможной связи каналов ENaC с липидными доменами, однако данные весьма противоречивы Поэтому специального внимания [12–16].

заслуживает изучение роли липидного окружения в функционировании потенциал независимых натриевых каналов.

Цели и задачи исследования.

Цель работы – функциональная и молекулярная идентификация потенциал независимых натриевых каналов и анализ механизмов их регуляции.

В связи с этим были поставлены следующие задачи:

1. Оценить проницаемость натриевых каналов для двухвалентных катионов (Ca+2, Mg+2) в широком диапазоне концентраций.

2. Исследовать экспрессию -, -, -субъединиц hENaC в клетках миелоидной лейкемии человека К562 и лимфомы U937 методом ОТ-ПЦР.

3. Охарактеризовать чувствительность потенциал-независимых натриевых каналов к амилориду;

определить, присутствует ли амилорид-чувствительная компонента в составе интегральных натриевых токов в клетках К562 и U937.

4. Исследовать состояние актинового цитоскелета в клетках К562 и U937 в различных условиях, в том числе при снижении уровня мембранного холестерина.

5. Выяснить особенности регуляции натриевых каналов и их связи с динамикой актина в клетках с пониженным содержанием холестерина.

Основные положения, выносимые на защиту:

В клетках К562 и U937 экспрессируются потенциал-независимые натриевые 1.

каналы, принадлежащие к семейству ENaC.

Потенциал-независимые натриевые каналы в клетках К562 и U937 не 2.

блокируются амилоридом. Фармакологическая чувствительность, в частности ингибирование амилоридом, по-видимому, не может рассматриваться как необходимый и достаточный аргумент, доказывающий принадлежность каналов к семейству DEG/ENaC.

Контролируемая сборкой и разборкой микрофиламентов активация и 3.

инактивация является отличительной особенностью регуляции натриевых каналов в клетках К562 и U937.

Потенциал-независимые натриевые каналы не ассоциированы с богатыми 4.

холестерином мембранными микродоменами.

Научная новизна работы.

Впервые получены данные о молекулярной природе потенциал-независимых натриевых каналов, идентифицированных в клетках К562 и U937. Показана экспрессия субъединиц эпителиального натриевого канала ENaC в этих клетках. С помощью различных вариантов метода патч-кламп детально исследовано действие диуретика амилорида на одиночные каналы и интегральные натриевые токи;

установлено отсутствие амилорид-чувствительной компоненты. Впервые показано, что натриевые каналы в клетках К562 непроницаемы для физиологически значимых двухвалентных катионов – кальция и магния в широком диапазоне концентраций. Сделан вывод, что в плазматической мембране клеток К562 и U функционируют амилорид-нечувствительные каналы ENaC.

Впервые показано, что натриевые каналы в клетках U937 активируются при действии деструкторов актинового цитоскелета;

сборка актина на цитоплазматической стороне мембраны приводит к инактивации каналов.

Впервые выявлены особенности поведения натриевых каналов в зависимости от содержания холестерина, обязательного липидного компонента клеточных мембран. Обнаружена реорганизация F-актина и ингибирование механозависимой активации катионных каналов клеточной мембраны в клетках К562 при частичной экстракции мембранного холестерина.

Теоретическое и практическое значение работы.

Молекулярная идентификация потенциал-независимых натриевых каналов способствует пониманию механизмов регуляции каналов семейства ENaC и их связи с цитоскелетом. Выявление амилорид-нечувствительного натриевого канала ENaC имеет принципиальное значение для анализа транспорта ионов и идентификации каналов в различных типах клеток. Полученные результаты демонстрируют, что блокирование ионных токов амилоридом или его аналогами не может использоваться как исчерпывающий критерий, определяющий принадлежность каналов к семейству ENaC. Результаты, свидетельствующие о связи уровня мембранного холестерина с перестройками актиновой сети и активностью каналов, представляют теоретический интерес для понимания механизмов регуляции транспортных белков. Данные по действию различных агентов, в том числе амилорида, циклодекстрина, цитохалазинов, на функциональные свойства каналов могут быть применены при разработке и тестировании новых лекарственных препаратов. Полученные результаты используются в курсах лекций для студентов факультета медицинской физики и биоинженерии Санкт-Петербургского государственного политехнического университета.

Апробация работы. По теме диссертации опубликовано 11 работ (3 статьи и 8 тезисов) в отечественных и зарубежных изданиях. Материалы работы доложены и обсуждены на Международном симпозиуме «Стволовые клетки, регенерация, клеточная терапия» (Санкт-Петербург, 2004), Межвузовской научно-технической конференции «XXXIII неделя науки СПбГПУ» (Санкт-Петербург, 2004), 10-й Пущинской школе-конференции молодых ученых «Биология – наука ХХI века»

(Пущино, 2006), Всероссийском симпозиуме «Биология клетки в культуре» (Санкт Петербург, 2006), конференциях Британского физиологического общества (Лондон, 2006;

Дублин, 2009), на семинарах ИНЦ РАН.

Объем и структура диссертации. Диссертация состоит из введения, обзора литературы, описания материалов и методов исследования, результатов, обсуждения, выводов и списка литературы, включающего 179 ссылок. Диссертация изложена на 106 страницах и иллюстрирована 33 рисунками и 2 таблицами.

МАТЕРИАЛЫ И МЕТОДЫ Клеточные культуры. Основными объектами исследования служили клетки миелоидной лейкемии человека К562 и гистиоцитарной лимфомы U937, полученные из Российской коллекции клеточных культур (Институт цитологии РАН). Клетки культивировали на среде RPMI-1640 с добавлением 10 % эмбриональной телячьей сыворотки и 80 мкг/мл гентамицина.

Электрофизиология. С помощью метода локальной фиксации потенциала (патч-кламп) регистрировали ионные токи через одиночные каналы на участке мембраны нативной клетки (конфигурация cell-attached) и в изолированных фрагментах мембран (конфигурации inside-out и outside-out). При отведении сигнала "от целой клетки" (whole-cell) измеряли токи через всю клеточную мембрану. Трансмембранные ионные токи регистрировали с помощью высокоточного измерительного усилителя EPC8 (HEKA, Germany). Сигналы из усилителя в реальном масштабе времени через 12-разрядный аналого-цифровой преобразователь Москва) записывали на диск компьютера для (L-card, последующего анализа. Пипетки изготавливали из стеклянных капилляров на горизонтальной микрокузнице Р-97 (Sutter Instrument, USA). Сопротивление пипеток, заполненных стандартным раствором, составляло около 2–4 МОм (конфигурация whole-cell) и 5–15 МОм в остальных режимах. Мембранный потенциал определяли как потенциал раствора с внутренней стороны мембраны относительно наружного раствора. Для оценки механочувствительности использовали известный способ механической стимуляции участка мембраны – локальное растяжение посредством уменьшения (P0) гидростатического давления в регистрирующей пипетке.

Растворы. Стандартный наружный раствор содержал (мМ): 145 NaCl, CaCl2, 1 MgCl2, 10 HEPES/TrisOH. При отведении cell-attached использовали калиевый внеклеточный раствор, содержащий (мМ): 145 KCl, 2 CaCl2, 1 MgCl2, HEPES/KOH. Раствор, контактирующий с внутриклеточной стороной мембранного фрагмента, содержал (мМ): 140 KAspartate, 5 NaCl, 2 EGTA, 1 MgCl2, HEPES/TrisOH и соответствующее количество CaCl2 (0.176 мМ) для установления свободной концентрации ионов кальция на уровне 0.01 мкМ (pCa=8). При исследовании проницаемости каналов для двухвалентных катионов использовали наружные растворы с различными концентрациями Mg2+ (Ca2+): 90, 20, 10, 2, 1 мМ.

Остальные катионы были заменены на непроникающие Tris+ и N-метил-D глюкамин (NMDG+). pH всех растворов составлял 7.3. Очищенный G-актин, выделенный из скелетных мышц кролика [17], хранили в растворе низкой ионной силы (2 мМ Tris-HCl, 0.1 мМ CaCl2, 0.2 мМ ATP и 0.02 % NaN3, pH=7.5) и использовали в течение 5 сут.

Обработка результатов. Для количественной оценки уровня активности каналов в мембранном фрагменте использовали значение вероятности их открытого состояния Ро = I/Ni, где N – число работающих каналов в патче, I – средний ток для заданного временного интервала, i – средний ток через открытый канал. Амплитуды токов, протекающих через одиночные каналы, рассчитывали из амплитудных гистограмм, описанных функцией Гаусса, или оценивали непосредственно из записей токов. Обработку экспериментальных данных проводили с использованием программных пакетов pCLAMP 10.2 (Axon Instruments Inc., USA), Microcal Origin 6.1 (Microcal Software, USA). Результаты представлены как среднее ± средняя ошибка.

Модификация липидного состава. Для снижения уровня мембранного холестерина клетки инкубировали (1 ч, 37 С, 5 % CO2) в среде RPMI-1640 без сыворотки в присутствии 2.5–5.0 мМ метил- -циклодекстрина (M CD), циклического олигосахарида, избирательно связывающего стеролы. Контрольными являлись клетки, переведенные на среду, не содержащую сыворотки и MCD.

Снижение уровня холестерина в клетках К562 после обработки M CD было подтверждено энзиматическим колориметрическим методом.

Флуоресцентная микроскопия. Для оценки состояния актинового цитоскелета применяли стандартные методики фиксации клеток и окраски F актина с помощью флуоресцентного красителя родамин-фаллоидина (TRITC phalloidin, 2 мкМ). Для получения изображений использовали конфокальный микроскоп LSM 5 Pascal либо флуоресцентный микроскоп «Carl Zeiss IM 35».

Обратная транскрипция и полимеразная цепная реакция (ОТ-ПЦР).

Общую РНК из клеток К562 выделяли с помощью гуанидин-тиоцианатного метода [18], с небольшими модификациями. Обратную транскрипцию проводили с использованием MMLV-обратной транскриптазы (Силекс, Россия) согласно инструкции фирмы-изготовителя. ПЦР проводили с использованием Hot-taq полимеразы (Силекс, концентрация 5 ед/мкл), 0.5 мкМ прямых и обратных праймеров и 0.5–2 мкл кДНК. Праймеры для ОТ-ПЦР были синтезированы согласно опубликованным последовательностям [19]. ENaC (ген SCNN1А):

прямой 5’-GGGTCTTCCAGATGCTATCG-3’, обратный 5’-AAGGACAG AGACATGGGGTG-3’, размер продукта 376 п.н.;

ENaC (ген SCNN1B): прямой 5’ AATACTGCAACAACCGGGAC -3’, обратный 5’-GATCTCCCCAAACTCGATGA 3’, размер продукта 392 п.н.;

(ген прямой 5’ ENaC SCNN1G):

AGATGGTGGAGAAATGTGGG-3’, обратный 5’-ATACTGTTGGCTGGGCTCTC 3’, размер продукта 367 п.н. Условия амплификации: 94 С – 9 мин 30 с, затем циклов (94 С – 30 с, 58 С – 40 с, 72 С – 40 с) и 72 С – 5 мин. Продукты ПЦР электрофоретически разделяли в 6 %-ном полиакриламидном геле, окрашивали бромистым этидием (0.5 мкг/мл).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ Функциональная идентификация потенциал-независимых натриевых каналов в клетках К562. С помощью различных вариантов метода патч-кламп исследовали функциональные свойства натриевых каналов в плазматической мембране клеток К562. В контрольных условиях унитарные токи измеряли в присутствии натрия (145 мМ Na+) как основного проникающего катиона в растворе с внеклеточной стороны мембраны. На рис. 1 представлен пример высокой фоновой активности натриевых каналов в участке мембраны нативной клетки (cell Характеристики потенциал-независимых натриевых каналов attached).

(проводимость 12–13 пСм, потенциал реверсии 20–25 мВ) сходны с полученными ранее в экспериментах на клетках К562 [4, 6].

Известно, что некоторые представители семейства DEG/ENaC проводят двухвалентные катионы;

в частности, каналы ASIC1a и механочувствительные каналы MEC-4 проницаемы для ионов Ca2+ [20]. Поэтому для функциональной идентификации натриевых каналов необходимы данные об их проницаемости для двухвалентных катионов в широком диапазоне концентраций.

0, I, пА -10 мВ з о 0, 0, E, мВ з -20 мВ о -40 -20 20 -0, з -30 мВ 12.7 пСм -0, о -0, 1 пА -0, 500 мс Рис. 1. Активность натриевых каналов в эксперименте на участке мембраны нативной клетки (cell-attached). Записи токов при различных значениях мембранного потенциала (указаны справа около каждой записи) и соответствующая вольт-амперная характеристика. Значение проводимости каналов составляет 12.7 пСм.

В экспериментах с заменой ионов во внешнем растворе (конфигурация outside-out) исследовали проницаемость натриевых каналов в клетках К562 для двухвалентных катионов (Ca+2, Mg+2). Раствор в пипетке, имитирующий внутриклеточный, содержал 140 мМ KAspartate в качестве основного электролита. Для поддержания тоничности и ионной силы наружных растворов, содержащих 2, 20 мМ MgCl2 или 10 мМ CaCl2, остальные катионы были заменены на непроникающие катионы – Tris+ и N-метил-D-глюкамин (NMDG+). Активность натриевых каналов наблюдали в 40 % экспериментов (n=32). На рис. 2 представлен эксперимент (конфигурация outside-out), в котором удалось провести несколько смен раствора с внешней стороны мембраны с последующими отмывками (обратными заменами раствора на контрольный). Показано, что токи, регистрируемые в контрольном Na-содержащем растворе, обратимо устранялись при замене ионов Na+ на ионы Mg+2 или Ca+ (n=14) в различных концентрациях (2–20 мМ). Таким образом, натриевые каналы в клетках К562 не проводят двухвалентные катионы в широком диапазоне концентраций.

В клетках К562 помимо натриевых каналов были зарегистрированы катионные каналы, обладающие механочувствительностью и, возможно, также принадлежащие к семейству DEG/ENaC (рис. 3). Выявлена проницаемость механочувствительных каналов для кальция [21] и магния при физиологических концентрациях (Staruschenko, Sudarikova et al., 2006).

контроль отмывка 10 мМ CaCl2 2 мМ MgCl 145 мМ NaCl 145 мМ NaCl 1 пА 500 мс Рис. 2. Исследование проницаемости натриевых каналов для ионов кальция и магния. Записи токов в контрольном Na-содержащем растворе и при последовательных заменах наружного раствора;

эксперимент на изолированном фрагменте мембраны outside-out, поддерживаемый потенциал -40 мВ.

Проведенные эксперименты позволяют на уровне функциональных характеристик четко отделить исследуемые натриевые каналы в клетках К562 от обнаруженных ранее механочувствительных каналов. На рис. 3 показаны механоактивируемые токи, переносимые ионами Mg2+.

Суммируя полученные данные, можно сделать вывод о том, что, в отличие от механочувствительных каналов и ряда каналов семейства DEG/ENaC, натриевые каналы в клетках К562 непроницаемы для двухвалентных катионов, причем как при физиологических (1–2 мМ), так и при более высоких концентрациях в растворе с наружной стороны мембраны (10–20 мМ). Судя по таким биофизическим характеристикам, как проводимость, селективность, кинетические свойства, обнаруженные каналы близки к каналам ENaC. Возникает вопрос относительно идентификации этих каналов на молекулярном уровне.

Рис. 3. Механочувствительные каналы в клетках К А 145 мМ NaCl проводят двухвалентные -50 мВ катионы. Активация каналов при механической стимуляции в экспериментах на нативных клетках (cell-attached) (А) в Б 20 мМ MgCl2 контрольных условиях (145 мМ в пипетке), (Б) в -50 мВ NaCl присутствии магния как 1 пА единственного проникающего 1с катиона с наружной стороны мембраны (20 мМ Mg в пипетке).

Исследование экспрессии -, -hENaC в клетках К562. Экспрессию -, hENaC в клетках К562 оценивали методом ОТ-ПЦР с праймерами, специфичными к генам SCNN1A ( -субъединица hENaC), SCNN1B ( -субъединица hENaC), Размеры продуктов амплификации SCNN1G ( -субъединица hENaC).

соответствовали расчетным (рис. 4А), а также размерам, полученным на используемых в качестве положительного контроля клетках линии НЕК293-Т, трансфицированных плазмидами, кодирующими три субъединицы hENaC (рис.

4Б).

Б А Рис. 4. Экспрессия -, -, -субъединиц hENaC в клетках К562.

Электрофореграммы продуктов ПЦР, полученных на кДНК клеток К562(А) и HEK293-T (Б) с праймерами, специфичными к субъединицам ENaC. Дорожки: 1 – ENaC (376 п.н.);

2 – ENaC (392 п.н.);

3 – ENaC (367 п.н.);

М – маркер длин фрагментов ДНК (O’Gene Ruler, Fermentas, USA).

Как показывают результаты ОТ-ПЦР анализа, в клетках К562 присутствуют -, -, -субъединицы эпителиального натриевого канала ENaC (рис. 4). Согласно современным представлениям, для формирования функционально активного канала ENaC в клеточной мембране необходимо наличие всех трех субъединиц [8].

Эти данные позволяют ставить вопрос о принадлежности исследуемых натриевых каналов к семейству ENaC.

Оценка чувствительности натриевых каналов к амилориду. Поскольку ОТ-ПЦР-анализ показал, что в клетках К562 экспрессируются три субъединицы ENaC, с помощью метода патч-кламп проверили действие диуретика амилорида на натриевые токи. Ингибирование ионных токов и каналов амилоридом (в субмикромолярных концентрациях) или его производными традиционно рассматривается как главный критерий, доказывающий их принадлежность к семейству ENaC. Для ответа на вопрос о том, присутствует ли амилорид чувствительная компонента в составе интегральных токов в клетках K562, провели эксперименты в варианте регистрации токов от всей мембраны клетки (конфигурации whole-cell). Так как известно, что исследуемые натриевые каналы активируются при разборке актинового цитоскелета [4, 6], в части опытов для повышения суммарной активности каналов и амплитуды токов использовали цитохалазин Д (ЦитД). Обнаружили, что добавление амилорида в камеру в концентрациях 0.01 или 0.1 мМ не приводило к существенному изменению тока.

Таким образом, на уровне интегральных токов мы не выявили компоненты, которая могла бы отражать активность амилорид-чувствительных натриевых каналов (ENaC) в клетках К562.

В следующих сериях экспериментов мы исследовали влияние амилорида на работу одиночных каналов как в экспериментах на мембранных фрагментах (конфигурация outside-out), так и при отведении от «целой клетки» (конфигурация whole-cell). Как известно, в режиме whole-cell мы регистрируем токи, отражающие активность каналов в мембране всей клетки. При достижении высокоомного контакта (10 ГОм и более) измерительной пипетки и поверхности мембраны в части экспериментов удалось измерить токи через одиночные каналы (рис. 5).

Регистрировали активность одиночных каналов до и после аппликации амилорида (0.1 мМ) к внешней поверхности мембраны. Наблюдали, по крайней мере, устойчивых уровня, соответствующих функционированию 4 каналов. Амилорид в концентрациях 0.01 или 0.1 мМ не оказывал действия на амплитуду и кинетику открываний и (или) закрываний каналов. Отсутствие ингибирующего действия амилорида на натриевые токи было также показано в экспериментах на изолированных фрагментах мембран (конфигурация outside-out), что согласуется с предшествующими результатами исследований в лаборатории [4]. Биофизические свойства натриевых каналов после обработки амилоридом (outside-out) были близки к таковым в контроле, а также к полученным в опытах whole-cell:

проводимость составляла 12–13 пСм. Важно отметить, что, как видно из записей токов в экспериментах whole-cell, выявляются только натриевые каналы, не обладающие чувствительностью к амилориду (рис. 5).

контрольный раствор Рис. 5. Амилорид-нечувстви -30 мВ тельные натриевые каналы в клетках К562. Регистрация токов в эксперименте от «целой» клетки (whole-cell) при + 0.1 мМ амилорид потенциале -30 мВ в контроле, -30 мВ после подачи амилорида и соответствующие вольт 1 пА амперные характеристики.

1с I, пА 0, Е, мВ -40 -20 20 контроль 12.7 пСМ -0,4 амилорид -0, Методом ОТ-ПЦР мы установили, что в клетках линии К562 экспрессируются -, -, -субъединицы ENaC (рис. 5). В то же время в электрофизиологических экспериментах мы не наблюдали типичных каналов ENaC, характерным признаком которых является блокирование амилоридом в микромолярных концентрациях. В связи с этим, имеющиеся данные позволяют заключить, что в клетках линии К экспрессируется амилорид-нечувствительный канал семейства ENaC.

Идентификация натриевых каналов в клетках U937;

связь с динамикой актина. С использованием апробированных экспериментальных подходов исследовали активность натриевых каналов в клетках лимфомы U937, имеющих свойства премоноцитов. В опытах на изолированных фрагментах мембран (конфигурация inside-out) была обнаружена активация натриевых каналов при действии ЦитД, деструктора актиновых филаментов. Типичный эффект ЦитД иллюстрирует рис. 6.

Мы проверили влияние глобулярного (G) актина на активность натриевых каналов, вызванную разрушением F-актина в клетках U937. Как показано на рис. 6, активность натриевых каналов ингибируется через 2–3 мин после добавления G актина в раствор (140 мМ KCl, 1мМ MgCl2).

до подачи ЦитД -20 мВ I, пА через 2 мин после ЦитД 0, -20 мВ 0, E, мВ -30 мВ -60 -40 -20 20 40 -0, -40 мВ 10.8 пСм -0, после G-актина -0, -40 мВ 1 пА 500 мс Рис. 6. Активация и инактивация натриевых каналов в эксперименте inside-out на клетках U937. Регистрация токов в контроле;

после подачи ЦитД при различных значениях мембранного потенциала;

после добавления G-актина (300 мкг/мл) в раствор с цитоплазматической стороны мембранного фрагмента;

вольт-амперная характеристика;

проводимость 10.8 пСм.

Можно заключить, что инактивация каналов обусловлена полимеризацией актина на цитоплазматической стороне мембраны;

аналогичные эффекты наблюдали на клетках К562. Таким образом, активация и инактивация натриевых каналов в клетках U937, как и в клетках К562, коррелирует с разборкой и сборкой актинового цитоскелета.

Влияние амилорида, блокатора каналов ENaC, на интегральную проводимость плазматической мембраны клеток U937 исследовали путем регистрации токов от целой клетки (конфигурация whole-cell). На рис. 7 представлены записи интегральных токов в контрольном растворе до и после действия ЦитД (10 мкг/мл) и затем после аппликации амилорида (0.01 мМ, 0.1 мМ). Активацию тока наблюдали через несколько минут после подачи ЦитД в камеру. Обнаружено, что добавление амилорида в концентрациях 0.01 или 0.1 мМ не приводило к подавлению натриевого тока (рис. 7). Таким образом, проведенные эксперименты свидетельствуют об отсутствии амилорид-чувствительной компоненты интегральных токов в клетках U937.

I, пА Б I, пА А -80 -60 -40 -20 20 E, мВ - - - до ЦитД - ЦитД 0,01 мМ амилорид до ЦитД - 0.1 мМ амилорид - ЦитД отмывка амилорид NMDGCl - - Рис. 7. Тестирование действия амилорида (0.01 мМ, 0.1 мМ) в эксперименте whole-cell на клетках U937. (А) Регистрация интегрального тока в контрольном натриевом растворе (до ЦитД), после подачи ЦитД (10 мкг/мл), последующей аппликации амилорида (0.01 мМ, 0.1 мМ), обратной замены раствора на контрольный (отмывка) и после замены катионов на непроникающие NMDG+. (Б) Данные рис. А после вычитания тока утечки (NMDG+) демонстрируют отсутствие амилорид-чувствительной компоненты.

Кроме того, в опытах whole-cell, т.е. при регистрации токов от «целой клетки», удалось проверить действие амилорида на работу одиночных каналов. На рис. 8 представлены результаты типичного эксперимента;

активность каналов регистрировали через 2 мин после подачи ЦитД во внеклеточный раствор.

Установлено, что амилорид в концентрациях 0.01 или 0.1 мМ не оказывал влияния на активность натриевых каналов. Таким образом, как регистрация одиночных каналов (рис. 8), так и анализ интегральных токов (рис. 7) демонстрируют, что натриевые каналы в клетках U937 не ингибируются амилоридом. Следовательно, свойства натриевых каналов в клетках U937 близки к обнаруженным ранее в клетках К562.

Экспрессия hENaC в клетках U937 исследована нами методом ОТ-ПЦР с использованием праймеров для - субъединиц hENaC. На рис. -, -, представлены результаты ОТ-ПЦР-анализа, которые показывают, что в клетках U937 экспрессируются -, -, - субъединицы эпителиального натриевого канала ENaC.

На основании функциональных характеристик и данных ОТ-ПЦР можно сделать вывод, что натриевые каналы, идентифицированные в клетках U937, принадлежат к семейству ENaC, но не блокируются амилоридом.

0.1 мМ 0.01 мМ А контроль амилорид амилорид -20 мВ -30 мВ -40 мВ Б 1 пА число число число 200 500 мс событий событий событий 150 150 100 50 0 0 I, пА I, пА -1 0 I, пА -1 0 -1 Рис. 8. Амилорид не блокирует натриевые каналы в клетках U937. (А) Записи токов (whole-cell) через натриевые каналы, активированные ЦитД (контроль), и после подачи амилорида (0.01 и 0.1 мМ). (Б) Соответствующие амплитудные гистограммы, полученные для потенциала -40 мВ;

расстояние между пиками соответствует амплитуде одиночного открывания канала.

Рис. 9. Экспрессия -, -, -субъединиц hENaC в клетках U937.

Электрофореграммы продуктов ПЦР, полученных на кДНК клеток U937 с праймерами, специфичными к субъединицам ENaC. Дорожки: 1 – ENaC (376 п.н.).

2 – ENaC (392 п.н.). 3 – ENaC (367 п.н.). М – маркер длин фрагментов ДНК (O’Gene Ruler, Fermentas, USA).

Следующая часть работы посвящена анализу механизмов регуляции натриевых потенциал-независимых каналов, в частности, роли липидного окружения. Наши данные и результаты предшествующих работ показывают, что активность натриевых каналов в клетках К562 и U937 критически зависит от состояния актинового цитоскелета. Механизмы взаимосвязи каналов и цитоскелета остаются неясными. Есть предположения, что для связи кортикального актина и ионных каналов важное значение могут иметь богатые холестерином липидные микродомены (рафты). Для выяснения физиологических путей модуляции активности натриевых каналов мы исследовали влияние холестерина на ионные токи и актиновый цитоскелет.

Организация актинового цитоскелета в клетках с пониженным содержанием холестерина. С использованием флуоресцентной микроскопии оценили состояние и перестройки актинового цитоскелета в клетках К562 при экстракции холестерина, т.е. в условиях деструкции рафтов. Для частичной экстракции холестерина клетки инкубировали с метил-бета-циклодекстрином (MCD, 2.5 или 5 мМ, 37 °С, СО2) в среде RPMI, не содержащей сыворотки.

На рис. 10 показаны результаты флуоресцентного окрашивания F-актина в клетках К562 в норме и после снижения уровня мембранного холестерина. В контрольных препаратах при окрашивании родамин-фаллоидином наблюдали типичный для суспензионных клеток кортикальный актиновый слой в виде четкого кольца под мембраной. После обработки MCD в клетках К562 обнаружены изменения актиновых элементов цитоскелета, вероятно, отражающие развитие фибриллярной сети (Сударикова и др., 2006).

Об изменении состояния F-актина в клетках К562 с пониженным содержанием холестерина свидетельствуют также изменения механических свойств клетки, оцененные с помощью электрофизиологических подходов. В клетках К наблюдали активацию механочувствительных каналов при локальном растяжении (stretch) мембраны (Sudarikova et al., 2006). В опытах cell-attached исследовали свойства механочувствительных каналов в контроле и после инкубации клеток с MCD (рис. 11).

Рис. 10. Снижение уровня мембранного холестерина приводит к реорганизации F-актина в клетках К562. Визуализация F-актина (А) в контроле и (Б) после инкубации с MCD (5 мМ, 60 мин). Окраска родамин-фаллоидином ( мкМ). Об. 100 x. Справа – профили интенсивности (Pixel Intensity Profile).

В клетках с пониженным уровнем холестерина (обработка MCD) обнаружили повышение порога активации и снижение вероятности открытого состояния (Po) механочувствительных каналов;

проводимость одиночного канала оставалась без изменений (16 пСм) (Morachevskaya, Sudarikova, Negulyaev, 2007). Таким образом, частичная экстракция холестерина приводит к подавлению механозависимой активации каналов. Скорее всего, влияние экстракции холестерина связано с нарушением целостности рафтов и обусловлено участием внутриклеточных структур, в первую очередь актинового цитоскелета [22].

Таким образом, результаты исследований механочувствительных каналов в клетках К562 подтверждают, что снижение уровня холестерина приводит к перестройкам актиновой сети, возможно включающим сборку микрофиламентов.

А контроль -40 мВ M CD 1 пА 500 мс Число 600 Число Б событий событий 300 0 -1,2 -0,8 -0,4 0,0 0,4 -0,8 -0,4 0,0 0, I, пА I, пА 0,20 P В Г 1,2 I, пА o 0,8 0, 0, E, мВ 0, -60 -40 -20 20 40 -0, 0, -0,8 -M CD n=12 n= -Контроль -1,2 0, M CD Контроль Рис. 11. Частичная экстракция холестерина приводит к подавлению активности механочувствительных каналов (MCD, 2.5 мМ, 60 мин). (А) Записи токов при потенциале -40 мВ. Стрелками показаны подача и снятие механического стимула: 25 мм рт. ст. в контроле и 70 мм рт. ст. после инкубации клеток с метил-бета-циклодекстрином (MCD). (Б) Соответствующие амплитудные гистограммы. (В) Усредненные вольт-амперные характеристики.

(Г) Средние значения вероятности открытого состояния (Po) для потенциала 40мВ.

Активация и инактивация натриевых каналов в клетках с пониженным содержанием холестерина. В параллельных сериях опытов проведено сопоставление свойств натриевых каналов в клетках К562 в контрольных условиях и после инкубации с акцептором стеролов MCD. Тестировали также действие деструкторов F-актина цитохалазинов Б или Д (ЦитД или ЦитБ). На начальном этапе работы было обнаружено, что после длительной инкубации (12–24 ч) клеток в среде без сыворотки активация каналов в ответ на разборку F-актина отсутствовала. Поэтому эффекты цитохалазина исследовали в экспериментах на контрольных и модифицированных клетках в течение 3–4 ч, избегая более длительного нахождения клеток в бессывороточной среде. Результаты показывают, что снижение уровня мембранного холестерина не оказывает существенного влияния на характеристики натриевых каналов, как в случае спонтанной активности, так и после активации в ответ на разборку актинового цитоскелета (рис. 12). Во всех сериях экспериментов не было различий в действии ЦитБ или ЦитД. Биофизические характеристики натриевых каналов в модифицированных клетках близки к таковым в контроле и типичны для исследуемых каналов [4, 6].

Так, в опытах на модифицированных клетках средние значения проводимости одиночного канала составляли 12.1 ± 0.6 (cell-attached) и 11.1 ± 0.7 пСм (inside-out);

после действия цитохалазина (эксперименты inside-out) значение проводимости составляло 11.6 ± 0.1 пСм. Суммируя результаты, полученные на целых клетках и на мембранных фрагментах, можно сделать вывод, что при пониженном содержании холестерина в клетках К562 сохраняется цитоскелет-зависимый механизм активации натриевых каналов, несмотря на обнаруженные изменения актиновой сети (см. рис. 10). В опытах cell-attached развитие эффекта было несколько замедлено по сравнению с типичной кинетикой для нормальных клеток.

до подачи ЦитБ M CD А контроль -20 мВ через 3 мин после ЦитБ -20 мВ 1 пА 300 мс Б I, пА I, пА 0, 0, E, мВ E, мВ -40 -20 20 -40 -20 20 -0, -0, 11.3 пСм 11.6 пСм -0, -0, -0, -0, Рис. 12. Активация натриевых каналов при действии цитохалазина Б (ЦитБ, 10 мкг/мл) в контроле и в клетках с пониженным содержанием холестерина (обработка MCD). (А) Записи токов (inside-out) при потенциале – мВ до и через 3 мин после подачи ЦитБ в раствор с цитоплазматической стороны мембраны (Б) Вольт-амперные характеристики каналов, активируемых ЦитБ.

Далее мы исследовали влияние G-актина на активность натриевых каналов, вызванную действием цитохалазина в клетках с пониженным содержанием холестерина. При добавлении в экспериментальную камеру G-актина, который, как известно, полимеризуется при повышении ионной силы раствора, наблюдали снижение активности каналов и, соответственно, вероятности открытого состояния (Po) до нулевого значения (рис. 13).

Процесс инактивации, по-видимому обусловленный сборкой филаментов на цитоплазматической стороне мембраны, развивался в течение 5–6 мин. Как видно (рис. 14), G-актин ингибировал не только индуцированную цитохалазином, но также и спонтанную активность натриевых каналов в клетках К562 (Sudarikova et al., 2009).

0, Po контроль G-актин ЦД 0, 1 пА 0, Контр. ЦД G-актин 300 мс Рис. 13. Инактивация натриевых токов, индуцированных цитохалазином Д (ЦД), при добавлении G-актина. Эксперимент inside-out на клетках с пониженным содержанием холестерина. Регистрация токов до (контроль) и после подачи ЦД, затем после добавления G-актина (300 мкг/мл) в раствор с цитоплазматической стороны мембранного фрагмента;

поддерживаемый потенциал –30 мВ. Справа показаны соответствующие значения вероятности открытого состояния каналов (Po).

Po 0, контроль G-актин 0, 1 пА 0, 300 мс Контр. G-актин Рис. 14. Подавление спонтанной активности натриевых каналов в клетках, модифицированных MCD, при подаче G-актина. Записи токов в эксперименте inside-out при потенциале –30 мВ в контроле и после добавления G актина (300 мкг/мл) в растворе с цитоплазматической стороны мембранного фрагмента. Справа показаны соответствующие значения вероятности открытого состояния каналов (Po).

Таким образом, в модифицированных по липидному составу клетках наблюдается подавление активности натриевых каналов при полимеризации актина. В клетках К562 и U937 сборка филаментов на цитоплазматической стороне мембраны приводит к единообразному эффекту – инактивации натриевых каналов.

Обобщая результаты исследования регуляции натриевых каналов, можно заключить, что в клетках с пониженным содержанием холестерина сохраняется активация и инактивация, контролируемая разборкой и сборкой примембранного актина. Результаты позволяют полагать, что амилорид-нечувствительные натриевые каналы не ассоциированы с богатыми холестерином ENaC мембранными микродоменами.

ВЫВОДЫ В клетках миелоидной лейкемии человека К562 и лимфомы U 1.

экспрессируются -, -, -субъединицы hENaC.

Потенциал-независимые натриевые каналы непроницаемы для 2.

катионов Ca+2 и Mg+2, причем как при физиологических, так и при более высоких концентрациях.

Активация и инактивация натриевых каналов в клетках U937, как и в 3.

клетках К562, коррелирует с разборкой и сборкой актинового цитоскелета.

Натриевые каналы в клетках К562 и U937 не блокируются 4.

амилоридом, специфическим ингибитором эпителиальных натриевых каналов ENaC. Показано отсутствие амилорид-чувствительной компоненты, как на уровне одиночных каналов, так и на уровне интегрального натриевого тока.

Судя по функциональным характеристикам и результатам ОТ-ПЦР 5.

анализа, амилорид-нечувствительные натриевые каналы в плазматической мембране клеток К562 и U937 принадлежат к семейству ENaC.

В клетках с пониженным уровнем холестерина наблюдается 6.

реорганизация актиновой сети, однако сохраняется основной механизм регуляции натриевых каналов, сопряженный с динамикой примембранного актина.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ 1. Сударикова А.В., Сырникова С.С., Морачевская Е.А. 2004. Влияет ли уровень холестерола на активацию ионных каналов и состояние актинового цитоскелета в клетках К562? Цитология. 46 (10): 943.

2. Сударикова А.В., Негуляев Ю.А., Морачевская Е.А. 2005. Проницаемость механочувствительных каналов для ионов магния. Сб. материалов межвузовской научно-технической конференции «XXXIII неделя науки СПбГПУ», Санкт Петербург, 196–198.

3. Staruschenko A.V., Sudarikova A.V. (equal contribution), Negulyaev Y.A., Morachevskaya E.A. 2006. Magnesium permeation through mechanosensitive channels:

single-current measurements. Cell Research. 16: 723–730.

4. Sudarikova A.V., Negulyaev Y.A., Morachevskaya E.A. 2006. Cholesterol depletion affects mechanosensitive channel gating coupled with F-actin rearrangement.

Proceedings of the Physiological Society, London, 95P–96P.

5. Сударикова А.В., Морачевская Е.А., Негуляев Ю.А. 2006. Состояние кортикального актина в клетках К562 и U937 при частичной экстракции холестерина. Цитология. 48 (9): 803–804.

6. Сударикова А.В., Негуляев Ю.А., Морачевская Е.А. 2006. Роль липидного бислоя и кортикального цитоскелета в функционировании ионных каналов в клетках К562. Сб. «Биология – наука ХХI века», Пущино, 119–120.

7. Morachevskaya E.A., Sudarikova A.V., Negulyaev Y.A. 2007. Mechanosensitive channel activity and F-actin organization in cholesterol-depleted human leukaemia cells.

Cell Biol. Int. 31: 374–381.

8. Sudarikova A., Negulyaev Y.A., Morachevskaya E.A. 2009. Cholesterol depletion does not prevent actin-based activation of non-voltage-gated sodium channels. Abstracts of the Main meeting of the Physiological society, Dublin, 148–149.

9. Сударикова А.В., Чубинский-Надеждин В.И., Негуляев Ю.А., Морачевская Е.А. 2009. Функциональные свойства натриевых каналов в клетках К562 после экстракции холестерина. Цитология. 51 (8): 676–683.

10. Сударикова А.В. 2009. Роль холестерина в регуляции натриевых каналов и их связи с перестройками цитоскелета в клетках крови. 14-ая ассамблея молодых ученых и специалистов, Санкт-Петербург, 67–68.

11. Сударикова А.В. 2010. Молекулярная и функциональная организация потенциал-независимых натриевых каналов в клетках крови. 15-ая ассамблея молодых ученых и специалистов, Санкт-Петербург, 101.

СПИСОК ЦИТИРУЕМОЙ ЛИТЕРАТУРЫ 1. Van Renterghem C., Lazdunski M. 1991. Pflgers Arch. 419: 401–408. 2. Negulyaev Yu.A., Vedernikova E.A. 1994. J. Membr. Biol. 138: 37–45. 3. Negulyaev Y.A. et al. 1994.

Biochim. Biophys. Acta. 1194: 171–175. 4. Ведерникова Е.А. и др. 1997. Цитология.

39: 1142–1151. 5. Negulyaev Y.A. et al. 1996. Mol. Biol. Cell. 7: 1857–1864. 6.

Negulyaev Y.A. et al. 2000. J. Biol. Chem. 275: 40933–40937. 7. Shumilina E.V. et al.

2003. Mol. Biol. Cell. 14: 1709–1716. 8. Kellenberger S., Schild L. 2002. Physiol. Rev.

82: 735–767. 9. Folkesson H.G. 2008. Am. J. Physiol. 294: 399–400. 10. O’Brodovich H.

et al. 2008. Am. J. Physiol. 294: 401–408. 11. Levitan I. et al. 2010. Subcell. Biochem.

51: 509–549. 12. Hanwell D. et al, 2002. J. Biol. Chem. 277: 9772–9779. 13. Hill W.G.

et al. 2002. J. Biol. Chem. 277: 33541–33544. 14. Hill W.G. et al. 2007. J. Biol. Chem.

282 (52): 37402–37411. 15. Shlyonsky V.G. et al. 2003. Am. J. Physiol. 284: 182–188.

16. Krueger B. et al. 2009. Cell. Physiol. Biochem. 24: 605-618. 17. Spudich J.A., Watt S. 1971. J. Biol. Chem. 246: 4866–4871. 18. Chomczynski P., Sacchi N. 1987. Anal.

Biochem. 162: 156-159. 19. Gamper N. et al., 2000. Pflgers Arch. 441: 281–286. 20.

Bianchi L. et al. 2004. Nat Neurosci. 7: 1337–1344. 21. Staruschenko A.V. et al. 2002. J.

Physiol. 541: 81–90. 22. Chubinskiy-Nadezhdin V.I. et al. 2011. Biochem. Biophys. Res.

Commun. 412: 80–85.



 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.