авторефераты диссертаций БЕСПЛАТНАЯ  БИБЛИОТЕКА

АВТОРЕФЕРАТЫ КАНДИДАТСКИХ, ДОКТОРСКИХ ДИССЕРТАЦИЙ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Pages:   || 2 |

Механизмы плейотропного действия гена small bristles (dm nxf1) drosophila melanogaster, принадлежащего эволюционно консервативному семейству nxf (nuclear export factor)

-- [ Страница 1 ] --
САНКТ-ПЕТЕРБУРГСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ

На правах рукописи

МАМОН Людмила Андреевна

Механизмы плейотропного действия гена

small bristles (Dm nxf1) Drosophila melanogaster,

принадлежащего эволюционно консервативному семейству

nxf (nuclear export factor)

Специальности

03.02.07 – генетика и

03.03.04 – клеточная биология, цитология, гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора биологических наук

Санкт-Петербург 2010 2

Работа выполнена в Санкт-Петербургском государственном университете на кафедре генетики и селекции и в Институте биофизики клетки, г. Пущино.

Научные консультанты: академик доктор биологических наук Сергей Георгиевич Инге-Вечтомов Санкт-Петербургский государственный университет профессор, доктор биологических наук Михаил Борисович Евгеньев Институт молекулярной биологии им. В.А.Энгельгардта, г. Москва

Официальные оппоненты: доктор биологических наук Константин Васильевич Квитко, профессор каф. микробиологии Санкт-Петербургского государственного университета доктор биологических наук Александр Викентьевич Родионов, заведующий лабораторией Ботанического института РАН, Санкт-Петербург доктор биологических наук Татьяна Владимировна Кузнецова, ведущий научный сотрудник Института акушерства и гинекологии им. Д.О.Отта, Санкт-Петербург Ведущее учреждение: Институт цитологии РАН, Санкт-Петербург

Защита состоится в на заседании совета Д 212.232.12 по защите докторских и кандидатских диссертаций при Санкт Петербургском государственном университете по адресу: 199034, Санкт Петербург, Университетская наб., 7/9. Санкт-Петербургский государственный университет, кафедра генетики и селекции, ауд. 1.

С диссертацией можно ознакомиться в научной библиотеке им. М.Горького Санкт-Петербургского государственного университета

Автореферат разослан И.о. ученого секретаря диссертационного совета д.б.н. М.В.Падкина Введение Актуальность проблемы. Гены, обеспечивающие сохранение, передачу и реализацию наследственной информации характеризуются широким спектром плейотропных эффектов. Именно такие гены обеспечивают системный контроль генетических процессов в клетке и относятся к эволюционно древним, проявляя удивительный консерватизм. Достижения геномики делают особенно актуальным изучение структуры и функции подобных генов, используя преимущества модельных объектов.

Гены семейства nxf, описанные у большинства эукариот от дрожжей до человека, вовлечены в контроль экспорта различных мРНК из ядра в цитоплазму (Herold et al., 2003). У D.melanogaster ортологом генов nxf1 является ген sbr (Herold et al., 2000;

Третьякова и др, 2001;

Wilkie et al., 2001), поэтому ген sbr получил еще одно название – Dm nxf1. Универсальной функцией гена Dm nxf1 и его ортологов у человека (Hs nxf1) и мыши (Mm nxf1) является транспорт мРНК из ядра в цитоплазму (Kang and Cullen, 1999;

Herold et al., 2003;

Sasaki et al., 2005).

Исходя из универсальной функции, продукты генов nxf1 относят к транспортным рецепторам, состоящим, по крайней мере, из двух частей. Первая – рецепторная - определяет взаимодействие с РНК (взаимодействие может быть специфичным – это узнавание последовательности СТЕ (constitutive transport element), и не специфичным – через адапторные молекулы) (Hautbergue et al., 2008). Вторая – транспортная – обеспечивает взаимодействие с нуклеопоринами – белками ядерных поровых комплексов с тем, чтобы переместить комплекс, содержащий мРНК, из ядра в цитоплазму (Braun et al., 2001, 2002). Затем, как правило, фактор NXF1 покидает транспортируемый комплекс и возвращается обратно в ядро (Palacios, 2002). Важно отметить, что не все мРНК приступают к трансляции сразу после выхода из ядра в цитоплазму. С существованием долгоживущих и временно не транслируемых мРНК связывают возникновение семейства генов nxf и появление генов-паралогов, контролирующих судьбу мРНК в цитоплазме (Jun et al., 2001;

Tretyakova et al., 2005;

Lai et al., 2006;

Takano et al., 2007;

Katahira et al., 2008). Специализация факторов NXF как рецепторов мРНК может проявляться не только в существовании семейства генов nxf, но и в том, что генам nxf, соответствует, как правило, несколько продуктов.

Исследования на мутантах показали, что под контролем гена Dm nxf1 (sbr) находятся два фундаментальных клеточных процесса: реакция клетки на действие теплового стрессора (Евгеньев, Левин, 1980;

Евгеньев, Денисенко, 1990) и расхождение хромосом в процессе клеточных делений (Мамон и др., 1990;

Никитина и др., 2003;

Кьергаард, Мамон, 2007;

Golubkova et al., 2006;

2009).

Существование сложных межаллельных взаимодействий и доминантных аллеле-специфичных признаков позволило высказать предположение о том, что гену Dm nxf1, помимо известной универсальной функции – обеспечения ядерно цитоплазматического транспорта мРНК, свойственны и специализированные функции, одна из которых – контроль расхождения хромосом в клеточных делениях. Основой широкого спектра плейотропных эффектов может быть полиморфизм продуктов гена, обеспечивающий их специализацию.

С усложнением организации живых систем часто возникают потребности в специализации универсальных функций. Эволюция генов в основном идет по пути объединения и возникновения новых комбинаций элементарных функций (Long et al., 2003). Объединение элементарных функций при формировании гена порождает ситуацию, при которой отдельные мутации могут нарушать конкретную элементарную функцию, не затрагивая остальные (Dudley et al., 2005;

van de Peppel, Holstege, 2005). В этом случае плейотропные эффекты гена отражают его полифункциональность и могут проявляться как аллеле специфичные.

Настоящая работа направлена на определение путей формирования специализированных функций гена Dm nxf1 у D.melanogaster, нарушение которых приводит к плейотропным эффектам. Вследствие эволюционной консервативности семейства генов nxf, выявленные с использованием модельного объекта закономерности имеют общебиологическое значение.

Цель работы заключается в определении молекулярных механизмов плейотропного действия эволюционно консервативного гена Dm nxf1 (sbr) D.melanogaster, вовлеченного в контроль важнейших клеточных процессов:

реакции клетки на действие стрессора, ядерно-цитоплазматического транспорта мРНК и расхождения хромосом в клеточных делениях.

Задачи:

1. Определить плейотропные эффекты гена Dm nxf1 (sbr) D.melanogaster и исследовать их механизмы.

2. Оценить характер взаимоотношений между нарушением реакции клетки на действие стрессора и хромосомной нестабильностью.

3. Исследовать механизмы хромосомной нестабильности у мутантов по гену Dm nxf1 (sbr) D.melanogaster, отвечающему за экспорт различных мРНК из ядра в цитоплазму.

Научная новизна. Впервые показано, что мутации эволюционно консервативного гена Dm nxf1 (sbr) у Drosophila melanogaster нарушают расхождение хромосом в клеточных делениях и вызывают характерные изменения веретена первого деления мейоза у самок. Данные эффекты можно рассматривать как проявление специализированной функции исследуемого гена наряду с другими аллеле-специфичными эффектами.

Выявлен полиморфизм мРНК Dm nxf1. Большинство специфичных транскриптов гена Dm nxf1 D.melanogaster выявлено впервые.

Использование полученных нами антител к С-терминальному фрагменту белка Dm NXF1 позволило методом Вестерн-блот анализа впервые идентифицировать специфичный для семенников короткий белковый продукт гена Dm nxf1 наряду с универсальной его формой. Существование полиморфизма продуктов гена Dm nxf1 свидетельствует о возможных путях специализации факторов NXF в пределах данного семейства белков.

Секвенированы участки ДНК, соответствующие рецессивным летальным аллелям гена sbr (Dm nxf1), и показана роль нарушений С-терминальной половины белка Dm NXF1 в определении плейотропных доминантных эффектов этих аллелей.

Теоретическое и практическое значение работы.

Эволюционная консервативность структуры и функции белков семейства NXF делает результаты исследований важными для понимания роли данных белков не только у D.melanogaster, но и у других организмов, включая человека.

Доминантные проявления мутантных аллелей гена Dm nxf1 (нарушение расхождения хромосом в клеточных делениях, мужская стерильность и нарушение сексуального поведения) позволяют рассматривать гены семейства nxf в качестве генов-кандидатов при определении генетических основ соответствующих наследственных патологий у человека.

Интерес к генам, вовлеченным в контроль расхождения хромосом в клеточных делениях, определяется, прежде всего, тем, что с нарушением числа хромосом связано подавляющее большинство раковых заболеваний у человека (Hartwell, Kastan, 1994;

Lengauer et al., 1998;

Cahill et al., 1999;

Sen, 2000;

Nowak et al., 2002;

Atkin, 2003). И если раньше полагали, что анеуплоидия является следствием злокачественного перерождения клетки, то в настоящий момент появляется все больше данных, свидетельствующих о том, что анеуплоидия может быть причиной рака (Marx, 2001;

Atkin, 2003;

Копнин, 2007).

Выявление механизмов плейотропного действия генов, основанных на аллеле-специфичных проявлениях, позволяет определять структурно функциональные элементы гена, что важно при создании рекомбинантных генетических конструкций в генной инженерии и разработке методов молекулярной диагностики наследственных патологий человека.

Основные положения, выносимые на защиту:

Жизненно важный эволюционно консервативный ген small bristles (sbr) D.melanogaster, относящийся к семейству генов nxf (Nuclear eXport Factor), отвечает не только за транспорт большинства типов мРНК из ядра в цитоплазму, но и вовлечен в регуляцию расхождения хромосом в клеточных делениях.

Продукт гена sbr (Dm nxf1) участвует в формировании аппарата деления клетки, влияя на поведение хромосом в мейозе и эмбриональных митозах. Полученные нами результаты позволяют отнести sbr к уже известным генам, выполняющим в клетке двойственную функцию: не только ядерно-цитоплазматический транспорт мРНК, но и транспорт хромосом к полюсам деления клетки. Появление в эволюции транспортных систем, выполняющих такую двойственную функцию, связано с возникновением ядерной оболочки и обособлением ядра в виде самостоятельного клеточного компартмента. Названные транспортные системы в процессе функционирования в клеточном цикле сменяют друг друга, используя общие структурно-функциональные модули.

Полиморфизм транскриптов и белковых продуктов, описанный для гена Dm nxf1, отражает характер эволюционной дивергенции и специализации транспортных рецепторов, принадлежащих семейству NXF и обеспечивающих перемещение в клетке различных мРНК.

На основе полученных данных сформулирована гипотеза о том, что продукты гена Dm nxf1 кроме универсальной функции – обеспечение ядерно цитоплазматического транспорта большинства мРНК из ядра в цитоплазму – выполняет и специализированные цитоплазматические функции, по-видимому, связанные с транспортом, сохранением в нетранслируемом состоянии особых мРНК или их деградацией. Присутствие подобных мРНК, относящихся к классу долгоживущих или локализованных, является характерной особенностью половых, эмбриональных нервных и стволовых клеток, а также необходимо при формировании аппарата деления клетки.

Данное предположение основывается на плейотропных эффектах мутантых аллелей гена Dm nxf1, таких как повышенная частота анеуплоидных потомков, аномалии веретена первого деления мейоза у самок, нарушение эмбриональных митозов, женская и мужская стерильность, нарушение памяти, временная атаксия.

Выполняя специализированные функции, фактор Dm NXF1 может входить в состав или участвовать в формировании макромолекулярных комплексов РНП, представляющих собой эволюционно древний способ хранения, передачи и реализации наследственной информации, не утративший своего значения в стволовых, нервных, генеративных и эмбриональных клетках.

Апробация работы: Материалы диссертации были представлены на следующих отечественных и международных конференциях и симпозиумах:

Всесоюзном симпозиуме «Структура и функции клеточного ядра» (Гродно, 1990);

Всесоюзном совещании «Генетика развития растений и животных» (Ташкент, 1990);

Всесоюзной конференции по генетике и цитологии мейоза (Новосибирск, 1990);

Всесоюзной конференции по генетике насекомых (Москва, 1991);

Международной конференции "Гипоксия в медицине" (Москва, 1996);

Международной конференции «Molecular chaperones and the heat shock response», Cold Spring Harbor Lab., (Нью Йорк, 1996);

37-й, 38-й, 39-й, 40-й, 41-й, 42-й, 43-й, 44-й, 45-й. 46-й Ежегодных конференциях по исследованиям на дрозофиле (Сан Диего, 1996;

Чикаго, 1997;

Вашингтон, 1998;

Белевью, 1999;

Питтсбург, 2000;

Вашингтон, 2001;

Сан Диего, 2002;

Чикаго, 2003;

2004;

Сан-Диего, 2005);

26-м Ежегодном совещании EEMS (Рим,1996);

15-й Европейской исследовательской конференции (Варна, Болгария, 1997);

Съездах ВОГиС (Санкт-Петербург, 2000;

Москва, 2004;

Москва, 2009);

17-й Европейской дрозофилиной конференции (Эдинбург, 2001);

Международной конференция «Генетика в России и мире»

(Москва,2006);

20-м Международном конгрессе по генетике (Берлин, 2008);

Международном научно-методическом семинаре «Современные методы микроскопии в исследовании живых систем» (Санкт-Петербург, 2008).

Публикации. По материалам диссертации опубликовано 56 печатных работ, из них 25 статей в реферируемых отечественных и зарубежных журналах, рекомендованных перечнем ВАК.

Структура и объем работы. Диссертация состоит из введения, обзора литературы, экспериментальной части, включающей материалы и методы, результаты и их обсуждение, заключения и выводов, а также списка цитированной литературы, насчитывающего 640 источников. Работа изложена на 310 страницах машинописного текста, включая приложение, иллюстрирована рисунками и 14 таблицами.

Содержание работы Материалы и методы исследования В работе использованы следующие линии и гибриды:

Линии, не содержащие мутантных аллелей гена sbr: не маркированные Кантон С, Орегон R, линия Т и маркированные: 1) waB, 2) y, 3) v, 4) ras v, + 5) Df(1)vL3/ In(1)FM6l, y31d sc8 dm B/Dp(1;

Y) v+y+, 6) y ct B, 7) y ct / Dp (1;

Y) y Линии, несущие мутантные аллели гена sbr:

1) l(1)ts403;

bw;

st, 2) ras l(1)ts403 v, 3) y cv l(1)ts403, 4) y cv sbr10 (l(1)ts403)/ + Dp (1;

Y) y, 5) ras sbr1, 6) Df(1)vL4, ras mD/FM6l,y31d sc8 dm B/Dp(1;

Y) v+ y+, 7) l(1)24/45A (sbr12) / FM6, y sc8 dm B, 8) l(1)K4 f car (sbr5) / FM6l, y sc8 dm B / Dp(1;

Y) v+y+ А также гибриды, несущие различные комбинации аллелей гена sbr и не содержащие мутантных аллелей гена sbr.

Название линий и обозначения мутаций даны в соответствии со справочником (Lindsley, Zimm, 1992).

Развитие особей всех линий и гибридов происходило при температуре 24,0±0,5°С.

Методы В работе были использованы следующие методы:

гибридологического анализа при определении частоты анеуплоидных потомков у самцов и самок-имаго, подвергнутых тепловому воздействию и облучению;

цитологические при анализе эмбриональных митозов у потомков самок и мейотических делений у самок D.melanogaster;

гистологического анализа семенников при определении причин стерильности самцов D.melanogaster;

Нозерн-блот гибридизации;

Вестерн-блот гибридизации;

ОТ-ПЦР;

секвенирования фрагментов ДНК;

клонирования фрагментов ДНК, трансформации бактериальных клеток, выделения и очистки белка при получении антител к фрагменту белка SBR (Dm NXF1).

Автор приносит благодарность всем тем, кто сделал возможным выполнение данной работы:

Коллекция мутантов гена sbr была предоставлена И.Ф.Жимулевым, в лаборатории которого были получены также геномные клоны гена sbr.

Геномные Р1 клоны получены от M.Ashburner (Великобритания).

Клон кДНК гена sbr получен от E.Izaurralde (Германия).

Большинство результатов с использованием молекулярных методов получено с участием И.В.Третьяковой, Г.Т.Лёзина и Н.А.Иванковой в Институте биофизики клетки (Пущино) и Э.О.Аванесян, Е.Г.Марковой, А.В.Маркова на базе фирмы Хеликс (Санкт-Петербург).

Антитела к С-терминальному фрагменту белка получены О.Маренковым (Институт биофизики клетки, Пущино).

Экспериментальные данные по мейозу у самок D.melanogaster получены Е.В.Голубковой в совместных исследованиях с S.Nokkala (Университет Турку.

Финляндия).

Автор приносит благодарность ученикам и коллегам, принимавшим участие в данной работе, что отражено в публикациях:

И.В.Третьяковой, Ю.А.Куцковой, А.В.Кьергаард (Комаровой), Е.В.Голубковой, Е.А.Никитиной, И.В.Чуркиной, Н.Н.Костроминой, О.М.Пугачевой, В.В.Касаткиной, А.А.Ацапкиной, А.С.Мусориной;

О.С.

Сотниковой, А.Н.Шершабовой, Е.П.Деминой, Л.В.Барабановой, О.Г.Зацепиной, Л.В.Бондаренко, Е.Л.Мазур.

Результаты и обсуждение Исследуя эффекты теплового воздействия (ТВ) (37 °С, 1 ч) на самок линии l(1)ts403 с нарушенным синтезом БТШ, мы показали, что частота анеуплоидных потомков при таком воздействии составляет 4,9-6,1 % (Табл.1) и превышает регистрируемую при действии рентгеновых лучей в дозе 9,3 Гр (Мамон и др., 1990;

1998). Таким образом, у особей линии l(1)ts403 при ТВ нарушенными оказываются два важнейших клеточных процесса: регуляция синтеза БТШ на посттранскрипционном уровне (Евгеньев, Денисенко, 1990) и расхождение половых хромосом в мейозе у самок D.melanogaster. Для понимания функции гена sbr важно было ответить на вопрос, связаны ли причинно-следственной связью эти проявления мутации l(1)ts403 (sbr10).

Поскольку синтез БТШ определяет формирование термотолерантности (Lindquist, 1986), мы оценили ее формирование по различным признакам.

Показали формирование термотолерантности по таким критериям, как выживаемость самок-имаго, повреждаемость яйцевых камер в овариолах, динамика яйцеоткладки. В то же время предварительное действие (35 °С, 1 ч) не снижает частоту нерасхождения и потерь половых хромосом в мейозе у самок при комбинированном воздействии (ТВ 35+37) по сравнению с ТВ (37 °С, 1 ч). Это заставило нас усомниться в том, что нарушение синтеза БТШ и нарушение расхождения хромосом при тепловом воздействии на самок линии l(1)ts связаны между собой причинно-следственной связью.

Влияние мутантного аллеля sbr10 (l(1)ts403) в компаунде с нулевым аллелем на фертильность самок Drosophila melanogaster в условиях пермиссивной температуры Для понимания функции гена sbr особый интерес представляли такие проявления мутантного аллеля l(1)ts403 (далее sbr10), которые можно выявить, не прибегая к тепловому воздействию. Среди них – влияние мутации sbr10 в условиях пермиссивной температуры 24,5 ± 0,5 С на репродуктивные функции самок. В наибольшей степени этот эффект проявляется, когда мутантный аллель sbr присутствует в одной дозе (Голубкова, 2004), т.е. на фоне делеции Df(1)vL4, удаляющей ген sbr (Жимулев и др., 1982). Далее в тексте делеция Df(1)vL4, являющаяся нулевым аллелем гена sbr, для краткости будет обозначена – 0.

Таблица 1. Частота (%) исключительных самок и самцов в потомстве из последовательных суточных яйцекладок самок Кантон С и l(1)ts403 при различных воздействиях (Мамон и др., 1998) Линия Сутки Вариант Число Частота (%) регулярных исключительных самок самок самцов Контроль 1268 0,1 0, ТВ (35оС, 1 ч) 840 0,1 0, ТВ (37оС, 1 ч) 319 5,6 5, ТВ (35оС, 1 ч) + (24,5оС, 1,5 ч) 338 5,2 7, +ТВ (37оС, 1 ч) Контроль 1437 0,1 0, ТВ (35оС, 1 ч) 1393 0,1 0, l(1)ts ТВ (37оС, 1 ч) 1005 4,9 6, ТВ (35оС, 1 ч) + (24,5оС, 1,5 ч) 805 4,8 5, +ТВ (37оС, 1 ч) 1-4 Контроль 4689 0,2 0, 1 ТВ (37оС, 1 ч) 611 0,7 0, Кантон С 2 513 0,4 0, 3 714 0,1 0, 4 821 0,1 0, Примечание: Выделены жирным шрифтом и подчеркнуты значения в вариантах опыта, отличающиеся статистически значимо от контрольных (Р0,05).

Доля неразвившихся яиц в потомстве самок sbr10/0 и 0/sbr10, полученных в результате реципрокных скрещиваний, статистически значимо превышает данный показатель для самок других исследуемых генотипов, составляя 72,9 и 82,8 %, соответственно (Табл.2). Причем основную долю составляют яйца без признаков развития или погибшие на ранних этапах эмбриогенеза. Самки генотипа sbr10/0 и 0/sbr10 отличаются от самок других исследуемых генотипов и по частоте появления личинок с нарушениями мальпигиевых сосудов, частота достигает 25%. Обычно аномальные личинки погибают на стадии первого возраста. В потомстве самок других исследуемых генотипов доля аномальных личинок не превышает 0,4% (Табл.2).

Самки генотипа sbr10/0 отличаются от самок других исследуемых генотипов крайне низкой плодовитостью – не более 3 потомков на одну самку за одни сутки. Плодовитость самок sbr10/sbr10 по сравнению с самками дикого типа снижена не более чем втрое и составляет около 10 потомков () на одну самку за одни сутки.

Поскольку плодовитость зависит от многих факторов, важно оценить вклад каждого из факторов в снижение плодовитости самок sbr10/0.

Таблица 2. Показатели, определяющие плодовитость самок различных генотипов:

продуктивность, гибель потомков на эмбриональной стадии и стадии личинки первого возраста (Голубкова и др., 2004) Линии и Общее Среднее Эмбриональ- Общее Частота гибриды число число яиц ная число аномаль отложенных на самку смертность, личинок ных яиц за сутки % личинок, % от общего числа личинок 5,7 ± 0,27 0,4 ± 0, +/+ 7520 40,1 (Canton S) + / sbr10 3,1 ± 0,36** 0,2 ± 0, 2292 50,8* sbr10 / + 6,5 ± 0,91 0,2 ± 0, 2187 49,8* sbr10 / L3 26,4 ± 0,78* 0.2 ± 0, 3234 47,9* L3 / sbr10 26,4 ± 0,64* 0,4 ± 0, 4679 50,5* 26,6 ± 0,70* 0,2 ± 0, +/0 3950 47,8* 29,2 ± 0,78* 0,4 ± 0, 0/+ 3404 45,8* 24,5 ± 1,03* 0,2 ± 0, + / L3 1741 47,1* 26,1 ± 0,95* 0,2 ± 0, L3 / + 2150 48,4* sbr10 / sbr10 14,7 ± 0,46* 0,4 ± 0, 5943 25,3** sbr10 / 0 72,9 ± 0,61 25,7 ± 3, 5309 25,0** *** * 0 / sbr10 82,8 ± 0,61 27,0 ± 1, 3755 29,9** *** * Примечание: При обозначении генотипов гибридных самок, полученных в результате реципрокных скрещиваний, на первом месте указывается генотип материнской линии, используемой при получении соответствующих гибридов.

* Отмечены значения, превышающие статистически значимо при Р 0,05 значения, полученные для самок + / +.

** Отмечены значения, которые являются статистически значимо при Р 0,05 ниже таковых, полученных для самок + / +.

*** Отмечены значения, превышающие статистически значимо при Р 0,05 значения, полученные для самок остальных исследуемых генотипов.

Самки генотипа sbr10/0 отличаются от самок других исследуемых генотипов крайне низкой плодовитостью – не более 3 потомков на одну самку за одни сутки. Плодовитость самок sbr10/sbr10 по сравнению с самками дикого типа снижена не более чем втрое и составляет около 10 потомков () на одну самку за одни сутки.

Поскольку плодовитость зависит от многих факторов, важно оценить вклад каждого из факторов в снижение плодовитости самок sbr10/0.

Хромосомная нестабильность при пермиссивной температуре, выявленная при анализе эмбриональных митозов у потомков самок, гемизиготных по мутации l(1)ts403 (sbr10) Для выяснения причин ранней эмбриональной смертности в потомстве самок sbr10/0, являющейся основной причиной снижения их плодовитости, анализировали яйца самок различных генотипов, собранные в течение не более трех часов после откладки (Голубкова, 2004;

Golubkova et al., 2006).

Среди нарушений раннего эмбрионального развития мы выделяли:

асинхронность ранних митозов (Рис. 1 В), нарушения деления ядер (Рис. 1 Г-Е), несоответствие морфологии эмбрионов их возрасту, определяемому по времени развития от момента откладки яйца (Табл. 3).

Таблица 3. Частота эмбрионов с различными нарушениями раннего эмбрионального развития (%) в зависимости от генотипа родительских самок (Golubkova et al., 2006) Частота различных нарушений (%) Число Генотип яиц Асинхрон- Нарушения Задержка Один родительских (эмбри- ность митотических развития пронуклеус самок онов) ранних делений митозов +/+ 156 0,6 0,6 1,3 sbr10/+ 205 1,0 2,4 3,9 0/+ 124 1,6 1,6 24,2 sbr10/sbr10 99 2,0 12,1# 8,1 0/sbr10 135 8,9* 14,1# 24,4 10,4* Примечание: отмечены статистически значимые различия при Р0,05 при сравнении: * самок 0/sbr10 и самок других исследуемых генотипов ;

# - самок sbr10/sbr10, 0/sbr10 и самок других исследуемых генотипов Характерной особенностью раннего эмриогенеза D.melanogaster является синхронность первых митотических делений дробления (Рис. 1 А,Б). В потомстве самок sbr10/0 частота эмбрионов с асинхронными делениями достигает 8,9 % (Табл.3), что статистически достоверно отличает самок sbr10/0 от самок других исследуемых генотипов. В норме синхронно делящиеся ядра ранних эмбрионов имеют одинаковые размеры и характеризуются определенным распределением в А Б В Г Д Е Рисунок 1. Эмбрионы Drosophila melanogaster в возрасте 1 -1,5 ч после откладки яйца (окраска DAPI). (Плоска - 10 µm) (Голубкова, 2004;

Golubkova et al., 2006) А,Б – Нормальные эмбрионы в потомстве самок +/+. Деления ядер синхронные, ядра распределены равномерно. В – Е – Эмбрионы с нарушениями делений в потомстве самок sbr10 / 0 ;

В –Ядра, имеют разные размеры, распределены неравномерно;

Г - Асинхронные деления ядер. Д,Е - «Митотические катастрофы» - скопления хромосом, окруженные пустым пространством.

эмбрионе, зависящим от стадии развития (Рис. 1 А,Б ). У эмбрионов с нарушениями делений ядер можно было встретить области, в центре которых находилось скопление множества хромосом, окруженное пустым пространством (Рис. 1 Д,Е). Такие нарушения образно называют «митотическими катастрофами»

(O’Dor et al., 2006). Эмбрионы с нарушениями делений ядер в потомстве самок гомо- и гемизиготных по sbr10 появляются с частотой 12,1 и 14,1 %, соответственно (Табл. 3).

Отличительной особенностью самок sbr10/0 является то, что только среди яиц, отложенных такими самками, с частотой 10,4 % встречаются яйца с одним пронуклеусом (Табл. 3). К сожалению, нам не удалось установить, является ли единственный пронуклеус мужским или женским.

Специфика раннего эмбриогенеза у D. melanogaster заключается в том, что первые 13 эмбриональных митозов происходят синхронно (Foe, Alberts, 1983;

Ji et al., 2004) и контролируются факторами, запасенными в оогенезе (Edgar et al., 1994). До 8 цикла делений зиготические гены почти не экспрессируются (Pritchard, Schubiger, 1996), а, следовательно, нет необходимости в ядерно цитоплазматическом экспорте мРНК. Полученные результаты позволили высказать предположение о том, что в контроль ранних эмбриональных митозов вовлечен материнский продукт гена sbr, запасенный в процессе оогенеза.

Регуляция экспрессии генов в раннем эмбриогенезе D.melanogaster происходит на уровне трансляции материнских мРНК, которые вначале трансляционно неактивны и могут быть активированы тогда, когда появляется потребность в соответствующем белке. Один из механизмов трансляционной активации в период раннего развития – цитоплазматическое полиаденилирование транскрипта (Groisman et al., 2002).

Нарушение синтеза белков теплового шока у мутантов l(1)ts403 (sbr10) – рецессивный признак, а повышенная частота анеуплоидных потомков – доминантный Частоты исключительных особей в потомстве гетерозиготных по мутации sbr самок (sbr10/+) имеют промежуточные значения по сравнению с подобными частотами в потомстве самок дикого типа и самок, гомозиготных по данной мутации. У гибридных самок генотипа sbr1 / sbr10 частоты нерасхождения и потерь половых хромосом не отличаются от соответствующих частот, показанных для самок генотипа + / sbr10. Это позволяет заключить, что по данному признаку мутация sbr10 проявляет неполное доминирование, а мутации sbr10 и sbr1 являются комплементарными.

Сравнение самок sbr10/+ с самками Df(1)vL4 / + (0/+) по частоте анеуплоидных потомков свидетельствует о том, что не недостаток нормального продукта гена sbr, а именно присутствие мутантного белка SBR10, влияет на расхождение половых хромосом в мейозе у самок, подвергавшихся тепловому воздействию. Можно предположить, что продукт мутантного аллеля sbr10 в результате тепловой модификации приобретает такие свойства, которые позволяют ему оказывать доминантное влияние на расхождение половых хромосом в мейозе у самок и последующих эмбриональных митозах в присутствии нормального продукта.

Рецессивный эффект мутации sbr10 в отношении синтеза БТШ при тепловом воздействии (Третьякова, 2000) и ее полудоминантный эффект в отношении расхождения хромосом указывают на то, что повышенная частота анеуплоидных потомков у самок sbr10, подвергнутых тепловому воздействию, не является следствием нарушения синтеза БТШ.

Повышенная частота анеуплоидных потомков с нарушенным числом и набором не только отцовских, но и материнских половых хромосом, у подвергавшихся тепловому воздействию самцов, несущих мутацию l(1)ts (sbr10) Для выяснения роли мутации l(1)ts403 (sbr10) в регуляции сегрегации хромосом в процессе клеточных делений исследовали нерасхождение и потери половых хромосом при тепловом воздействии (ТВ) (37 °С, 1 ч) на самцов D.melanogaster. Поскольку самцы-имаго, несущие мутацию sbr10, очень теплочувствительны и погибают при ТВ (37 °С, 1 ч) мы подвергали воздействию самцов в возрасте предкуколки или куколки (Комарова, 2002;

Кьергаард, Мамон, 2007). Максимально зрелые половые клетки у самцов на стадии предкуколки, как правило, вступают в мейоз. Разработанная нами схема скрещиваний позволяла по фенотипу потомков определять, какой набор половых хромосом получил исключительный потомок.

Повышение частоты всех классов исключительных особей в потомстве самцов sbr10 в основном приходится на период реализации спермиев, которые в период тепловой обработки находились на стадии мейоза. Так, при тепловой обработке куколок в возрасте 24, 48 и 72 ч частота исключительных особей была максимальной в потомстве, полученном от скрещивания в первые, вторые и третьи сутки, соответственно (Табл. 4).

Исходя из фенотипа исключительных потомков (фенотипические классы 1, 2, 6, 7, 8 и 9) можно заключить, что ТВ (37 °С, 1 ч) на мейоциты самцов, находившихся в момент воздействия на стадии куколки, приводит к нарушению сегрегации как отцовских, так и материнских половых хромосом.

Особенность данного объекта заключается в том, что к моменту оплодотворения в сперматоците дрозофилы мейоз уже завершен, а ооцит находится на стадии метафазы первого деления мейоза (Huettner, 1924;

Cooper, 1950). Проникновение спермия в яйцо индуцирует цепь цитологических событий, быстро сменяющих друг друга. Материнское ядро заканчивает мейоз и сближается с мужским пронуклеусом. Возможно, спермий привносит в зиготу какие-то факторы, способные повлиять на сегрегацию материнских хромосом после оплодотворения.

Известно, что при оплодотворении вместе со спермием в яйцеклетку попадают отцовские хромосомы, компоненты ядерной мембраны и центросома, а также ассоциированные с ними белки и растворимые белки цитоплазмы (Riparbelli M.G., Callaini, 1996;

Сallaini G., Riparbelli, 1996;

Palermo et al., 1994).

Показано, что у D.melanogaster в яйцеклетку проникает весь сперматозоид, включая хвост (Karr,1991;

Karr, Pitnick,1996). Полученные данные указывают на то, что факторы, влияющие на расхождение хромосом после оплодотворения, проявляют наибольшую теплочувствительность в период мейоза у самцов.

Таблица 4. Частота исключительных потомков, полученных от скрещивания интактных самок y ct B с самцами y cv sbr10 /Dp (1;

Y) y+, подвергнутыми тепловому воздействию (37 °С, 1 ч) на стадии куколки (Кьергаард, Мамон, 2007) Вариант Возраст Номер Число Частота исключительных потомков следующих фенотипов, % куколок суточ потом в момент ной ков 1 2 3 4 5 6 7 8 воздейст пере Самки Самцы Самки Самцы Самцы Самцы Самцы Самки Cамки вия, ч кидки ct B y cv +/В у ct B y ct B cv cv y ct B y cv стериль cтериль фертиль стериль фертиль ные ные ные ные ные Опыт 1 1182 0,4 0, 1,9* 1,0* 1,7* 1,9* 1,7* 1,6* 1,3* 24 2 1240 0,2 0, 1,6* 0,8* 1,5* 1,5* 1,6* 1,3* 1,3* 3 1341 0,5 0,2 0,2 0,1 0,6 0, 0,9* 0,9* 0,9* Опыт 1 1109 0,3 0,1 0,4 0,4 0,3 0,2 0,2 0,5 48 2 1245 0,3 0, 2,1* 1,9* 2,0* 1,8* 1,0* 2,2* 1,6* 3 1324 0,6 0,2 0, 1,5* 1,4* 1,0* 1,2* 1,3* 1,3* Опыт 1 1290 0 0 0,2 0,2 0,4 0,2 0,5 0,4 0, 60 2 1280 0,1 0,1 0,2 0,1 0,1 0,3 0,5 0, 0,9* 3 1387 0,4 0, 1,2* 0,9* 1,6* 1,4* 1,0* 2,2* 2,2* Конт- 1 1233 0 0 0,1 0,1 0,5 0 0 0 роль 2 1369 0 0 0,1 0,2 0,3 0 0 0 3 1407 0 0,1 0 0,1 0,4 0 0 0 Примечание: * - статистически значимые отличия данных в опыте от соответствующих данных в контроле при уровне значимости Р0,05.

Возможные причины возникновения исключительных особей:

1 – нерасхождеие материнских Х-хромосом;

2 – потеря материнских половых хромосом;

3 – нерасхождение отцовских Х и Y-хромосом или транслокация участка, маркированного y+, на отцовскую Х-хромосому ;

4 – потеря отцовских половых хромосом;

5 – утрата маркера Y хромосомы;

6 – потеря материнских Х-хромосом и транслокация участка, маркированного y+, на отцовскую Х-хромосому;

7 – нерасхождение отцовских Х и Y-хромосом и потеря материнских половых хромосом;

8 – нерасхождение материнских Х-хромосом и потеря отцовской половой хромосомы или нерасхождение материнских Х-хромосом и утрата участка Y-хромосомы, маркированного у+;

9 – нерасхождение отцовских Х-хромосом и потеря материнской Х-хромосомы.

Более высокая частота появления исключительных особей в потомстве подвергнутых ТВ (37 °С, 1 ч) самцов, несущих мутацию sbr10, позволяет предположить, что этот фактор, попадающий в яйцеклетку вместе со спермием и способный повлиять на расхождение хромосом после оплодотворения, может быть продуктом гена sbr, взаимодействовать с ним или формироваться при его участии. Поскольку мы наблюдали эффект только в том случае, когда действовали на мейоциты самцов, и не наблюдали эффекта при действии на постмейотические половые клетки, первые два предположения кажутся менее вероятными, поскольку не объясняют, почему при действии на более поздние стадии сперматогенеза эффект отсутствует.

Известно, что веретено первого митоза дробления у D.melanogaster формируется из материала ооцита с участием отцовской центросомы, в то время как ооцит своей центросомы не содержит (Schatten, 1994;

Riparbelli., Callaini, 1996;

Сallaini., Riparbelli, 1996). Это позволяет предположить, что с центросомой в ооцит могут попадать факторы, способные повлиять на поведение хромосом в период деления. Наиболее подходящими на роль таких факторов являются мРНК, поскольку небольшое количество этих молекул за счет трансляции может обеспечить построение аппарата расхождения хромосом и необходимый контроль периодичности его функционирования. Это особенно важно в первые часы эмбрионального развития D.melanogaster, которые протекают в отсутствие транскрипционной активности зиготического генома (Edgar, Schubiger, 1986).

Гибридологический анализ позволяет увидеть последствия нарушений поведения хромосом в клеточных делениях, но не дает возможности увидеть те нарушения, которые приводят к появлению анеуплоидных потомков, поэтому нами был проведен цитологический анализ мейоза у самок, несущих мутантные аллели гена sbr, молекулярная природа которых была известна к этому моменту.

Доминантные проявления мутантных аллелей гена Dm nxf1 (sbr) Высокая частота трехполюсных веретен деления в мейозе у самок sbr5/+ Цитологический анализ мейоцитов показал, что самки sbr10, sbr5/sbr10, +/sbr5 и в особенности самки sbr10/0, характеризуются высокой частотой нарушений первого деления мейоза (Табл.5). При этом основными нарушениями являются изменения морфологии веретена (сужение, искривление), изменения числа хромосом и их положения на веретене (Рис. 2Б;

). Самая высокая частота нарушений мейоза наблюдается у самок 0/ sbr10. Она достигает 73% (Табл. 5).

Самки sbr5/sbr10 имеют более низкую частоту нарушений мейоза, составляющую 38,5 %, а частота нарушений мейоза у самок, гомозиготных по мутации sbr10/sbr10, составляет 17,9 % (Табл. 5). Интересно отметить, что самки + / sbr5 имеют высокую частоту аномалий первого мейотического деления – 43,4 %, а самки + / sbr10 - на порядок более низкую - 4,5 %.

Для самок, несущих аллель sbr10 и при этом не несущих аллеля дикого типа, наиболее характерными являются нарушения индивидуализации бивалентов на метафазной пластинке (Рис. 2Б и В). Очень часто хромосомные биваленты вообще не разделяются, представляя собой единую массу хроматина (Рис. 2В). У самок sbr5 /+ доля таких нарушений составляет только 7 % и значительную долю Таблица 5. Частота нарушений первого деления мейоза у самок Drosophila melanogaster, несущих различные комбинации аллелей гена sbr (Golubkova et al., 2009).

Генотип самок Частота Объем выборки аномальных (число делений проанализированных первого делений) деления мейоза (%) +/+ 1,7±1,2 0/+ 3,2±1,8 +/sbr10 4,5±2,2 sbr10/sbr10 17,9±3,6* 0/sbr10 73,3±4,3*#^ sbr5/sbr10 38,5±5,1*# +/sbr5 43,4±5,0* Примечание: Отмечены статистически значимые различия при Р0,05:

* - между самками генотипа +/+ и самками других исследованных генотипов;

# - между самками генотипа 0/sbr10 и генотипа sbr5/sbr10;

^ - между самками генотипа 0/sbr10 и самками других исследованных генотипов;

- между самками sbr10/sbr10 и самками других исследованных генотипов нарушений (около 30 %) составляют трехполюсные деления (Рис. 3, Рис.2Г). У самок, несущих аллель sbr10, трехполюсные деления не выявлены (Рис. 3).

Поскольку частота нарушений мейоза у самок sbr5 /sbr10 значительно ниже, чем у самок 0/ sbr10, можно заключить, что аллель sbr5 не является нулевым. Более того, аллель sbr5 характеризуется доминантным проявлением на фоне аллеля sbr+ – образованием трехполюсных веретен деления (Рис. 2Г), что указывает на наличие мутантного продукта SBR5, оказывающего доминантно-негативный эффект.

У самок sbr10/0 встречаются деления с редуцированным числом бивалентов (Рис.2Б). Редукция числа бивалентов могла произойти в результате потери хромосом в предшествующих митозах. К потерям хромосом может приводить и преждевременное разделение хроматид в первом делении мейоза (Рис. 2Д).

А Б В Г Е Д Рисунок 2. Первое деление мейоза у самок Drosophila melanogaster (Golubkova et al., 2009).

А) Нормальная метафаза первого мейотического деления у самки +/+ (Полоска, 5 µm).

Б, В) Аномальные метафазы первого мейотического деления у самки sbr10/0 (Б - узкое веретено, уменьшено число бивалентов, В - веретено искривлено, нарушена индивидуализация бивалентов).

Г) Трехполюсная анафаза первого мейотического деления у самки +/sbr5.

Д) Преждевременное разделение хроматид Х-хромосомы с отставанием одной хроматиды в первом делении мейоза у самки sbr10/0.

Е) Нерасхождение половых хромосом (обе X-хромосомы отходят к одному полюсу) в первом делении мейоза у самки sbr10/0.

Примечание: нарушения первого мейотического деления проявляются в изменении морфологии веретена (Б-Г) и числа хромосом (Б), а также в нарушении расхождения хромосом (Д и Е).

+/sbr 0/sbr sbr 10 /sbr 10 sbr 5 /sbr 10 3% 1 2 5 0% 5 13% 1 30% 5% 0% 2% 2 4% 0% 16% 4 25% 4 20% 40% 33% 25% 3 20% 7% 3 3 50% 52% 55% 1 2 3 4 Рисунок 3. Доля различных типов нарушений первого деления мейоза у самок Drosophila melanogaster, имеющих статистически значимое превышение частоты отклонений от нормы, в зависимости от генотипа (Golubkova et al., 2009) Типы нарушений первого деления мейоза: 1 – трехполюсные деления;

2 - измененная форма веретена;

3 - нарушение индивидуализации бивалентов;

4 – потери и нерасхождения хромосом;

5 – прочие нарушения.

Примечание: - отмечены показатели, отличающиеся статистически значимо (при P 0,05), от показателей, полученных для самок остальных исследуемых генотипов.

указывает на наличие мутантного продукта SBR5, оказывающего доминантно негативный эффект.

У самок sbr10/0 встречаются деления с редуцированным числом бивалентов (Рис.2Б). Редукция числа бивалентов могла произойти в результате потери хромосом в предшествующих митозах. К потерям хромосом может приводить и преждевременное разделение хроматид в первом делении мейоза (Рис. 2Д).

Итак, обе исследованные мутации вызывали нарушения первого деления мейоза у самок, проявляя аллеле-специфичные эффекты. Для понимания функциональной значимости определенных частей продуктов гена sbr важны данные о природе мутантных аллелей.

Мы показали, что делеция sbr5 затрагивает С-терминальную часть белка SBR (Golubkova et al., 2009), т.е. участок, отвечающий у белков-ортологов за связь с нуклеопоринами (Bachi et al., 2000;

Izaurralde, 2001;

Grant et al., 2002). Делеция приводит к утрате части домена NTF2-like и гибкого линкера, связывающего домен NTF2-like с доменом UBA-like.

Учитывая высокую степень гомологии факторов NXF1 и отсутствие данных о белках-партнерах фактора Dm NXF1, можно обратиться к данным, известным для фактора NXF1 млекопитающих. Среди белков, взаимодействующих с фактором NXF1 и способных оказать влияние на формирование веретена деления, известны фактор Gle2/Rae1 (Bachi et al., 2000) и белки, взаимодействующие с микротрубочками MAP1A и MAP1B (microtubule associated protein) (Tretyakova et al., 2005). Причем за взаимодействие с белком Rae1, который вовлечен в контроль клеточных делений, ответственна именно С терминальная часть белка Hs NXF1 (TAP) (Bachi et.al., 2000;

Blevins et al., 2003).

Факторы, участвующие в формировании полюсов веретена, как возможные партнеры белка Dm NXF1 (SBR).

Характерной особенностью мейоза у самок многих организмов, в том числе и D.melanogaster, является то, что веретено мейотического деления формируется в отсутствии центросом и астральных МТ (Compton, 2000). Центрами нуклеации пучков микротрубочек, которые по мере их роста фокусируются на полюсах деления, являются хромосомы (McKim, Hawley, 1995). Короткие МТ отходят от хромосом еще до образования веретена первого деления мейоза у D.melanogaster (Hatsumi, Endow, 1992).

Процесс формирования анастрального веретена у D.melanogaster происходит в несколько этапов. Первый этап наступает после разрыва ядерной оболочки, когда МТ взаимодействуют с хромосомами (Theurkauf, Hawley, 1992;

Skld et al., 2005). Возможно, такое взаимодействие способствует индивидуализации бивалентов и превращению компактной массы хроматина кариосомы в дискретные биваленты, хорошо различимые на метафазной пластинке. МТ облепляют хромосомы и отталкивают биваленты друг от друга. На следующем этапе построения веретена деления очень большую роль играют процессы латерального взаимодействия МТ и их перемещения относительно друг друга (Skld et al., 2005). По мере удлинения МТ происходит их фокусирование на полюсах веретена, что способствует выравниванию бивалентов на экваторе метафазной пластинки (Theurkauf, Hawley, 1992;

Heald et al., 1996).

У мутантов по гену sbr нарушается, как процесс индивидуализации бивалентов хромосом на метафазной пластинке (Рис. 2В), так и их выравнивание в области экватора (Рис. 2Е). Кроме того, веретено первого деления мейоза у мутантных самок sbr10 (Рис. 2Б,В) часто выглядит более узким, чем у самок, имеющих хотя бы один аллель дикого типа (Рис. 2А). Поскольку описываемые нами аномалии первого деления мейоза связаны, прежде всего, с нарушениями веретена деления, важно понять, на каких этапах формирования веретена деления (захват МТ хромосомами, нуклеация МТ, рост и стабилизация концов МТ, а также образование поперечных сшивок между МТ и их фокусирование на полюсах веретена) требуется участие белка SBR. Нарушение индивидуализации бивалентов и их выравнивания на метафазной пластинке (Рис.2Б,Е;

3) у самок, несущих аллель sbr10, позволяет предположить, что белок SBR может иметь отношение к комплексам, взаимодействующим с плюс-концами МТ и участвующим в стабилизации МТ. Эти комплексы играют важную роль в поиске и захвате хромосом микротрубочками (Schuyler, Pellman, 2001;

Hayashi et al., 2005).

Высокая частота трехполюсных метафаз у самок sbr5/+ позволяет предположить, что белок SBR нужен и для формирования полюсов веретена.

Интересно, что образование трехполюсных веретен в мейозе I наблюдается только в том случае, когда мутантный белок SBR5 присутствует наряду с нормальным белком SBR, т.е. у самок +/sbr5.

На первый взгляд кажется парадоксальным отсутствие трехполюсных веретен в мейозе I у самок sbr5/ sbr10. Однако, если принять во внимание различия между самками sbr5/ sbr10 (55 %) и +/sbr5 (7 %) по признаку нарушение индивидуализации хромосом на метафазной пластинке (доля таких нарушений указана в скобках) можно предположить, что образование терхполюсных веретен деления происходит только в том случае, когда доля нарушений индивидуализации хромосом на метафазной пластинке не велика (около 7 %).

Фокусирование МТ на полюсах происходит в результате скольжения макромолекулярных комплексов в направлении минус-конца МТ, в результате такого скольжения происходит установление поперечных сшивок между МТ.

Данные о нарушениях организации хромосом на метафазной пластинке и веретена первого деления мейоза у самок D.melanogaster, несущих различные комбинации аллелей sbr, а также результаты, представленные ранее, свидетельствуют в пользу того, что участие фактора SBR в формировании аппарата деления клетки может представлять собой одну из специализированных функций данного фактора.

Доминатные эффекты аллеля sbr12 - стерильность и нарушение сексуального поведения самцов sbr12/ Dp(1;

Y)y+ v+ Доминатные эффекты характерны и для аллеля sbr12 (l(1)24/45A)– это нарушение фертильности и сексуального поведения самцов, несущих аллель sbr в гетерозиготном состоянии (Третьякова, 2000;

Касаткина, 2007). Данная мутация является летальной в гомо- и гемизиготе (Eeken et al., 1985). Однако на фоне нормального аллеля sbr+, транслоцированного в Y-хромосому, можно получить жизнеспособных самцов, хотя их жизнеспособность значительно снижена по сравнению с особями других генотипов - самцами-сибсами или самками сибсами.

Анализ нефиксированных препаратов содержимого семенника и семенных пузырьков показал, что у самцов, гетерозиготных по гену sbr12, как правило, отсутствуют подвижные сперматозоиды, а сперматозоиды самцов-сибсов FM6v, y v B/ Dp (1;

Y)y+ v+ подвижны.

Аллель sbr12 имеет делецию размером 30 нуклеотидов в экзоне 9 - del(13075 13104). При этом рамка считывания не нарушается. Таким образом, в предполагаемом белковом продукте мутантного аллеля sbr12, по сравнению с нормальным белком SBR, удалены 10 аминокислот TIFITNATHE с 526 по 535.

Первые 4 из 10 делетированных аминокислот относятся к домену NTF2-like, а остальные 6 аминокислот принадлежат участку, соединяющему домены NTF2-like и UBA-like.

Отличительной особенностью сперматогенеза многих животных, включая D.melanogaster, является то, что транскрипция генов идет не только в интерфазных диплоидных, но и в мейотических и даже гаплоидных клетках (Kleene, 2001, 2003). При этом существует множество различных мРНК, трансляция которых происходит не сразу после транскрипции. В течение нескольких суток транскрипты могут сохраняться в состоянии недоступном для трансляции. Активная трансляция таких транскриптов происходит в период спермиогенеза (Kleene, 1996, 2003;

Kotaja et al., 2006). Спермиогенез – это процесс превращения сперматид в зрелые сперматозоиды, характеризующийся формированием сложных морфологических структур, которые наделяют сперматозоид функциями одноклеточного организма, способного улавливать сигналы из окружающей среды и направленно перемещаться, конкурируя с другими сперматозоидами в активном поиске яйцеклетки. В период спермиогенеза активируется трансляция мРНК, находящихся в составе комплексов РНП, блокирующих трансляцию (Kleene, 2001, 2003;

Hawthorne et al., 2006;

Iguchi et al., 2006). Сохранение в неактивном состоянии важно и для таких мРНК, которые попадают в яйцеклетку вместе со сперматозоидом и могут иметь значение для оплодотворения, слияния пронуклеусов и эмбрионального развития (Ostermeier et al., 2004).

Возможно, в формировании комплексов РНП принимает участие и белок Dm NXF1. Полученные нами данные позволяют предполагать, что в процессе сперматогенеза белок Dm NXF1 участвует в формировании факторов, попадающих в яйцеклетку вместе со сперматозоидом и влияющих на расхождение как отцовских, так и материнских хромосом в период эмбриональных делений (Кьергаард, Мамон, 2007).

Самцы, несущие мутацию sbr12, имеют нарушения не только сперматогенеза, но и сексуального поведения – они не спариваются с девственными самками в течение первых 90 мин после их объединения. В то время как более 70 % самцов-сибсов FM6v, y v B/ Dp (1;

Y)y+ v+ спариваются с самками в течение первых 15 мин, а через 30 мин этот показатель для самцов без мутации sbr12 достигает 100 %.

Важно отметить, что белки, взаимодействующие с мРНК в цитоплазме и участвующие в регуляции их трансляции, нередко вовлекаются в контроль и поведения, и сперматогенеза (Chennathukuzhi et al., 2003;

Yang et al., 2004;

Zhang et al., 2004).

Мутация sbr12 нарушает жизненно-важные функции, оказывая рецессивный летальный эффект в геми- и гомозиготном состоянии, который компенсируется присутствием аллеля дикого типа. В то время как нарушения специализированных функций данного фактора, определяющих подвижность сперматозоидов и сексуальное поведения самцов, проявляются на фоне присутствия продукта нормального аллеля.

Известно, что у млекопитающих факторы NXF2 и NXF3, специфичные для семенников, отличаются от фактора NXF1 либо последовательностью LRR, либо С-терминальной частью молекулы. Цитоплазматическая локализация соответствующих белков предполагает существование цитоплазматических функций (Herold et al., 2000;

Sasaki et al., 2005) и наличие цитоплазматических белков-партнеров.

Полиморфизм продуктов как возможный источник плейотропного действия гена Dm nxf1 (sbr).

Полиморфизм транскриптов гена Dm nxf1 (sbr) Существование аллелей гена sbr, характеризующихся специфичными доминантными проявлениями и сложными межаллельными взаимодействиями, позволило предположить, что специализация функций гена Dm nxf1 может происходить за счет существования дополнительных продуктов гена. Известно, что благодаря полиморфизму транскриптов и белковых продуктов функциональные возможности гена значительно расширяются (Cceres, Kornblihtt, 2002). К источникам полиморфизма транскриптов можно отнести:

альтернативный сплайсинг (включая сохранение интронов), использование альтернативных промоторов или терминаторов транскрипции, использование альтернативных сайтов полиаденилирования и изменение степени полиаденилирования. Для генов семейства nxf описаны почти все названные источники полиморфизма транскриптов (Herold et al., 2000;

Jun et al., 2001;

Sasaki et al., 2005), однако связь полиморфизма со специализацией белков данного семейства определена недостаточно.

Для проверки предположения о том, что гену sbr (Dm nxf1) может соответствовать несколько продуктов, используя метод Нозерн-блот гибридизации, исследовали характер экспрессии гена на уровне транскрипции в зависимости от органа, части тела или стадии онтогенеза (Иванкова и др., 2009;

Ivankova et al., 2010).

Поскольку мутанты по гену sbr характеризуются, прежде всего, дефектами репродуктивной и нервной систем, мы анализировали экспрессию гена sbr в семенниках, яичниках и головах взрослых насекомых, а также в нервных ганглиях и слюнных железах личинок третьего возраста. Для анализа экспрессии гена sbr разделенную путем гель-электрофореза тотальную РНК из исследуемых образцов гибридизовали с двумя зондами: P1 (фрагмента SacI-XbaI из геномного субклона DS03615) и AJ (кДНК sbr).

Характер экспрессии локуса small bristles По результатам Нозерн-блот-анализа гену sbr соответствуют, по крайней мере, четыре транскрипта, размеры которых 1,9 т.н., 2,8 т.н., 3,0 - 3,5 т.н. и 5,1 т.н.

(Рис. 4). Транскрипт 3,5 т.н. представлен во всех исследуемых нами образцах и вероятно соответствует известной мРНК sbr – 3283 н. (GenBank AJ251947, AJ318090, NM_079921) (Herold et al., 2001;

Korey et al., 2001;

Wilkie et al., 2001), варьирование размера транскрипта в интервале 3,0 - 3,5 т.н. может быть связано с характером и степенью цитоплазматического полиаденилирования. С таким предположением согласуется присутствие в 3UTR мРНК sbr сайтов цитоплазматического полиаденилирования.

1 2 3 Рисунок 4. Транскрипты гена Dm nxf1 (sbr) М (н.) Drosophila melanogaster, выявляемые в различных органах личинок и имаго методом Нозерн-блот гибридизации c зондом AJ (Ivankova et al., 2010) Примечание: М – молекулярные маркеры с указанием размера в нуклеотидах;

1– РНК из яичников взрослых самок в различных концентрациях;

2 - РНК из семенников взрослых самцов;

3 – РНК из нервных ганглиев личинок третьего возраста;

4 - РНК из слюнных желез личинок третьего возраста.

Три других транскрипта – 1,9 т.н., 2,8 т.н. и 5,1 т.н. являются специфичными. Если транскрипты 1,9 т.н. и 2,8 т.н. характерны для семенников, то транскрипт 5,1 т.н. по нашим данным специфичен для нервной системы.

Появление специфичных транскриптов возможно определяется специализацией соответствующих белковых продуктов в отношении особых мРНК или связано с особенностями посттранскрипционной регуляции экспрессии самого гена Dm nxf1.

Локус small bristles в геноме D.melanogaster является генетически сложным.

В данном локусе располагается несколько предсказанных генов (Flybase, 2009), и гену sbr соответствует предсказанный ген CG1664. Данный ген включает экзонов и 9 интронов (Herold et al., 2001) (Рис.5) и имеет протяженность 14 п.н. Предполагаемая полностью сплайсированная мРНК sbr (кДНК, CG1664-RA, EMBL) включает 5UTR (504 н.), 3UTR (760 н.) и кодирующую область гена (2019 н.). Около 61% всей ДНК гена приходится на интрон 3-4 размером 8892 н.

Рисунок 5. Структура локуса sbr у Drosophila melanogaster. Указаны размеры экзонов и интронов в н.п.

Сперматогенез нуждается в существовании тканеспецифичных изоформ NXFs Согласно нашим данным (Ivankova et al., 2010) в семенниках представлены специфичные мРНК sbr - 1,9 т.н. и 2,8 т.н., в то время как соответствующие короткие транскрипты Hs nxf1 и Mm nxf1 не описаны (Herold et al. 2001;

Sasaki et al., 2005). Возможно, существование транскриптов гена Dm nxf1 (sbr), специфичных для семенников, отражает начальные этапы дивергенции генов nxf в пределах генного семейства. У млекопитающих специализация функций произошла за счет появления специализированных генов-паралогов nxf2 и nxf3, экспрессия которых наблюдается в семенниках или и в семенниках и мозге (Herold et al., 2000;

Wang et al., 2001;

Sasaki et al., 2005).

Характеристика интрона 5-6 Dm nxf1: структура, эволюционная консервативность и функциональная значимость Мы предположили, что транскрипт 5,1 т.н. включает интрон 5-6 (1602 н.).

Аналогичный вариант сплайсинга описан для генов Mm nxf1 мыши (Sasaki et al., 2005) и Hs nxf1 человека (Li et al., 2006), являющихся ортологами гена Dm nxf дрозофилы (Herold et al., 2000). Сохранение интрона – одна из форм альтернативного сплайсинга (Black, 2003;

Forrest et al., 2004;

Galante et al., 2004;

Hiller et al., 2005;

Ohler et al., 2005). Интрон-содержащие мРНК имеют ограничения на этапе транспорта из ядра в цитоплазму и в период трансляции (Chang et al. 1990;

Hammarskjld, 2001). Однако РНК вирусов, содержащие интроны, экспортируются из ядра благодаря тому, что содержат последовательность СТЕ (constitutive transport element), которая непосредственно взаимодействует с белком Hs NXF1 (ТАР), участвующим в экспорте клеточных мРНК (Grter et al., 1998).

мРНК Hs nxf1, содержащая интрон 10-11, активно транслируется в культуре клеток и производит белок, состоящий из 356 а.к., из которых 18 С-терминальных аминокислот соответствуют последовательности интрона 10-11, предшествующей первому стоп-кодону в данном интроне (Li et al., 2006).

Выравнивание ортологичных последовательностей показало, что, как у H.sapiens, так и у M.musculus в генах Hs nxf1 и Mm nxf1 экзоны 10 и соответствуют экзонам 5 и 6 в гене sbr (Dm nxf1) (Herold et al., 2000;

Sasaki et al., 2005). Причем у всех трех видов существует не только гомология, но и соответствие размеров экзонов, между которыми не вырезается интрон. Экзон, расположенный слева от невырезанного интрона 5-6 (Dm nxf1) или 10-11 (Hs nxf и Mm nxf1), составляет 110 н., а экзон, расположенный справа - 37 н. (Рис.5).

Cохранение гомологичных интронов в транскриптах ортологичных генов nxf является консервативным в эволюции, указывая на функциональную значимость не только интрона, сохраняемого в транскриптах, но и всего блока экзонов и интрона между ними.

Состав альтернативных транскриптов гена sbr (Dm nxf1) Сохранение интрона в транскрипте 5.1 т.н.

Предположение о том, что транскрипт 5,1 т.н. является результатом недосплайсинга и сохраняет интрон 5-6, подтвердили, используя метод ОТ-ПЦР.

Нам не удалось амплифицировать фрагмент, содержащий интрон 5-6 целиком, возможно, из-за сложной вторичной структуры, которую формирует РНК, в состав которой входит данный интрон. Для доказательства включения интрона 5 6 в состав транскриптов гена sbr использовали пару праймеров, один из которых – прямой - ex4 (F1) - локализован в экзоне 4, а другой – обратный - in5-6 (R) - в интроне 5-6. В качестве исходного материала служила РНК, выделенная из семенников или из голов и яичников взрослых мух. Показали, что если в качестве исходного материала используется РНК, выделенная из голов и яичников взрослых особей, то амплифицируется фрагмент размером 659 п.н., а если РНК, выделенная из семенников, то фрагмент ожидаемого размера присутствует в незначительном количестве (Рис. 6А).

По результатам секвенирования полученный фрагмент содержит часть интрона 5-6, экзон 5 и часть экзона 4 и не содержит интрон 4, что подтверждает РНКовое происхождение фрагмента. Аналогичные результаты получены при использовании прямого праймера в экзоне 1 - ex1 (F) - и обратного в интроне 5-6.

Специфичный для семенников транскрипт 2,8 т.н.

К появлению коротких транскриптов, специфичных для семенников, может привести: использование альтернативного промотора, альтернативный сплайсинг, приводящий к вырезанию экзона(ов) или части экзона(ов) и использование альтернативного сайта терминации транскрипции или полиаденилирования.

Методом ОТ-ПЦР, используя два разных прямых праймера в экзоне 4 - ex4 (F1) или ex4 (F2) - и обратный праймер - ex10 (R4), комплементарный некодирующей последовательности экзона 10 (Рис. 7), показали, что в семенниках D.melanogaster отсутствуют полноразмерные транскрипты гена Dm nxf1 (Рис. 6Б).

1 2 3 М (н.п.) М 1 2 3 4 5 М М А Б Рисунок 6. Результаты ОТ ПЦР при определении сохранения интрона 5-6 в транскриптах гена sbr (Dm nxf1), присутствующих в разных органах или частях взрослых особей D.melanogaster (Аванесян, 2009) А–Праймеры- ex4 (F1) и in5-6 (R). Ожидаемый размер фрагмента –659 п.н. Дорожки соответствуют вариантам ОТ-ПЦР с использованием РНК из разных органов и частей тела взрослых особей D.melanogaster:1 – семенники;

2 – головы;

3 – яичники (А);

нечетные – семенники, четные – головы (Б). М – шкала размера транскриптов (н.п.). Б- Дорожки 1 и 2 :

праймеры - ex1 (F) и ex5 (R). Ожидаемый размер фрагмента – 973 п.н. Дорожки 3 и 4 :

праймеры - ex4 (F1) и ex10 (R4). Ожидаемый размер фрагмента – 1951 п.н. Дорожки 5 и 6 :

прямой праймер - ex4 (F2) и ex10 (R4). Ожидаемый размер фрагмента–1549 п.н.

Результаты ОТ-ПЦР позволили заключить, что транскрипты гена Dm nxf1, присутствующие в семенниках, укорочены с 3'-конца. Это предположение подтвердили результаты ОТ ПЦР с использованием прямого праймера - ex9 (F), и пяти обратных праймеров в экзоне 10 (Рис.7).

Результаты ОТ-ПЦР позволили заключить, что транскрипты гена Dm nxf1, присутствующие в семенниках, укорочены с 3'-конца. Это предположение подтвердили результаты ОТ ПЦР с использованием прямого праймера - ex9 (F), и пяти обратных праймеров в экзоне 10 (Рис.7).

Поскольку размер транскрипта уменьшается за счет 3'UTR, транскрипту 2, т.н. может соответствовать полноразмерный белок Dm NXF1 (SBR) известной молекулярной массы 74 kDa. Укороченные транскрипты гена Dm nxf1, присутствующие в семенниках, лишены последовательностей, важных для осуществления цитоплазматического полиаденилирования и регуляции их трансляции (Рис. 7).

Специфичный для семенников транскрипт 1,9 т.н.

Размер самого короткого транскрипта (1,9 т.н.), специфичного для семенников, свидетельствует об альтернативном сплайсинге или использовании альтернативного промотора. Поскольку, используя разные пары праймеров, мы не смогли выявить случаи альтернативного сплайсинга, способного сделать 5 AUCGCAUAGGAGUUUCCGUAGGACAGAGCCGCGUGCCACATCCACATAATCGAATGCUGUUUUUUUUU UUUUGGUUUUGUAAUUAAAUUUUAAAAUUAUUAGAGAAACCUCUAUAUAAUAAUAAUAAUUAAUAUUA UUAAGCUGCGAAGUUGUGUGCACAUUCGGGCAGUAGCAAUUAUUAUCCCAGCACUGCGGGCAAUGUGC AUCAACGAUCACAGUUCUUCGAUAGAUUAGUUUAGCUCUCUUUAAGUUCCGUCCGCAGAUCCGCUGGU CUACAUUGAGGCCAGGACGAGUCUGCGAACGGUAGUCCCUUUAGAGUUAAAGUUGUUUUAGAUUCCUA AGCCAAACACCUUCAAACACACACAACACGACAACACUAUUAAACGUAAUGCAACAAUGUUGUCGAAU CGAAAGAAACCCAAUUUUUAUUUUAAUAUAUACGACGAUACCGAAACCAAGGCGAUGGUCGAAAAGCA UGGAUCGCGCCAAUAAUUCUAUAUUCCCCGCUUUCCCAGAUCCUCGACUCGCCUUACAUUUUGUAUAC AAAUACCAUAGAAUAAAAAGAAACAUUUUGACCACUGUAAAAAUUUUGUAACGCUCGGAAACCAAAAU UACCUUUAUUUCUUAAUAGAAAAAAAUUAUUCGAUUUACAAUACACGCUUAGCCGUAAAUUCAAUUGA AUUUAAGUGUAAGAUAUAUAAAAAUUAUAUACAUUAAGACAAAAGUGUAGAUUCAUAAAUAAAUUUUU CAGAAUAGAAU - Рисунок 7. Фрагмент последовательности мРНК Dm nxf1, соответствующий 3 нетранслируемому району (3UTR) Примечание: жирным шрифтом выделены: последовательности отвечающие за цитоплазматическое полиаденилирование транскриптов – это СPЕ – cytoplasmic polyadenylation element – UUUUUAU, взаимодействующий с фактором CPEB – CPE-binding protein и два гексануклеотида (AAUAAA), взаимодействующие с фактором CPSF – cytoplasmic polyadenylation stimulator factor;

темно-серым цветом отмечены последовательности, комплементарные обратным праймерам, не дающим результата при проведении ОТ-ПЦР на основе РНК из семенников;

серым – последовательности, комплементарные обратным праймерам, позволяющим получить амплифицируемый фрагмент во всех исследуемых пробах.

транскрипт гена Dm nxf1 почти вдвое короче полноразмерного, стали проверять гипотезу существования альтернативного промотора, тем более, что в интроне 3- такие последовательности предсказаны программой поиска промоторов (Promoter 2.0 Prediction Server. Vector NTI) и такое предположение существовало до 2000 г.

(Herold et al., 2000;

Третьякова, 2000).

Для проверки существования альтернативного промотора в интроне 3-4 мы старались выбрать такой прямой праймер, который находился бы максимально близко к 3-концу интрона 3-4, а обратный - в экзоне 7 (Рис. 8). Фрагмент ожидаемого размера выявляется только в пробах из семенников, где при считывании мРНК sbr с альтернативного промотора может появиться укороченный транскрипт (1,9 т.н).

Характер экспрессии гена Dm nxf1 в семенниках отражает общие тенденции генной экспрессии, свойственные данному органу. Многие гены в сперматогенезе часто используют альтернативные сайты инициации и терминации транскрипции (Kleene, 2005). Характерным для семенников является наличие транскриптов, укороченных по сравнению с транскриптами тех же генов, присутствующих в других органах (Steger, 1999;

Kleene, 2003, 2005).

Полиморфизм транскриптов предполагает существование и полиморфизма белковых продуктов гена sbr (Dm nxf1). Для идентификации альтернативных белковых продуктов, выполняющих по нашему предположению специализированные функции, необходимо было получить антитела к белку SBR.

(п.н.) М 1 2 Рисунок 8. Результаты, полученные методом ОТ ПЦР при определении структуры коротких транскриптов гена sbr (Dm nxf1), присутствующих в семенниках 1000 взрослых особей D.melanogaster (Аванесян, 2009).

Прямой праймер локализован в интроне 3-4, обратный - в экзоне 7. Ожидаемый размер фрагмента – 846 н.

Дорожки соответствуют вариантам ОТ-ПЦР с использованием РНК из разных органов и частей тела взрослых особей D.melanogaster: 1 – семенники, 2 – головы Полиморфизм белковых продуктов гена Dm nxf1 (sbr) Полученные нами антитела к С-терминальному участку белка позволили методом Вестерн-блот анализа выявить у D.melanogaster во всех образцах, полученных из разных органов и частей тела, универсальную (74 kDa) форму белка SBR, а также специфичную для семенников (62 kDa) короткую форму данного белка (Рис. 9). Можно предположить, что короткой форме белка SBR соответствует короткий транскрипт 1,9 т.н., выявляемый в семенниках методом Нозерн-блот-анализа (Рис. 4).

Рисунок 9. Результаты Вестерн-блот-анализа экспрессии гена sbr в разных органах и частях тела взрослых самок и самцов D. melanogaster в зависимости от генотипа (Касаткина, 2007) М – маркер молекулярной массы. На дорожки нанесены пробы из: 1 – яичников (+/ +);

2 – голов самцов (sbr12 / Dp(1;

Y) y+ v+) ;

3 – голов самцов (FM6 / Dp(1;

Y) y+ v+) ;

4 – семенников (sbr12 / Dp(1;

Y) y+ v+), 5 - семенников (FM6 / Dp(1;

Y) y+ v+).

Примечание: стрелки указывают на полноразмерную и укороченную формы белка SBR.

Транскрипту может соответствовать белок, содержащий 536 а.к., вместо а.к.. Молекулярная масса короткого белка может составлять около 60 kDa, что подтверждено нами методом Вестерн-блот-анализа (Рис. 9).

Полученные нами антитела позволяют идентифицировать только белковые продукты гена Dm nxf1 (sbr), содержащие аминокислотную последовательность, соответствующую большей части экзона 9. Однако, исходя из возможных вариантов транскриптов данного гена, можно ожидать, что гену Dm nxf1 (sbr) соответствуют и другие белковые продукты (Рис. 10).

Заключение Механизмы и источники плейотропного действия генов Среди генов довольно часто встречаются такие, которые влияют на проявление нескольких признаков. Это явление назвали плейотропией (Dobzhansky, Holz, 1943;

Caspari, 1952). Крайняя степень плейотропии проявляется в том, что один и тот же ген может влиять на две (или более) особенности организма, на первый взгляд не связанные между собой.

Центральный вопрос плейотропии заключается в том, вызваны ли плейотропные эффекты генов множеством молекулярных функций, или эти эффекты являются следствием нарушения одной и той же функции, вовлеченной во множество клеточных процессов (Dudley et al., 2005;

van de Peppel, Holstege, 2005).

Гены, участвующие в контроле разнообразных клеточных процессов, вовлечены в сеть взаимодействий (Van de Peppel, Holstege, 2005).

Взаимодействующие белковые продукты генов образуют протеом (Freatherstone, Brodie, 2002;

Von Mering, 2002).

M(499)I T(493)S P(139)L Df(1)sbr sbr 10 sbr Df(1)sbr экзоны 4 5 6 78 9 1 2 Ген sbr 5UTR 3UTR (Dm nxf1) Домены RBD LRR NTF2-like UBA-like б SBR Полноразмерный 5UTR 3UTR 3,2 т.н.

2,8 т.н. 3UTR 5UTR Семенниково специфичные 1,9 т.н. 3UTR 5UTR Нейро 5UTR 3UTR специфичный 5,1 т.н.

Рисунок 10. Структура гена Dm nxf1 (sbr) и его возможных продуктов.

Примечание:

Домены: RBD (RNA-binding domain) - РНК-связывающий;

LRR – leucine rich repeats - лейцин богатые повторы;

NTF2-like (NTF – nuclear transport factor) –похожий на фактор ядерного транспорта;

UBA-like (UBA- ubiquitin associated) - похожий на последовательность, взаимодействующую с убиквитином.

Цветом обозначены транслируемые участки. Пунктирной линией показан сохраненный интрон 5-6.

Линией показан фрагмент последовательности, который использовали при получении антител.

Протеом – система более динамичная, чем геном. Она изменяется в развитии, реагирует на внешние воздействия. В протеоме белки регулируют и дополняют друг друга (Otto, 2004). Гены с высокой степенью плейотропии часто кодируют белки, находящиеся в составе различных белковых комплексов.

Выявление специфических белковых взаимодействий или взаимодействующих партнеров является определяющим для понимания механизмов плейотропного действия гена.

Существование нескольких продуктов гена может создавать предпосылки для эволюционной дивергенции в пределах генного семейства. Специфичность транскриптов гена sbr (Dm nxf1) в отношении нервной системы и семенников не является удивительным, поскольку более высокая сложность транскриптома и протеома, характерная для нервных и генеративных клеток, обеспечивает большую пластичность данных систем.

Специфичным транскриптам могут соответствовать и специфичные белковые продукты. Использование полученных нами антител к С терминальному фрагменту полноразмерного белка Dm NXF1 (SBR) позволило идентифицировать два белковых продукта – полноразмерный - 74 kDa (672 а.к ) и специфичный для семенников около 60 kDa, который, по нашему предположению, соответствует семенниково-специфичному транскрипту 1,9 т.н.

К сожалению, полученные нами антитела не позволяют ответить на вопрос, соответствует ли нейроспецифичному транскрипту – 5.1 т.н. еще одна форма белка SBR, которая включает только его N-терминальную часть (домены RBD и LRR) (Рис. 10). Поскольку во всех (выявленных и предполагаемых) продуктах гена sbr (Dm nxf1) сохраняются домены, отвечающие за взаимодействие с РНК, можно предположить, что утрата тех или иных последовательностей белка SBR может привести к специализации соответствующего продукта в отношении определенных РНК и неспособности укороченного продукта к выполнению универсальной функции.

Еще одним источником плейотропного действия гена может быть взаимодействие с различными белками-партнерами. Поскольку в молекуле NXF существуют дискретные области, отвечающие за взаимодействие с соответствующими факторами, можно предположить, что повреждения определенной области белковой молекулы в результате мутации, приводящие к нарушению таких взаимодействий, могут блокировать только ту функцию полифункционального фактора, которая от этого взаимодействия зависит. В результате фенотипы мутантов могут оказаться настолько различными, что на первый взгляд трудно представить, что это мутации одного и того же гена.

Существование функциональной независимости отдельных частей молекулы может приводить к разным эффектам у мутантов.

Функции факторов NXF и возможные пути их специализации Известно, что N-терминальная половина белка NXF1 (TAP) функционально независима от C-терминальной половины молекулы (Bear et al., 1999). N терминальная часть представлена доменами RBD и LRR (Рис. 10). Участок, предшествующий RBD, является наиболее дивергентным в семействе NXF (Jun et al., 2001). В этом районе в белке Hs NXF1 располагаются последовательности, соответствующие сигналу ядерной локализации - NLS (nuclear localization signal) и сигналу ядерного экспорта – NES (nuclear export sequence) (Bear et al., 1999;

Kang, Cullen, 1999;

Katahira et al., 1999;

Tan et al., 2005).

Использование альтернативного промотора локализованного в интроне 3- приводит к появлению коротких транскриптов гена Dm nxf1, которым могут соответствовать белковые продукты, лишенные участка, примыкающего слева к домену RBD. Это может приводить к ограничению функций и специализации соответствующих коротких белков (Рис. 10).

Согласно нашим данным изменения С-терминального домена приводит к нарушению таких специализированных функций, как формирование аппарата деления клетки, образование подвижных сперматозоидов и сексуальное поведение самцов. Это свидетельствует о функциональной сложности С терминальной части молекулы Dm NXF1 и ее значении в формировании специализированных функций.

Присутствие в белке Dm NXF1 дискретных структурно-функциональных элементов позволяет предположить, что специализация факторов NXF может происходить за счет утраты определенных частей молекулы, не нужных, а возможно и мешающих выполнению специализированных функций.

Утрата N- или/и С-терминальной части полноразмерного белка может приводить к нарушению способности белка попадать в ядро или выходить из ядра, сохраняя в той или иной степени способность к взаимодействию с РНК.

Со специализированными функциями гена sbr (Dm nxf1) можно связать такие фенотипы мутантных аллелей, как:

1. Повышенная частота анеуплоидных потомков (Мамон и др., 1990;

Никитина и др., 2003а;

Пугачева, Мамон, 2005;

Кьергаард, Мамон, 2007) 2. Дефекты веретена мейотического деления (Golubkova et al., 2009) 3. Аномалии эмбриональных митозов (Golubkova et al., 2006) 4. Повышенная частота яиц с одним пронуклеусом (Golubkova et al., 2006) 5. Мужская стерильность (Tretyakova, Mamon, 1998;

Касаткина, 2007) 6. Нарушение памяти (Никитина и др., 2003б) 7. Временная атаксия взрослых особей, гомозиготных по аллелю l(1)ts (sbr ) при тепловом воздействии (Мамон и др., 1999).

Возможность регуляции экспрессии генов на уровне трансляции делает реализацию наследственной информации относительно независимой от процесса транскрипции. Такая независимость особенно важна в периоды, когда-либо не идет транскрипция, как при формировании генеративных клеток или в период ранних эмбриональных митозов у ряда животных, либо в том случае, когда процессы транскрипции и трансляции разобщены во времени и пространстве, как в крайне поляризованных нервных клетках и сперматозоидах. Способ сохранения, передачи и реализации наследственной информации в виде комплексов РНП является эволюционно очень древним (Spirin, 1969), и для полной автономности ему не хватает способности к редупликации.

Эволюционно консервативному гену Dm nxf1 (sbr) D.melanogaster, как и ортологичным генам человека Hs NXF1 и мыши Mm nxf1, соответствуют, помимо универсального, и специфичные продукты, что может отражать этапы эволюционной дивергенции в пределах семейства генов nxf. У D.melanogaster нами описаны семенниково-специфичный транскрипт и белок, а также нейроспецифичный транскрипт, в то время как у человека и мыши существуют паралогичные гены nxf2 и nxf3, Hs nxf5, Mm nxf7, экспрессия которых специфична для семенников или мозга. Выявленный и предполагаемый полиморфизм продуктов гена nxf1 отражает функциональную сложность транскриптома и протеома, характерную для нервной и репродуктивной систем и может служить источником возникновения специализированных функций.

Нами высказано предположение о том, что фактор Dm NXF1, кроме универсальной функции – обеспечение ядерно-цитоплазматического транспорта большинства мРНК из ядра в цитоплазму – выполняет и специализированные цитоплазматические функции. Данное предположение основывается на плейотропных эффектах мутантых аллелей гена Dm nxf1 и находит подтверждение в цитоплазматической локализации фактора Dm NXF1 (Голубкова и др., 2009).

Выводы 1. Эволюционно консервативный ген Dm nxf1 (sbr) D.melanogaster, известной функцией которого является ядерно-цитоплазматический транспорт мРНК, вовлечен в контроль расхождения хромосом в клеточных делениях.

2. Нарушение стресс-реакции на тепловое воздействие у теплочувствительного мутанта l(1)ts403 (sbr ) не является причиной хромосомной нестабильности.

3. Ген Dm nxf1 (sbr) оказывает материнское влияние на характер эмбриональных митозов у ранних эмбрионов: присутствуя в одной дозе, теплочувствительный аллель sbr10 вызывает при пермиссивной температуре нарушение эмбриональных митозов у потомков самок, гетерозиготных по мутации sbr10 и делеции, удаляющей ген Dm nxf1 (sbr).

4. Продукты гена Dm nxf1 (sbr) участвуют в формировании компонентов сперматозоида, повышающих после попадания в яйцеклетку частоту анеуплоидных потомков с нарушенным числом и набором не только отцовских, но и материнских хромосом.

5. Выявленный полиморфизм транскриптов и белковых продуктов гена Dm nxf1 (sbr), проявляющих органоспецифичность, рассматривается как основа формирования соответствующих специализированных функций. Определены структурно-функциональные элементы в транскриптах и белковых продуктах гена Dm nxf1 (sbr), комбинация которых может приводить к появлению специфичных продуктов данного гена.

6. Важную роль в выполнении специализированных функций играет С терминальная части молекулы Dm NXF1. Делеции, удаляющие часть С терминальной половины гена Dm nxf1 (sbr), характеризуются специфичными доминантными эффектами: делеция sbr5 вызывает образование трехполюсных мейозов у самок, а делеция sbr12 нарушает фертильность и половую активность самцов.

7. Предложена гипотеза об эволюционной дивергенции и специализации фактора Dm NXF1 (NXF – Nuclear eXport Factor): продукты гена Dm nxf1 могут находиться в составе комплексов РНП, сопровождая особые мРНК не только при ядерном экспорте, но и в цитоплазме, что особенно важно для сперматогенеза, оогенеза, нейрогенеза, раннего эмбриогенеза и при регуляции клеточных делений.

Список публикаций по материалам диссертации 1. Мамон Л.А., Мазур Е.Л., Чуркина И.В., Барабанова Л.В. Влияние высокой температуры на частоту нерасхождения и потерь половых хромосом у самок Drosophila melanogaster линии l(1)ts403 с дефектом в системе белков теплового шока // Генетика.-1990.-Т.26. № 3.-С.554-556.

2. Мамон Л.А., Барабанова Л.В. Неслучайное распределение спонтанных и индуцированных высокой температурой рецессивных летальных мутаций в X хромосоме дрозофилы // Генетика. -1991.-Т.27.-№ 9.-С.1541-1546.

3. Мамон Л.А., Куцкова Ю.А. Динамика индукции и регрессии пуфов 87А, 87С и 93D в политенных хромосомах дрозофилы Drosophila melanogaster при действии аноксии и высокой температуры//Цитология.-1991.-Т.33.-№12.-С.99-105.

4. Мамон Л.А., Барабанова Л.В., Костромина Н.Н. Частота нерасхождения и потерь половых хромосом в оогенезе у мутанта l(1)ts403 D. melanogaster с дефектом в системе белков теплового шока при действии аноксии и высокой температуры // Генетика.- 1992.- Т.28.- №4.- С.64-71.

5. Мамон Л.А., Куцкова Ю.А. Роль белков теплового шока в восстановлении индуцированных высокой температурой повреждений митотических хромосом у D. melanogaster//Генетика.-1993.-Т.29.- №4.- С.606-612.

6. Мамон Л.А., Куцкова Ю.А. Роль белков теплового шока в восстановлении клеточной пролиферации после воздействия высокой температурой на личинок D. melanogaster // Генетика.-1993.-Т.29.-№5.- С.791-798.

7. Тихомирова М.М., Мазур Е.Л., Барабанова Л.В., Мамон Л.А.

Температурная модификация мутационного процесса и белки теплового шока // Генетика. -1993.-Т.29.-№ 2.-С.280-287.

8. Тихомирова М.М., Ватти К.В., Мамон Л.А., Барабанова Л.В., Куцкова Ю.А. Механизмы, обеспечивающие устойчивость генетического материала клетки к стрессовым воздействиям // Генетика.- 1994.- Т.30.- № 8.- С.1097-1104.



Pages:   || 2 |
 




 
2013 www.netess.ru - «Бесплатная библиотека авторефератов кандидатских и докторских диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.